| Nucleic Acids Research | Pages |
The products of the yeast MMS2 and two human homologs (hMMS2 and CROC-1) define a structurally and functionally conserved Ubc-like protein family
Introduction
Materials And Methods
Saccharomycescerevisiae strains
Plasmids
DNA sequencing and sequence analysis
Northern hybridization
Cell killing and mutagenesis assays
Mammalian cells culture and c-fos-CAT assays
Results
Identification of hMMS2
hMMS2 and CROC-1
Tissue distribution of the hMMS2 transcript
Functional complementation of an mms2 mutant by hMMS2 and CROC-1
Functions of MMS2 and hMMS2 in mammalian cells
Discussion
Acknowledgements
References
The products of the yeast MMS2 and two human homologs (hMMS2 and CROC-1) define a structurally and functionally conserved Ubc-like protein family
ABSTRACT
INTRODUCTION
Ubiquitin (Ub) is a highly conserved 76 residue protein and is found in eukaryotic cells either as an unbound molecule or covalently joined to a variety of proteins (for reviews see 1-3). Ub conjugation has been shown to participate in many eukaryotic metabolic processes, including ribosome biogenesis (4), mating type regulation (5), cell cycle control (6), DNA repair (7) and other responses (8). Ub is bound to the ubiquitin-activating enzyme (E1), which activates Ub and enables it to bind to the ubiquitin-conjugating enzyme (Ubc or E2). A single cysteine residue in a highly conserved region of Ubc is absolutely required to bind Ub via a thioester bond and attach it to the target molecule. In most cases, a third protein or protein complex is required as a ubiquitin ligase enzyme (E3) to select and polyubiquitinate target proteins for degradation (1-3,9).
There are at least 13 different E2 enzymes in the yeast Saccharomyces cerevisiae, most of which confer distinct and non-overlapping functions, although some Ubc functions may be redundant, e.g. Ubc4 and Ubc5 (10) and Ubc6 and Ubc7 (11). All known eukaryotic E2 enzymes are highly conserved in their primary sequence, especially around the active Cys residue region (1,2) and their core tertiary structures are also conserved (11-13). In contrast, E3 enzymes may consist of either a single polypeptide, such as Ubr1 (14), or a complex of several subunits, such as SCFCdc4 (15,16) or APCCdc20 (17,18), none of which share apparent sequence homology. However, all known E3 enzymes are able to form a complex with a specific E2 to target distinct protein substrates for degradation (14-18).
Recently, Ub-like proteins have been found in many eukaryotes. Like Ub, these proteins (e.g. Smt3 and Rub1 from yeast) also participate in post-translational modification of cellular proteins through biochemically conserved but genetically distinct E1 and E2 enzymes (for recent reviews see 19,20). Ubc9 conjugates Smt3 in vivo (21,22), which appears to be involved in subcellular localization of the target protein (23). Similarly, Ubc12 is required for Rub1 conjugation to Cdc53, which is probably involved in cell cycle regulation (24,25). Interestingly, eukaryotic genes encoding Ubc-like proteins were also identified recently. CROC-1 was isolated from a human cDNA library by its ability to transactivate a c-fos promoter via the 8 bp tandem repeat enhancer element (26). The same gene (also known as UEV-1 and CIR1) was subsequently isolated and characterized by differential display techniques and found to be decreased in HT-29-M6 human colon carcinoma cells undergoing differentiation (27) and to be increased in SV40-transformed human embryonic kidney cells undergoing immortalization (28). Furthermore, overexpression of the CROC-1 gene in HT-29-M6 cells inhibits the activity of the mitotic kinase cdk1 and cell differentiation (27). These results collectively suggest a role for CROC-1 in mammalian cell proliferation and differentiation. However, it remains to be determined if the biological effects of CROC-1 are solely due to its transactivation activity of c-fos (26) or inhibition of cdk1 activity (27). In parallel, an S.cerevisiae homolog of CROC-1, denoted MMS2, was independently isolated (29) by complementation of the mms2-1 mutant (30), which was sensitive to killing by methyl methanesulfonate (MMS), a DNA alkylating agent. The yeast MMS2 gene is involved in protection of cells from a variety of DNA damage, since disruption of the MMS2 gene not only results in an increased killing by MMS and UV irradiation, but also dramatically increases the spontaneous mutation rate (29). Genetic analyses indicate that MMS2 functions in the error-free post-replication repair (PRR) branch of the RAD6 pathway (29), but its exact biochemical activity remains to be determined.
Although CROC-1 and Mms2 share significant amino acid sequence homology with Ubcs (up to P = 10-7) and their size and predicted secondary and tertiary structures resemble E2 enzymes (27), CROC-1 and Mms2 lack the active site cysteine residue within the highly conserved Ubc motif; indeed, neither CROC-1 nor Mms2 appears to confer Ubc activity in an in vitro assay (27,29). At the amino acid sequence level, CROC-1 and Mms2 are much more homologous with each other than to Ubcs (29), suggesting that they may form a separate Ubc-like protein family. We report here the isolation and characterization of a human cDNA, which we denote hMMS2, encoding a second MMS2 homolog and demonstrate that the function of hMMS2, CROC-1 and MMS2 are conserved in heterologous hosts, indicating that these genes may represent a novel gene family with a broad spectrum of evolutionarily conserved functions.
MATERIALS AND METHODS
Saccharomycescerevisiae strains
Haploid yeast strains DBY747 (MATa his3-[Delta]1 leu2-3,112 ura3-52 trp1-289) and FY86 (MAT[alpha] his3-[Delta]200 ura3-52 leu2-[Delta]1 GAL+) and their respective mms2::LEU2 disruption mutants SBL and FY86m2L were used in this study. The mms2 mutants were created by a one-step gene replacement protocol (31) using an mms2::LEU2 disruption cassette as previously described (29). Cells were cultured at 30°C in either a rich YPD medium or a synthetic glucose (SD) medium supplemented with amino acids and bases as described (32). Galactose media were made by replacing glucose in the above media with (+)d-galactose.
Plasmids
Plasmid pBS-hM2 initially isolated from the cDNA library contains the entire hMMS2 cDNA (Fig.
Figure 1. (A) Nucleotide and deduced amino acid sequences of the hMMS2 cDNA (GenBank accession no. AF049140). The 1535 bp cDNA contains a single ORF encoding a putative 145 amino acid polypeptide. Two consensus polyadenylation signals (AATAAA) are underlined. Restriction sites EcoRI and SphI used in this study are indicated. (B) Amino acid sequence alignment of hMMS2 with Mms2 and CROC-1B generated by a Clustal method with the DNASTAR MegAlign program. Amino acid residues corresponding to the active site Cys in other Ubcs are marked *. A 2.1 kb KpnI-SacI fragment containing the entire CROC-1B cDNA (26) was cloned into the KpnI and SacI sites of pYES2.0 to form YEpGAL1-C1B. To create a truncated CROC-1, the CROC-1B ORF was PCR-amplified by a 5[prime] primer GCGAGCTCATGGTAAAAGTCCCTCGC, containing a SacI cloning site followed by a translation start codon and the CROC-1B coding region from codon 81 (underlined), and a 3[prime] primer CCGGATCCTTAATTGCTGTAACACTG (CROC-1B sequence underlined) with a BamHI site. The resulting 0.42- kb SacI-BamHI fragment was cloned into pSCW231 to form pSCW-C1. Plasmid pIRES1neo (Clontech, Palo Alto, CA) containing the CMV promoter was used as a cloning vector for transient mammalian expression. CMV-C1B contains the 2.1 kb CROC-1B cDNA; CMV-hM2 contains a 0.55 kb EcoRI fragment from pBS-hM2; CMV-yM2 contains a 0.6 kb intron-less BamHI fragment of the MMS2 ORF. Plasmid pSVX-G12V Ha-ras was a gift from Dr Ali Fattey of the Onyx Corp. The c-fos-CAT construct has been described previously (26).
DNA sequencing and sequence analysis
Nucleotide sequences of the hMMS2 cDNA were determined by a dideoxy chain terminating method (34) using a T7 DNA Polymerase Sequencing kit (Pharmacia LKB, Piscataway, NJ). hMMS2 and its deduced amino acid were analyzed and used to perform a homology search and multiple sequence alignment.
Northern hybridization
To analyze the tissue distribution of hMMS2 and CROC-1 expression, membranes containing 2 µg poly(A)-selected mRNA from multiple human tissues and cancer cell lines were purchased from Clontech and used according to the manufacturer's instructions. DNA fragments used for northern analysis were isolated from an agarose gel after restriction enzyme digestion and electrophoresis and labeled with [[alpha]-32P]dCTP using a Random Primer Labeling kit (Gibco-BRL). The membranes were sequentially hybridized and stripped with: (i) a 0.8 kb BamHI-SphI probe from pBS-hM2 containing the entire hMMS2 ORF and 0.36 kb 3[prime]-untranslated region (UTR) (Fig.
Cell killing and mutagenesis assays
MMS- and UV-induced liquid killing experiments were performed at 30°C in YPD as previously described (35). MMS was purchased from Aldrich (St Louis, MO). For UV treatment, the 254 nm UV doses were provided and controlled by a UV crosslinker (Fisher Scientific model FB-UVXL-1000 at ~2400 µW/cm2) in the dark. The plates were incubated at 30°C in a dark chamber for 4 days to prevent photoactivation.
Spontaneous Trp+ reversion rates of DBY747 derivatives were measured by a modified Luria and Delbruck fluctuation test as described (36). DBY747 bears a trp1-289 amber mutation that can be reverted to Trp+ by several different mutational events. An overnight yeast culture was used to inoculate five tubes, each containing 10 ml fresh YPD, to a final titer of 20 cells/ml. Incubation was continued until a titer of 2 × 108 cells/ml was reached. Cells were collected, washed, resuspended and plated. Each set of experiments contained five independent cultures of each strain; each culture was plated onto YPD in duplicate to score total survivors and onto SD-Trp plates to score Trp+ revertants. Spontaneous mutation rates (no. revertants/cell/generation) were calculated as previously described (37).
Mammalian cells culture and c-fos-CAT assays
All media and serum were purchased from Gibco-BRL (Gaithersburg, MD). Rat-1 fibroblasts were cultured in Dulbecco's modified Eagle's medium (DMEM) supplemented with 10% fetal bovine serum (FBS) and 50 µg/ml gentamicin sulfate and grown at 37°C in a humidified atmosphere containing CO2.
Rat-1 cells were seeded at a density of 8 × 105 cells/100 mm Petri dish in 10 ml DMEM + 10% FBS and allowed to attach overnight. The following day, monolayers were co-transfected for 7 h with 1 µg c-fos-CAT reporter gene and 9 µg CMV-C1B, CMV-hM2, CMV-yM2, pIRES1neo (negative control) or pSVX-G12V H-ras (positive control), using Lipofectamine (Gibco-BRL) according to the manufacturer's instructions. Following transfection, monolayers were re-fed with DMEM + 0.5% FBS and incubated for an additional 72 h to permit induction of CAT activity. Monolayers were lysed and 200 µg cell extract were used for measurement of CAT levels, using the CAT ELISA kit from Boehringer Mannheim (Mannheim, Germany).
RESULTS
Identification of hMMS2
The deduced S.cerevisiae Mms2 amino acid sequence was used to search the Human Genome Sciences Inc. (HGS) database for expressed cDNA sequence tags (ESTs). With cut-offs that would eliminate all known Ubcs, two distinct groups of cDNAs were identified. One group was soon found to be identical to the CROC-1 isolated in one of our laboratories (26), whereas a second group of cDNAs appeared to be novel and were thus named hMMS2. Among 19 initial putative hMMS2 clones, HGS36,109 contained the longest cDNA (1.5 kb). Determination of the nucleotide sequence of its entire cDNA insert revealed HGS36,109 to encode a 137 amino acid polypeptide that is highly homologous to Mms2. However, no translation start codon was observed at the 5[prime]-end. The HGS database was subsequently searched for the full-length hMMS2 cDNA clone, which resulted in the isolation of pBS-hM2 (HGS1,273,684) from a human colon carcinoma cDNA library, containing 45 additional nt with an in-frame ATG and surrounding nucleotide sequences characteristic of a translation start codon (Fig.
Figure 2. Expression of hMMS2. Membranes containing multiple tissue poly(A) RNA (2 µg per lane) were purchased from Clontech and used as instructed. (A) Human multi-tissue northern (MTN) blot; (B) human III MTN blot; (C) human cancer line MTN blot. Tissues and cell lines from which RNA was isolated are given at the top of each figure. All three membranes were sequentially hybridized with a 0.8 kb hMMS2 probe (top panels) and a 0.96 kb CROC-1 probe (middle panels) under identical conditions. The membranes were also hybridized to a 2.0 kb [beta]-actin cDNA probe as an internal control (bottom panels). The CROC-1 hybridization results have been presented elsewhere (2) and are shown here merely for the purpose of comparison with hMMS2 hybridization. CROC-1A and CROC-1B appear to be differential mRNA splicing products, encoding 170 and 221 amino acid proteins respectively, with different N-terminal lengths (26). hMMS2 shares 91.5% (129/141) identity with CROC-1s (Fig. A hMMS2 cDNA probe was used to study tissue-specific expression of the hMMS2 gene. The hMMS2 transcript level appears to be extremely low in most normal tissues examined (Fig. Since hMMS2 and CROC-1 transcripts can be distinguished using different probes, it is possible to compare the hMMS2 and CROC-1 mRNA tissue distribution patterns in the same set of membranes. The CROC-1-specific probe detected two transcripts corresponding to CROC-1A (2.0 kb) and CROC-1B (2.1 kb). While CROC-1 transcript levels appear to be elevated in all cancer cell lines examined, levels of hMMS2 are relatively low in lung carcinoma A549 and melanoma G361 (Fig. The tissue distributions of the hMMS2 and CROC-1 transcripts were also analyzed (utilizing the HGS database) by the frequency of gene detection from various cDNA libraries. By the end of January 1998, 49 entries for hMMS2 from 36 cDNA library pools and 119 entries for CROC-1 from 40 library pools were identified, representing <0.005% and <0.01% respectively of total HGS human ESTs used for this analysis (>106). It appears that expression of both hMMS2 and CROC-1 is elevated in some fast growing cells such as fetal tissues, immune cells and cancers. For example, hMMS2 accounts for 0.042% (4/9544) of early stage human brain ESTs, 0.043% (4/9346) of osteoclastoma ESTs, 0.12% (2/1698) of colon carcinoma ESTs and 0.026% (3/11 387) of T cell lymphoma ESTs. Of the 119 CROC-1 cDNAs obtained, 29 came from infant brain ESTs, accounting for 0.056% (29/51 506), and 11 came from melanocyte ESTs, accounting for 0.091% (11/12 098). Given the strong homology between hMMS2, CROC-1 and Mms2, we asked if hMMS2 and CROC-1 are able to provide MMS2 functions in yeast cells. The yeast mms2 mutant is sensitive to killing by DNA damaging agents, including MMS and UV. The hMMS2 and CROC-1B ORFs were cloned into a yeast expression vector under the control of an inducible GAL1 promoter. As seen in Figure Figure 3. Relative sensitivity to MMS-induced killing of wild-type (FY86), the mms2 mutant (FY86m2L) and the mms2 mutant transformed with pGAL1-C1B and pGAL1-hM2. Yeast strains previously grown on a synthetic selective medium were streaked onto a rich medium with or without 0.035% MMS or with different carbon sources as indicated. YPD, glucose; YPGal, galactose. Plates were incubated at 30°C for 3 days before being photographed. The failure of CROC-1B to complement mms2 could be due to either a lack of expression (mRNA or protein instability), the amino acid sequence divergence between hMMS2 and CROC-1 or the additional N-terminal sequence unique to CROC-1B. To address these possibilities, we made a construct that produces a truncated CROC-1 comparable in length with hMMS2 and Mms2 (Fig. Figure 4. Truncated CROC-1B is able to complement the mms2 mutant. (A) Structure of various plasmid inserts used in this study. Filled boxes indicate two highly conserved motifs among all three proteins. Hatched boxes indicate regions that are moderately conserved among all three proteins. Dotted boxes indicate sequences that are only moderately conserved between CROC-1 and hMMS2. Open boxes represent sequences with no homology in other proteins. Transformants of the mms2 mutant harboring plasmids with these genes either confer MMS resistance (+) or sensitivity (-) by a plate assay. (B) MMS-induced killing and (C) UV-induced killing. Cells were incubated in a selective medium prior to killing experiments to maintain the plasmids. [open square], DBY747 (wt); [solid square], SBL (mms2); [solid triangle], SBL/pSCW-hM2; [open circle], SBL/pSCW-C1[Delta]80. Results are an average of two independent experiments. Probably the most astonishing effect of the mms2 mutation is the remarkable increase in the spontaneous mutation rate, leading to a hypothesis that Mms2 functions in the error-free PRR that possibly suppresses the mutagenesis pathway (29). To see if the human MMS2 homologs are able to fully complement mms2 defects, hMMS2 was cloned in a yeast expression vector suitable for the mutagenesis assay and the spontaneous Trp+ reversion rates of the wild-type, mms2 mutant and mms2 transformed with hMMS2 were determined. As seen in Table 1, the spontaneous Trp+ reversion rate increased >40-fold in the mms2 mutant, however, it was dramatically limited in the same cells expressing the hMMS2 gene. The 3.4-fold increase in the hMMS2 transformants compared with the wild-type cells can be attributed to loss of the plasmid in a small population of the hMMS2 transformants (Table 1). Table 1. 
hMMS2 and CROC-1
Tissue distribution of the hMMS2 transcript
Functional complementation of an mms2 mutant by hMMS2 and CROC-1
Strain
Key alleles
Mutation rate
(×10-8)aRelative rateb
DBY747
Wild-type
1.31 (0.53)
1
SBL
mms2
55.0 (8.41)
42.0
SBL/YEp-hM2c
mms2-hMMS2
4.49 (2.05)
3.4
Functions of MMS2 and hMMS2 in mammalian cells
The CROC-1 gene was initially isolated by its ability to transactivate the c-fos promoter in a binary system, as well as in a transient transfection assay. hMMS2 cDNA was not isolated from this screening. To see if MMS2 and hMMS2 are able to function like CROC-1 in mammalian cells, we performed transient transfection assays by co-transfecting Rat-1 cells with a c-fos-CAT reporter construct and an expression vector carrying either CROC-1B, hMMS2 or MMS2. As a positive control, the c-fos-CAT reporter was co-transfected with the V12 H-ras gene, known to be able to transactivate the c-fos promoter (42). Both hMMS2 and MMS2, like CROC-1B, are able to transactivate the c-fos-CAT gene (Table 2), however, the transactivation activity of both CROC-1B and MMS2 was ~3.1-fold, whereas that of hMMS2 was ~2.3-fold, which is consistently lower than the transactivation activity observed in CROC-1B and MMS2 transfections. The reduced transactivation ability of hMMS2 was also observed with calcium phosphate transfections (data not shown).
Table 2.
| Plasmidsa | Gene of interest | OD (SD)b | Fold increasec |
| pIRES1neo | Negative control | 0.015 (0.003) | 1 |
| CMV-C1B | CROC-1B | 0.047 (0.004) | 3.1 |
| CMV-hM2 | hMMS2 | 0.034 (0.003) | 2.3 |
| CMV-yM2 | MMS2 | 0.046 (0.003) | 3.1 |
| pSVX-G12V | V12 H-ras | 0.154 (0.003) | 10.3 |
DISCUSSION
We have cloned a novel gene, hMMS2, which shares a high degree of homology with CROC-1 and MMS2 encoding Ubc-like proteins in different organisms. CROC-1 and hMMS2 share >90% identity at the amino acid level and both are able to functionally complement the yeast MMS2 defect, suggesting that they play a role in mammalian DNA repair. Several observations support such a role. First, we show that CROC-1 and hMMS2 are capable of transcriptionally activating the promoter for the c-fos proto-oncogene, whose expression is necessary for protection of cells against DNA damaging agents, most likely through a PRR pathway (43). Second, overexpression of CROC-1 has been shown to cause cells to accumulate in G2 and inhibit cdc2 kinase activity (27), a phenotype associated with hyperphosphorylation of cdc2 and cellular resistance to DNA damage (44). This G2/M DNA damage checkpoint control pathway is conserved between fission yeast and mammalian cells (45,46). Third, expression of CROC-1, and in some cases hMMS2, is elevated in human tumor-derived cell lines; this increase may be related to the acquisition of drug resistance. Indeed, it has been observed that co-transfection of CROC-1 with an MDR-1-CAT reporter gene also results in induction of CAT activity (26). Hence, a model in which CROC-1/hMMS2 function to inhibit cdc25 activity, leading to hyperphosphorylation of cdc2, cell cycle G2 accumulation and DNA damage/drug resistance would be consistent with these observations.
The significant degree of conservation of Ubc-like proteins with E2 enzymes indicates that they are evolutionarily related. Based on observations that Ubc proteins may form a homodimer (47,48) or heterodimer (5), it has previously been suggested that one of the possible functions of these Ubc-like proteins may be to physically interact with a specific Ubc and thus modulate its function (27,29). In yeast and mammalian cells, both Ubcs and Ubc-like proteins have been implicated in cell cycle regulation and DNA repair processes. The CDC34 gene encodes a Ubc3 that interacts with an E3 complex SCFCdc4 for Sic1 degradation, which is required for cell cycle progression through S phase (15,16). This pathway is conserved in mammalian cells: a human CDC34 homolog has been identified that functionally complements a yeast cdc34-2 mutant (49) and a human E3 complex related to yeast SCFCdc4 has recently been identified (50). CROC-1 expression fluctuates during the cell cycle (27), is up-regulated in virus-transformed immortal cells (28) and down-regulated in HT-29-M6 cells undergoing differentiation (27). Overproduction of CROC-1 stimulates c-fos reporter gene expression (26), but inhibits cdk1 activity and HT-29-M6 cell differentiation (27). These results suggest a role for CROC-1 in cell cycle regulation that overcomes cellular senescence. However, whether or not CROC-1 plays a role in Ubc3-mediated proteolysis remains to be determined. On the other hand, the yeast MMS2 gene clearly plays a role in PRR and it defines the error-free subpathway within the RAD6 pathway (29). RAD6 encodes a Ubc2 and its E2 activity is required for both PRR and mutagenesis (51). Ubc2 is a multifunctional protein: it forms a complex with an E3 protein Ubr1 for N-terminus rule protein degradation (32,52,53) and a different complex with Rad18 for DNA repair (54) that is independent of Ubr1. The E3 enzyme and the target protein(s) for the Ubc2-Rad18 complex during DNA repair are currently unknown. In this regard, study of MMS2 and its gene product may illuminate how ubiquitination by Rad6 is involved in PRR and mutagenesis.
If the above Ubc-like protein family is indeed involved in ubiquitination, it may only regulate one or some selected E2 pathways. Different organisms do not appear to have as many Ubc-like proteins as they have Ubcs. The complete S.cerevisiae genome database does not reveal a second MMS2 family gene and a search of the HGS and public databases for additional human MMS2 family genes has not been successful to date, even though hMMS2 and CROC-1 cDNAs have appeared 49 and 119 times respectively. However, eukaryotic cells may employ at least two strategies to diversify Ubc-like protein functions. First, there exist at least four isoforms of CROC-1 (26,27), all differing at their N-termini as a result of differential splicing (27). Our demonstration that deletion of the CROC-1B N-terminus is required for functional complementation of the yeast MMS2 defect implicates the N-terminus in CROC-1 regulation and suggests that the various N-termini can confer specificity and enable CROC-1 to participate in a variety of functions. In addition, hMMS2, which differs from CROC-1 primarily at the N-terminus, has been reported as a putative enterocyte differentiation promoting factor, which contrasts with the ability of CROC-1 to inhibit differentiation. Secondly, genes encoding Ubc-like proteins that are distantly related to the Mms2 family may function in a manner similar to Mms2 family proteins. For example, mouse (55) and human (56) TSG101 genes have been identified as tumor susceptibility genes; the TSG101 gene is mutated in many breast cancers (56,57). The N-terminus of the protein shares structural similarity with Ubcs and it has been proposed that TSG101 may function in the ubiquitination pathway (58,59). A yeast homolog of TSG101 has been identified as a result of genome sequencing (60), but it has not been characterized.
CROC-1 expression appears to be elevated in all tumor cell lines examined (28) and it may function to overcome cellular senescence (26,27). Furthermore, the CROC-1 gene is mapped to chromosome 20q13.2 (27), a region where DNA amplification is frequently reported in breast cancers (61-64) and other tumors (65), as well as in virus-transformed immortal cells (66) and those overcoming cellular senescence in cancer pathogenesis (67). In this study, we found that hMMS2 gene expression is also elevated in some but not all cancer cell lines. These results suggest that, like CROC-1, hMMS2 expression may also be involved in cell differentiation and tumorigenesis in a subset of tissues. Hence, elucidation of CROC-1 and hMMS2 functions and identification of their related signaling pathways can be expected to provide insights into additional mechanisms through which neoplastic cells become resistant to radiation therapy and chemotherapy.
ACKNOWLEDGEMENTS
We thank Drs A.Fattey and L.Prakash for plasmids, Drs S.Bacchetti and L.Ma for valuable discussion and T.Fontanie for technical assistance. W.X. is a Research Scientist of the National Cancer Institute of Canada and S.B. is supported by a University of Saskatchewan Graduate Fellowship. This work was supported by grants from the Medical Research Council of Canada and the National Cancer Institute of Canada to W.X.
REFERENCES
This article has been cited by other articles:
This page is run by Oxford University Press, Great Clarendon Street, Oxford OX2 6DP, as part of the OUP Journals
Comments and feedback: www-admin{at}oup.co.uk
Last modification: 14 Aug 1998
Copyright©Oxford University Press, 1998.
CiteULike 
Connotea 
Del.icio.us What's this?
R. Wen, J. A. Torres-Acosta, L. Pastushok, X. Lai, L. Pelzer, H. Wang, and W. Xiao
Arabidopsis UEV1D Promotes Lysine-63-Linked Polyubiquitination and Is Involved in DNA Damage Response
PLANT CELL,
January 1, 2008;
20(1):
213 - 227.
[Abstract]
[Full Text]
[PDF]
P. L. Andersen, H. Zhou, L. Pastushok, T. Moraes, S. McKenna, B. Ziola, M. J. Ellison, V. M. Dixit, and W. Xiao
Distinct regulation of Ubc13 functions by the two ubiquitin-conjugating enzyme variants Mms2 and Uev1A
J. Cell Biol.,
August 29, 2005;
170(5):
745 - 755.
[Abstract]
[Full Text]
[PDF]
L. Pastushok, T. F. Moraes, M. J. Ellison, and W. Xiao
A Single Mms2 "Key" Residue Insertion into a Ubc13 Pocket Determines the Interface Specificity of a Human Lys63 Ubiquitin Conjugation Complex
J. Biol. Chem.,
May 6, 2005;
280(18):
17891 - 17900.
[Abstract]
[Full Text]
[PDF]
H. P. Roest, W. M. Baarends, J. de Wit, J. W. van Klaveren, E. Wassenaar, J. W. Hoogerbrugge, W. A. van Cappellen, J. H. J. Hoeijmakers, and J. A. Grootegoed
The Ubiquitin-Conjugating DNA Repair Enzyme HR6A Is a Maternal Factor Essential for Early Embryonic Development in Mice
Mol. Cell. Biol.,
June 15, 2004;
24(12):
5485 - 5495.
[Abstract]
[Full Text]
[PDF]
N. Kociok, A. Hueber, P. Esser, U. Schraermeyer, G. Thumann, T. T. Luther, J. Jordan, G. Welsandt, and B. Kirchhof
Vitreous Treatment of Cultured Human RPE Cells Results in Differential Expression of 10 New Genes
Invest. Ophthalmol. Vis. Sci.,
July 1, 2002;
43(7):
2474 - 2480.
[Abstract]
[Full Text]
[PDF]
Z. Li, W. Xiao, J. J. McCormick, and V. M. Maher
Identification of a protein essential for a major pathway used by human cells to avoid UV- induced DNA damage
PNAS,
April 2, 2002;
99(7):
4459 - 4464.
[Abstract]
[Full Text]
[PDF]
E. Villalobo, L. Morin, C. Moch, R. Lescasse, M. Hanna, W. Xiao, and A. Baroin-Tourancheau
A Homologue of CROC-1 in a Ciliated Protist (Sterkiella histriomuscorum) Testifies to the Ancient Origin of the Ubiquitin-conjugating Enzyme Variant Family
Mol. Biol. Evol.,
January 1, 2002;
19(1):
39 - 48.
[Abstract]
[Full Text]
[PDF]
S. McKenna, L. Spyracopoulos, T. Moraes, L. Pastushok, C. Ptak, W. Xiao, and M. J. Ellison
Noncovalent Interaction between Ubiquitin and the Human DNA Repair Protein Mms2 Is Required for Ubc13-mediated Polyubiquitination
J. Biol. Chem.,
October 19, 2001;
276(43):
40120 - 40126.
[Abstract]
[Full Text]
[PDF]
M. Long
A New Function Evolved from Gene Fusion
Genome Res.,
November 1, 2000;
10(11):
1655 - 1657.
[Full Text]
W. Xiao, B. L. Chow, S. Broomfield, and M. Hanna
The Saccharomyces cerevisiae RAD6 Group Is Composed of an Error-Prone and Two Error-Free Postreplication Repair Pathways
Genetics,
August 1, 2000;
155(4):
1633 - 1641.
[Abstract]
[Full Text]
A. P. Stubbs, P. D. Abel, M. Golding, G. Bhangal, Q. Wang, J. Waxman, G. W.H. Stamp, and E.-N. Lalani
Differentially Expressed Genes in Hormone Refractory Prostate Cancer : Association with Chromosomal Regions Involved with Genetic Aberrations
Am. J. Pathol.,
May 1, 1999;
154(5):
1335 - 1343.
[Abstract]
[Full Text]
[PDF]
Z. Li, W. Xiao, J. J. McCormick, and V. M. Maher
Identification of a protein essential for a major pathway used by human cells to avoid UV- induced DNA damage
PNAS,
April 2, 2002;
99(7):
4459 - 4464.
[Abstract]
[Full Text]
[PDF]
T. M. Thomson, J. J. Lozano, N. Loukili, R. Carrió, F. Serras, B. Cormand, M. Valeri, V. M. Díaz, J. Abril, M. Burset, et al.
Fusion of the Human Gene for the Polyubiquitination Coeffector UEV1 with Kua, a Newly Identified Gene
Genome Res.,
November 1, 2000;
10(11):
1743 - 1756.
[Abstract]
[Full Text]
This Article 
Abstract
Print PDF (238K)
Alert me when this article is cited
Alert me if a correction is posted
Services
Email this article to a friend
Similar articles in this journal
Similar articles in ISI Web of Science
Similar articles in PubMed
Alert me to new issues of the journal
Add to My Personal Archive
Download to citation manager
Search for citing articles in:
ISI Web of Science (52)
Request Permissions
Commercial Re-use Guidelines
for Open Access NAR Content
Google Scholar
Articles by Xiao, W.
Articles by Wei, Y. F.
Search for Related Content
PubMed
PubMed Citation
Articles by Xiao, W.
Articles by Wei, Y. F.
Social Bookmarking
What's this?