Nucleic Acids Research

Preparation of RNA

The P RNA from B.subtilis and the selected substrates were obtained by in vitro transcription using T7 RNA polymerase (11). The plasmids containing templates for #4, #8 and #17 were cloned and isolated from the initial selection experiment (7). The oligonucleotide template for a minimal construct of #22 was made by automated DNA synthesis. The sequence, 5[prime]-TGGTGCGAATTCTGAAGGGTGATTACCTTAGTTTTCGGTGCTATAGTGAGTCGTATTA (T7 promoter sequence underlined) encodes the 3[prime] 40 nt of #22 plus a 5[prime]G to improve transcription. This minimal construct has identical cleavage efficiency as the full-length #22 (data not shown).

Chemical modification using dimethylsulfate (DMS) and kethoxal (KE)

The P RNA and the substrates were renatured separately by heating at 85-90°C for 2 min followed by incubation at 22°C for 3 min. MgCl₂ was added to P RNA to appropriate concentrations and the mixture was incubated at 50°C for 10 min. MgCl₂, spermine or KCl were added to appropriate substrates followed by incubation at 37°C for 5 min. Each substrate was reacted with P RNA at 37°C for 15 min to ensure that substrate cleavage was complete and that the P RNA-3[prime] product complex was formed. Modification reactions were carried out using published protocols with minor modifications (12-14). Ten picomoles of P RNA in either the presence or absence of a substrate were modified with DMS or KE. The total reaction volume was 33 µl. The final concentration of tRNA, #4, #8 and #17 was >1 µM; that of #22 was 3 µM. These substrate concentrations are greater than four times the binding constant (~0.1 µM for #4 and #17, ~0.2 µM for #8 and ~0.8 µM for #22) as determined by non-denaturing gel electrophoresis. The final concentrations of DMS and KE were 105 mM (100-fold dilution from stock solution) and 15 mM (400-fold dilution), respectively. The reaction buffers were: (i) 30 mM HEPES, pH 7.9, 25 mM MgCl₂ for #4, #17 and #22; (ii) 30 mM HEPES, pH 7.9, 10 mM MgCl₂, 1 mM spermine for #8; (iii) 30 mM HEPES, pH 7.9, 100 mM MgCl₂, 0.6 M KCl for tRNA^Phe. Modification proceeded at 37°C for 5 min and was stopped by the addition of a 2.5-fold molar excess of [beta]-mercapto-ethanol over DMS or 2-fold molar excess of boric acid over KE. The mixtures were then ethanol precipitated using 3.3 µg E.coli tRNA as carrier. Pellets were resuspended in 150 µl of 50 mM K-acetate, 200 mM KCl, pH 7.0, and re-precipitated with ethanol three times. Samples were dried and resuspended in water prior to reverse transcription.

Reverse transcription of modified P RNA

Three DNA primers were used to visualize the modified P RNA. Primer 1 (5[prime]-AAATGTAAGTGGTCTAACGTT CTGTAA) was complementary to nt 381-401; primer 2 (5[prime]-AACCATCC CCTTGGAAGAATTGCC) was complementary to nt 256-279; and primer 3 (5[prime]-CGACTGCCGTCCTTTTTTCGGATG) was complementary to nt 127-149 of B.subtilis P RNA. Modified P RNA (1.7 pmol) and 0.72 pmol ³²P-labeled primer in 3.5 µl were heated at 93°C for 1 min in 15 mM Tris-HCl, pH 7.5, 1.5 mM EDTA followed by quick cool on ice for 4 min. Reverse transcription was carried out in 50 mM Tris-HCl, pH 8.3, 8 mM MgCl₂, 30 mM NaCl, 1 mM DTT, 200 µM dNTPs and 0.9 U of AMV reverse transcriptase (United States Biochemical) in 5 µl at 50°C for 10 min. The reaction was stopped by the addition of 5 µl gel loading buffer (9 M urea, 50 mM EDTA, 0.01% each of xylene cyanol FF and bromophenol blue). Samples were boiled for 1 min and quick cooled on ice for 3 min prior to electrophoresis on 8% polyacrylamide gels containing 7 M urea. The gels were dried and visualized using a PhosphorImager (Fuji Medicals).

Kinetics of the selected substrates

All reactions were performed under single turn-over conditions with 10-1000-fold molar excess of P RNA over the 5[prime] ³²P-labeled substrate. The detailed procedure of single turnover kinetics has been described by Loria and Pan (5).

Structural mapping by nucleases

These procedures have been thoroughly described by Pan and Jakacka (8).

Chemical modification of P RNA and P RNA-3[prime] product complexes

P RNA was chemically modified under three ionic conditions. Each condition was chosen to optimize binding between P RNA and each of its substrates. All three conditions contain Mg²⁺ concentrations significantly above that required for P RNA folding (9). Using three primers, ~85% of all nucleotide positions could be analyzed. Figures 1 and 2A summarize the B.subtilis P RNA modification pattern that resulted from DMS and KE modification at 37°C. Modifications are classified as strong or weak based on the intensity of the reverse transcriptase stops. Upon binding of the tRNA product, protection occurs at nucleotides A130, G180, G220 and A230 in the folding domain I of P RNA. This folding domain has been shown to directly interact with the T stem-loop of tRNA (4,5,15,16). Protection is also visible at nucleotides G258 and G259 in the CCA-3[prime] binding loop, L15 (17-19). Protection of nucleotides C53 and A54 in P4 can be attributed to P RNA interaction with the substrate residues around the cleavage site (3,4). The J5.1/7 region of B.subtilis P RNA is not conserved among bacterial P RNAs and protection of G82 and G84 in this region may be due to conformational changes that occur upon tRNA binding. Overall, our results agree well with those from Pace and co-workers (18) whose results were obtained under a different ionic condition and at lower temperature (50 mM HEPES, pH 7.8, 25 mM CaCl₂ and 1 M NH₄Cl, 0°C).

Chemical modification of P RNA reveals that binding of #4, #17 and #22 protects many of the same nucleotides as binding of tRNA (Figs 1 and 2B). In particular, nucleotides that are known to interact with the T stem-loop in tRNA, A130 and A230, are protected by all three substrates. #4 and #17 also protect nucleotides G258 and G259 in loop L15, the binding site of the CCA-3[prime]. #22 did not prevent modification of these nucleotides. This result agrees with the previous observation that the CCA-3[prime] of #22 has little effect on cleavage efficiency (7). Interestingly, protection of nucleotides G180, A185 and G220 differs for these three substrates. #17 binding protects all three residues; however, A185 is not protected by #22, and G180 and G220 are not protected by #4. These results suggest that the binding surfaces for these substrates overlap but are not identical.

Binding of #8 results in a unique protection pattern of P RNA (Figs 1 and 2C). Only three nucleotides are protected in the region known to bind tRNA. This result is consistent with the previous observation that little overlap exists between the binding site of #8 and that of tRNA (8). Interestingly, the deletion of nucleotides #62-239 does not affect binding of #8 to P RNA; however, this deletion has a large effect on the chemical step (8). It can therefore be assumed that protection of G82, G84 and G180 is induced by conformational change in P RNA rather than by substrate binding. Potential substrate binding site was identified using a P RNA construct containing nucleotides #240-401+#1-112 (10). This construct was modified while complexed with #8 and analyzed with a primer complementary to nucleotides #61-47 of P RNA. Extensive and strong protection is seen in the L1 region (Fig. 3C). This result provides physical evidence that #8 indeed interacts with the L1 region of P RNA.

Figure 3. Proposed secondary structure of #4, #17 and #22 with cleavage site motif (CS) and the T stem-loop like motif (hairpin loop, or HL-motif) shaded. The tRNA^Phe substrate used in this work is also included for comparison. The linker regions in these selected substrates are non-helical, in contrast to a tRNA. The cleavage site is located between the two highlighted residues. Partial digestion by T1 (solid arrows), V1 (open arrows) and S1 (stem and solid circles) nucleases for #17 and #22 are indicated by arrows.

Secondary structure and kinetic analysis of the selected substrates

The secondary structure of the selected substrates was probed with nucleases V1, T1 and S1 (Fig. 3). The nuclease mapping data is consistent with a secondary structure that contains a short helix around the cleavage site and a hairpin loop at the corresponding position of the T stem-loop in tRNA. These two helices are connected through a non-helical linker region that differs among these substrates.

The catalytic efficiency of the selected substrates is analyzed by single turnover kinetics (Table 1). Under these conditions, k_cat is pH dependent (data not shown) and may directly correlate with the chemical step, k₂. Assuming that the k_cat/K_m approximates the on-rate for substrate binding, k₁, the K_m [= (k_-1 + k₂)/k₁ under single turnover conditions] for #4 and #22 can be calculated to approximate K_d. However, it is likely that the dissociation rate, k_-1, of the tRNA and #17 substrates is comparable to k₂. The K_m for tRNA and #17 may, therefore, represent an overestimate of K_d. All selected substrates nevertheless appear to bind equally well or better than the tRNA substrate at 50 mM MgCl₂. The chemical step of the selected substrates, on the other hand, is significantly slower than that of a tRNA substrate. These results are consistent with the selection experiment in which binding is a far more dominant factor than the chemistry of the cleavage reaction (7). To test whether the protection observed in the chemical modification experiments faithfully detects direct ribozyme-substrate interaction, a P RNA double mutant of A185->G185/C186->U186 was tested kinetically (Table 1). Nucleotide A185 was protected by #4 and #17, but not by #22. Indeed, the K_m for #4 and #17 using the mutant P RNA increases by 36- and 8-fold compared to the K_m using the wild-type P RNA, whereas the K_m for #22 remains the same. K_m also increases by 8-fold for the tRNA substrate, suggesting that tRNA has another direct contact with P RNA that was not observed in the protection experiment. The protected nucleotides therefore only represent a fraction of all potential P RNA residues involved in substrate binding. The chemical step is not affected in the mutant, in agreement with our previous finding that disruption of a single interaction in the T stem-loop region has little effect on chemistry of the P RNA reaction (5). Since k₂ remains the same, the increased K_m for the mutant P RNA is likely to be due to faster k_-1. These K_m values therefore approximate K_d for all substrates. By this criteria, the G185U186 mutant affects binding of the tRNA and #17 substrates by >1.3 kcal/mol.

Table 1. P RNA cleavage of selected substrates under single turnover conditions

Substrate	Km (µM)	[Delta][Delta]G (kcal/mol)b	k2 (min-1)	[Delta][Delta]G (kcal/mol)c
P RNA (wild-type)a
tRNAPhe	0.24 ± 0.03	-	2.0 ± 0.1	-
#4	0.10 ± 0.03	-	0.30 ± 0.02	-
#17	0.046 ± 0.010	-	0.55 ± 0.02	-
#22	0.21 ± 0.05	-	0.08 ± 0.01	-
P RNA mutant (G185U186)a
tRNAPhe	2.0 ± 0.3	1.3	2.0 ± 0.3	0.0
#4	3.6 ± 0.4	2.2	0.36 ± 0.02	-0.1
#17	0.37 ± 0.10	1.3	0.71 ± 0.05	-0.2
#22	0.31 ± 0.08	0.3	0.039 ± 0.002	0.4

^aReaction conditions: 50 mM MES, pH 6.1, 50 mM MgCl₂, 0.2 M KCl (0 M for #22), 37°C.
^b[Delta][Delta]G = -RT ln [K_m(w.t. P RNA)/K_m(mutant P RNA)].
^c[Delta][Delta]G = -RT ln [k₂(mutant P RNA)/k₂(w.t. P RNA)].

Interaction of RNA structural modules

The coaxially stacked acceptor stem and T stem-loop in tRNA have been proposed to participate in P RNA binding as three distinct motifs: the cleavage site (CS) motif; the T stem-loop (TSL) motif; and a coaxially stacked linker region (Fig. 4; 8). The linker region in tRNA may be partially unstacked when tRNA is bound to P RNA (20,21). The secondary structure of the selected substrates, #4, #17 and #22, also contains the equivalents of the CS- and the TSL-motifs (Fig. 3). These two motifs are designated as structural modules in this work. The modules in a fourth selected substrate, #8, consist of a short helix around the cleavage site and a pseudoknot (8). The two modules in all selected substrates are connected through a non-helical linker region.

Figure 4. Interaction of structural modules in the P RNA-substrate complexes. The folding domains of P RNA are shown as light shaded ovals and the L1 region is shown as a dark shaded circle. The substrates are shown schematically with the cleavage site indicated by an arrow.

The two folding domains of P RNA can be thought of as two structural modules that bind substrate. Domain I of P RNA contacts the T stem-loop module of tRNA and, thus, confers substrate specificity. Domain II of P RNA directly contacts the acceptor stem/5[prime] leader module of tRNA. The two domains in P RNA bind the two modules in the selected substrates, #4, #17 and #22, in a similar fashion. Domain II of P RNA can additionally be broken down into two intradomain modules that bind substrate #8. One module contains the active site of P RNA and binds the cleavage-site module of #8. The other module contains the L1 region of P RNA and binds the pseudoknot module of #8 (Fig. 4).

The binding properties of P RNA revealed by studies with our selected substrates can be exploited to isolate new ribozyme-substrate pairs by in vitro selection. Substitution of one module in the ribozyme (e.g. the T stem-loop binding domain or the L1 region) may be compensated for by substitution of another module (e.g. the hairpin-loop module or the pseudoknot module) in the RNA substrate.

ACKNOWLEDGEMENTS

This work was supported by a grant from NIH (GM52993) and a Junior Faculty Research Award from the American Chemical Society (JFRA-543) L.O. is a recipient of an undergraduate summer research fellowship from Howard Hughes Medical Institute and from the Richter Fund.

REFERENCES

1. Altman,S., Kirsebom,L. and Talbot,S. (1993) FASEB J., 7, 7-14. MEDLINE Abstract

2. Pace,N.R. and Brown,J.W. (1995) J. Bacteriol., 177, 1919-1928. MEDLINE Abstract

3. Westhof,E. and Altman,S. (1994) Proc. Natl Acad. Sci. USA, 91, 5133-5137. MEDLINE Abstract

4. Harris,M.E., Nolan,J.M., Malhotra,A., Brown,J.W. and Pace,N.R. (1994) EMBO J., 13, 3953-3963. MEDLINE Abstract

5. Loria,A. and Pan,T. (1997) Biochemistry, 36, 6317-6325. MEDLINE Abstract

6. Liu,F. and Altman,S. (1994) Cell, 77, 1093-1100. MEDLINE Abstract

7. Pan,T. (1995) Biochemistry, 34, 8458-8464. MEDLINE Abstract

8. Pan,T. and Jakacka,M. (1996) EMBO J., 15, 2249-2255. MEDLINE Abstract

9. Pan,T. (1995) Biochemistry, 34, 902-909. MEDLINE Abstract

10. Loria,A. and Pan,T. (1996) RNA, 2, 551-563. MEDLINE Abstract

11. Milligan,J.F., Groebe,D.R., Witherell,G.W. and Uhlenbeck,O.C. (1987) Nucleic Acids Res., 15, 8783-8798. MEDLINE Abstract

12. Moazed,D., Stern,S. and Noller,H.F. (1986) J. Mol. Biol., 187, 399-416. MEDLINE Abstract

13. Ehresmann,C., Baudin,F., Mougel,M., Romby,P., Ebel,J.P. and Ehresmann,B. (1987) Nucleic Acids Res., 15, 9109-9128. MEDLINE Abstract

14. Stern,S., Moazed,D. and Noller,H.F. (1988) Methods Enzymol., 164, 481-489. MEDLINE Abstract

15. Nolan,J.M., Burke,D.H. and Pace,N.R. (1993) Science, 261, 762-765. MEDLINE Abstract

16. Pan,T., Loria,A. and Zhong,K. (1995) Proc. Natl Acad. Sci. USA, 92, 12510-12514. MEDLINE Abstract

17. Kirsebom,L.A. and Svard,S.G. (1994) EMBO J., 13, 4870-4876. MEDLINE Abstract

18. LaGrandeur,T.E., Huttenhofer,A., Noller,H.F. and Pace,N.R. (1994) EMBO J., 13, 3945-3952. MEDLINE Abstract

19. Oh,B.-K. and Pace,N.R. (1994) Nucleic Acids Res., 22, 4087-4094. MEDLINE Abstract

20. Kahle,D., Wehmeyer,U. and Krupp,G. (1990) EMBO J., 9, 1929-1937. MEDLINE Abstract

21. Gaur,R.K., Hanne,A., Conrad,F., Kahle,D. and Krupp,G. (1996) RNA, 2, 674-681. MEDLINE Abstract

---

*To whom correspondence should be addressed. Tel: +1 773 702 4179; Fax: +1 773 702 0439; Email: taopan@midway.uchicago.edu
⁺Present address: BCMB Program, The Johns Hopkins University School of Medicine, Baltimore, MD 21205, USA

---

This page is run by Oxford University Press, Great Clarendon Street, Oxford OX2 6DP, as part of the OUP Journals
Comments and feedback: www-admin{at}oup.co.uk
Last modification: 30 Jul 1998
Copyright©Oxford University Press, 1998.
CiteULike    Connotea    Del.icio.us    What's this?

This article has been cited by other articles:

				M. d. l. Pena, D. Dufour, and J. Gallego Three-way RNA junctions with remote tertiary contacts: A recurrent and highly versatile fold RNA, November 1, 2009; 15(11): 1949 - 1964. [Abstract] [Full Text] [PDF]

				S. A. Mortimer and K. M. Weeks C2'-endo nucleotides as molecular timers suggested by the folding of an RNA domain PNAS, September 15, 2009; 106(37): 15622 - 15627. [Abstract] [Full Text] [PDF]

				A. V. Kazantsev, A. A. Krivenko, D. J. Harrington, S. R. Holbrook, P. D. Adams, and N. R. Pace Crystal structure of a bacterial ribonuclease P RNA PNAS, September 20, 2005; 102(38): 13392 - 13397. [Abstract] [Full Text] [PDF]

				G. J. SMITH, T. R. SOSNICK, N. F. SCHERER, and T. PAN Efficient fluorescence labeling of a large RNA through oligonucleotide hybridization RNA, February 1, 2005; 11(2): 234 - 239. [Abstract] [Full Text] [PDF]

				A. S. Krasilnikov, Y. Xiao, T. Pan, and A. Mondragon Basis for Structural Diversity in Homologous RNAs Science, October 1, 2004; 306(5693): 104 - 107. [Abstract] [Full Text] [PDF]

				D. H. MATHEWS Using an RNA secondary structure partition function to determine confidence in base pairs predicted by free energy minimization RNA, August 1, 2004; 10(8): 1178 - 1190. [Abstract] [Full Text] [PDF]

				D. H. Mathews, M. D. Disney, J. L. Childs, S. J. Schroeder, M. Zuker, and D. H. Turner Incorporating chemical modification constraints into a dynamic programming algorithm for prediction of RNA secondary structure PNAS, May 11, 2004; 101(19): 7287 - 7292. [Abstract] [Full Text] [PDF]

				A. Loria and T. Pan Modular construction for function of a ribonucleoprotein enzyme: the catalytic domain of Bacillus subtilis RNase P complexed with B.subtilis RNase P protein Nucleic Acids Res., May 1, 2001; 29(9): 1892 - 1897. [Abstract] [Full Text] [PDF]

This Article Abstract Print PDF (285K) Alert me when this article is cited Alert me if a correction is posted Services Email this article to a friend Similar articles in this journal Similar articles in ISI Web of Science Similar articles in PubMed Alert me to new issues of the journal Add to My Personal Archive Download to citation manager Search for citing articles in: ISI Web of Science (24) Request Permissions Commercial Re-use Guidelines for Open Access NAR Content Google Scholar Articles by Odell, L. Articles by Pan, T. Search for Related Content PubMed PubMed Citation Articles by Odell, L. Articles by Pan, T. Social Bookmarking          What's this?