Skip Navigation

This Article
Right arrow Abstract Freely available
Right arrow Print PDF (250K) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (27)
Right arrowRequest Permissions
Right arrow Commercial Re-use Guidelines
for Open Access NAR Content
Google Scholar
Right arrow Articles by Udell, C. M.
Right arrow Articles by Davey, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Udell, C. M.
Right arrow Articles by Davey, S.
Social Bookmarking
Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Nucleic Acids Research Pages 3971-3976  

HRAD1 and MRAD1 encode mammalian homologuesof the fission yeast rad1+ cell cycle checkpointcontrol gene
Introduction
Materials And Methods
   DDBJ/EMBL/GenBank accession numbers
   cDNA libraries, screening and sequencing
   Plasmid constructions
   Schizosaccharomyces pombe culture and manipulations
   Radiation sensitivity and radiation-induced cell cycle delay
   Sensitivity to HU
Results
   Isolation of the HRAD1 and MRAD1 genes
   Sequence analyses of the HRAD1 and MRAD1 genes
   HRAD1 partially rescues the G2 DNA damage checkpoint defects of rad1 yeast mutants
   Expression of HRAD1 restores minimal resistance to HU in rad1::ura4+ yeast
Discussion
Acknowledgements
References

HRAD1 and MRAD1 encode mammalian homologuesof the fission yeast rad1<sup>+</sup> cell cycle checkpointcontrol gene

HRAD1 and MRAD1 encode mammalian homologuesof the fission yeast rad1+ cell cycle checkpointcontrol gene

Christian M. Udell2, Sabrina K. Lee and Scott Davey1,2,*

Cancer Research Laboratories, 1Department of Oncology and 2Department of Pathology, Queen's University, Kingston K7L 3N6, Canada

Received May 13, 1998; Revised and Accepted July 20, 1998

DDBJ/EMBL/GenBank accession nos AF011905 and AF038841

ABSTRACT

Eukaryotic cells arrest at the G2 checkpoint in the presence of DNA damage or incompletely replicated DNA. This cell cycle checkpoint prevents the development and propagation of genomic instability. In the fission yeast, this process requires the action of a number of genes, including rad1+. We report here the identification of human and mouse cDNAs that exhibit extensive sequence homology to rad1+. The human gene, called HRAD1, encodes a 282 amino acid protein that is 27% identical and 53% similar to yeast Rad1p. The human homologue maintains its sequencesimilarity over the full length of the protein, including the three proposed 3[prime]->5[prime] exonuclease domains, and the leucine rich repeat region. The mouse gene, called MRAD1, encodes a 280 amino acid protein that is 90% identical and 96% similar to HRAD1 at the amino acid level. Expression of HRAD1 in yeast rad1 mutants partially restores radiation resistance and G2 checkpoint proficiency to these mutants. Evolutionaryconservation of structure between HRAD1, MRAD1, rad1+, Saccharomyces cerevisiae RAD17 and the Ustilago maydis REC1 checkpoint genes suggests that the function of the encoded proteins is conserved as well. The ability of HRAD1 to partially complement yeast rad1 mutants suggests that this gene is required for G2 checkpoint control in human cells.

INTRODUCTION

Cell cycle checkpoints are regulatory mechanisms that ensure prerequisite events are completed before subsequent cell cycle transitions occur. For example, mitotic entry is dependent on the prior completion of DNA replication. Checkpoints also exist to prevent the propagation of damaged chromosomes that can result from radiation or radiomimetic drugs. These DNA damage checkpoints operate predominantly at the G1/S and G2/M transition points (1).

Even in the absence of exogenous DNA damage or blocked DNA replication, checkpoint mutants are known to exhibit genomic instability, as seen in RAD9 mutants of Saccharomyces cerevisiae at the G2/M checkpoint (2), and in p53-/- mammalian cell lines at the G1/S checkpoint (3,4). The accumulation of mutations in cells exhibiting genomic instability has been suggested to be the driving force behind tumour formation and metastasis (5,6). This is supported by studies on individuals with inherited chromosome instability diseases which include ataxia telangiectasia , Li-Fraumeni syndrome and Bloom's syndrome (7-10). In all three cases, genomic instability and cancer predisposition are seen, with the former operating at the cellular level and the latter at the level of the individual. The genes mutated in these diseases are ATM, p53 and BLM, respectively. The ATM protein is a member of the PI-3 kinase family (11,12) and p53 is a transcription factor (13-15), and both are known to have checkpoint functions (16-23). The BLM protein has structural homology with known helicases and is also thought to function in checkpoint control (24,25).

A recent report has shown a strong correlation between loss of the G2 checkpoint and the appearance of chromosomal abnormalities (26), suggesting that the G2 checkpoint is a major protective factor against the development of genomic instability and cancer. Despite its apparent importance, only two presumptive components of the mammalian G2 checkpoint have been identified to date (27-29). By contrast, the G2 checkpoint has been well characterised in the fission yeast Schizosaccharomyces pombe. Fission yeast undergo a dose dependent G2 delay following exposure to radiation and the resultant DNA damage that occurs (30,31). The yeast remain arrested at G2 while the damage is repaired, then enter mitosis and resume progression through the cell cycle. This dose dependent response to radiation is absent from mutants of any one of the six checkpoint rad genes rad1+, rad3+, rad9+, rad17+, rad26+ and hus1+ (30-33). Mutants of any one of these genes have similar phenotypes; they are hypersensitive to radiation and to transiently inhibited DNA replication, such as occurs in the presence of hydroxyurea (HU). The sensitivity of these mutants to radiation and HU results from loss of the G2 DNA damage checkpoint and the S phase checkpoint monitoring completion of DNA synthesis, respectively (30-33).

The fission yeast rad1+ gene has previously been shown to be conserved among lower eukaryotes. Saccharomyces cerevisiae RAD17 (34) and Ustilago maydis REC1 (35,36) are functional homologues of rad1+. RAD17 and REC1 were shown independently to be required for checkpoint function, and both exhibit moderate sequence conservation with rad1+ (25-30% at the amino acid level). We report here the cloning of human and mouse homologues of the S.pombe rad1+ gene, called HRAD1 and MRAD1, respectively. Expression of HRAD1 in yeast rad1 mutants results in partial restoration of the G2 checkpoint response to radiation. Expression of HRAD1 in these yeast does not restore resistance to HU. We propose that HRAD1 and MRAD1 are components of the G2 checkpoint mechanism in humans and mice, respectively.

MATERIALS AND METHODS

DDBJ/EMBL/GenBank accession numbers

The accession numbers for the HRAD1 and MRAD1 cDNA sequences are AF011905 and AF038841, respectively.

cDNA libraries, screening and sequencing

The HaCaT cDNA library in [lambda] ZAP II was a gift of D.Beach, and the CB7 mouse erythroleukemia cDNA library was a gift from P.A.Greer. A probe for screening the HaCaT cDNA library was generated by amplification of a 399 bp portion of the EST sequence (DDBJ/EMBL/GenBank accession no. AA029300) using primers A (GGTACATGACCTTGCTCCTAT) and B (AGTTCCCACCTTGACTATCC), and HaCaT cDNA as template. The full-length HRAD1 cDNA was used as a probe to screen the mouse cDNA library. Library screens were performed using standard techniques (37). Sequencing of both strands of the HRAD1 and MRAD1 cDNAs was performed on an ABI 377 automated sequencer after subcloning into pBluescript KS-. Amino acid sequence alignments were generated using the CLUSTAL W program (38). In the amino acid alignment, similar amino acids are defined as I/L/V/M, D/E, S/T, A/G, N/Q, R/H/K and W/F/Y.

Plasmid constructions

The rad1+ cDNA was excised from pGR4-rad1+ (gift of S.E.Sorensen) with BamHI and XbaI, the 3[prime] recessed ends were filled in with Klenow polymerase, and the cDNA was blunt end ligated into the SmaI site of the S.pombe expression vector pART1 (39), to generate pART1-rad1+. The HRAD1 open reading frame (ORF) was amplified with primers HRAD1-5 (GGACGGTCGACATGCCCCTTCTGACCCAA) and HRAD1-3 (ACGGATCCTCAAGACTCAGATTCAGG), and blunt end ligated into the SmaI site of pART1, to generate pART1-HRAD1. Orientation of the inserts within pART1 was determined by restriction enzyme digestion.

Schizosaccharomyces pombe culture and manipulations

Schizosaccharomyces pombe was cultured using standard techniques (40). The strains used in this study were Sp337, h+N rad1::ura4+ leu1-32 ura4-D18; and Sp199, h+N cdc25-22 rad1-1 leu1-32. Sp337 was generated by crossing 975 (40) with Sp267 (41), and Sp199 was generated by crossing SP32 (41) with SP1202 (41). Schizosaccharomyces pombe transformations were performed using the method of Okazaki et al. (42).

Radiation sensitivity and radiation-induced cell cycle delay

X-irradiation was delivered using a Clinac 2100 C/D with a 6 MV beam, at a dose rate of 0.24 Gy/s. UV radiation treatments were performed at 254 nm, with a dose rate of 1.8 J/m2/s. For viability assays, S.pombe was cultured to mid-logarithmic phase (5 × 106 cells/ml) at 25°C, plated on minimal selective media at a density of 1000 cells per plate, and irradiated with the indicated dose of radiation. The plates were incubated at 30°C until colonies were easily visible. Relative viability was expressed as the number of treated versus untreated cells that were able to form colonies.

To assess radiation-induced checkpoint control, plasmids were transformed into a cdc25-22 rad1-1 strain background. These cells were cultured to mid-logarithmic phase at 25°C, plated on pre-warmed minimal selective plates, and incubated at 36°C for 3 h to synchronize the cells in G2. Immediately prior to release from 36°C, the plated cells were irradiated with the indicated dose of UV radiation, transferred to liquid minimal selective media, and incubated at 25°C. Samples were removed at the indicated times and fixed in 3.7% formaldehyde. Fixed cells were washed once with phosphate buffered saline (PBS), once with PBS containing 1% Triton X-100, and resuspended in PBS. The cells were then stained with 0.2 µg/ml 4[prime]6-diamidino-2-phenylindole (DAPI) and viewed under a fluorescence microscope. Binucleate cells were scored as having passed mitosis.

Sensitivity to HU

Schizosaccharomyces pombe was cultured to mid-logarithmic phase at 32°C, and then HU was added to a final concentration of 12 mM. At the indicated times after the addition of HU aliquots of cells were removed, and plated on PM media at a density of 1000 cells per plate. The plates were incubated at 30°C until colonies had reached a suitable size for counting, and relative viability was assessed as described above for radiation sensitivity.

RESULTS

Isolation of the HRAD1 and MRAD1 genes

A search of the dBEST data base revealed an EST of interest obtained from a normalized and directionally cloned human cDNA library (43). The complementary strand of the EST appears to encode a predicted protein similar to the S.pombe rad1+ gene product. This ORF predicted a protein that is 30% identical and 57% similar over an 80 amino acid stretch, which represents approximately one quarter of the Rad1p protein. It is aligned closer to the C-terminal portion of the protein which is a moderately conserved region in the S.pombe rad1+, S.cerevisiae RAD17 and U.maydis REC1 gene products. The extent of homology in the region that the EST is aligned with S.pombe rad1+ is comparable to that of rad1+ and RAD17 (44). This same region contains nine identical residues between Rad1p, RAD17p and REC1p, of which seven are also present in the human EST. Based on the alignment and extent of sequence identity, this was evidence for the existence of a possible human homologue of S.pombe rad1+.

Because a positive orientation clone had not been identified in the original library, we chose to search other cDNA libraries for the bona fide human rad1+ homologue. A HaCaT (spontaneously transformed human keratinocyte) cDNA library in [lambda] ZAP II was amplified by PCR using oligonucleotide primers directed against the putative HRAD1 gene. The 399 bp PCR product generated using oligonucleotides A and B was subcloned into pBS KS-. Sequencing of the subclone revealed an insert of identical sequence to that of the original EST, confirming that the sequence of interest was present in the HaCaT cDNA library.

The screen of the HaCaT cDNA library yielded four positive clones. In vivo excision converted these [lambda] cDNA vectors into pBS plasmids containing the cDNA insert. Sequencing indicated that all four contained the same cDNA. One of these, clone HRAD1-7, was slightly longer than the others and was chosen for further analysis.

The full-length HRAD1-7 clone was used to probe a mouse CB7 erythroleukemia cDNA library by low stringency hybridization. Five positives were identified, four of which were the same length, and one was slightly shorter than the others. Clone MRAD1-2.1 was chosen for further analysis.

Sequence analyses of the HRAD1 and MRAD1 genes

Full DNA sequences of both strands of the insert of clone HRAD1-7 showed that the cDNA was 1300 bp long with a 214 bp 5[prime] untranslated region (UTR), an 846 bp coding region and a 240 bp 3[prime] UTR (Fig. 1A). The 3[prime] UTR contains a consensus AATAAA polyadenylation signal sequence. The ORF of HRAD1 encodes a 282 amino acid polypeptide with 27% identity and 53% similarity to Rad1p. This is 41 amino acids shorter than the S.pombe rad1+ gene product.


Figure 1. Nucleotide sequences of HRAD1 and MRAD1. Nucleotide sequences of the HRAD1 (A) and MRAD1 (B) cDNAs. The initiating and terminating codons are shown in bold. Consensus polyadenylation signals are underlined. Numbers to the right indicate the number of the last nucleotide on each line.

Complete sequencing of both strands of clone MRAD1-2.1 identified a cDNA that was 1380 bp long with a 218 bp 5[prime] UTR, an 840 bp coding region and a 322 bp 3[prime] UTR (Fig. 1B). The 3[prime] UTR contains a common variant of the consensus polyadenylation signal sequence (ATTAAA). However, no poly A tail is observed in this cDNA isolate. The ORF of MRAD1 encodes a 280 amino acid polypeptide that is 90% identical and 96% similar to HRAD1p. An amino acid alignment (Fig. 2) shows that the sequence similarity of HRAD1p and MRAD1p to the other members of the Rad1p family extends over their entire lengths, suggesting that the isolated human and mouse cDNAs are full-length.


Figure 2. Amino acid sequence alignment of HRAD1p and MRAD1p with members of the Rad1p family. Amino acid alignment of HRAD1p, MRAD1p, S.pombe Rad1p (Sp_rad1p), S.cerevisiae RAD17p (Sc_RAD17p) and U.maydis REC1p (Um_REC1p). Numbers to the right indicate the numbering of the final amino acid on each line. Identical residues in [ge]80% of the sequences are highlighted in dark grey. Conserved residues (defined in Materials and Methods) in [ge]80% of the sequences are highlighted in light grey. Potentially important functional regions include the putative 3[prime]->5[prime] exonuclease domains (Exo I, II and III), and the leucine rich region (Leu rich), which have been previously defined for other members of the family (35,36).

HRAD1 partially rescues the G2 DNA damage checkpoint defects of rad1 yeast mutants

The HRAD1 ORF was subcloned into the S.pombe expression vector pART1 under control of the strong, constitutive adh1+ promoter. Expression of HRAD1 in a rad1::ura4+ strain background increased the survival of these mutants following UV irradiation, to levels above that of the vector transformed control (Fig. 3A). However, this increase in viability did not reach the level of rescue that was obtained by expression of the wild type rad1+ gene (Fig. 3A). Expression of HRAD1 also restored partial resistance to ionizing radiation (Fig. 3B).


Figure 3. HRAD1 expression restores resistance to DNA damage in rad1::ura4+ mutants of S.pombe. Sp337 was grown to mid-logarithmic phase in PM media, plated on PM plates, and irradiated with the indicated doses of radiation. Colonies were counted after 6 days and relative viability is expressed as the number of irradiated cells relative to unirradiated cells that were able to form colonies. (A) The UV dose versus survival curve for Sp337 carrying pART1 ([circle]), pART1-rad1+ ([square]) or pART1-HRAD1 ([triangle]). (B) The ionizing radiation dose versus survival curve. The symbols are the same as in (A). Both panels are the average of two independent experiments, each performed in duplicate. Error bars indicate standard error of the mean.

In order to more rigorously examine if HRAD1 rescues the checkpoint defects of rad1 mutants, HRAD1 was expressed in a rad1-1 strain containing the temperature sensitive cdc25-22 allele. At the restrictive temperature of 36°C, these yeast arrest at the G2/M transition point, due to their inability to activate the Cdc2 kinase. If cells blocked at the G2/M transition are irradiated just prior to being released to the permissive temperature of 25°C, checkpoint proficient cells will undergo a dose dependent delay in entry into mitosis. Checkpoint deficient cells will enter mitosis without a noticeable delay. As shown in Figure 4A, the checkpoint deficient vector transformed controls enter a synchronous mitosis within 100 min of being irradiated, regardless of the dose received. Checkpoint proficient yeast expressing Rad1p undergo the characteristic dose dependent delay in entry into mitosis (Fig. 4B). Yeast expressing HRAD1p also undergo a dose dependent delay in entry into mitosis (Fig. 4C). The dose dependence is not equal to that of cells expressing Rad1p, however, this is what one would expect for partial rescue.


Figure 4. HRAD1 expression restores dose dependent radiation-induced cell cycle delay to rad1-1 mutants of S.pombe. Sp199 was grown to mid-logarithmic phase at 25°C, synchronized at the G2/M transition by a 3 h incubation at 36°C, irradiated with the indicated doses of radiation (time zero), and released back to 25°C. At the indicated time points after irradiation, cells were removed, fixed, stained with DAPI and viewed under the fluorescence microscope. The % cells passing mitosis for each sample is the number of binucleate cells expressed as a percentage of the total number observed. Greater than 100 cells were scored for each timepoint. (A-C) Sp199 carrying either pART1 (A), pART1-rad1+ (B) or pART1-HRAD1 (C). In each panel the doses were 0 J/m2 ([circle]), 10 J/m2 ([square]) and 30 J/m2 ([triangle]). This figure is a representative example of three independent experiments.

Expression of HRAD1 restores minimal resistance to HU in rad1::ura4+ yeast

Expression of HRAD1 in Sp337 confers weak, but statistically significant resistance to the transient DNA synthesis inhibitor HU. However, this rescue is not nearly as high as that observed in other instances, such as HRAD9 rescue of rad9 S.pombe mutants (27). As shown in Figure 5, HRAD1 expressing cells lose viability with kinetics similar to that of the vector transformed control. Cells expressing wild type rad1+ remain viable for at least 6 h in HU (Fig. 5).

DISCUSSION

We have identified novel human and mouse genes that are structural homologues of the fission yeast rad1+ checkpoint control gene. The sequence similarity extends over the entire coding regions, indicating that the isolated cDNAs are full length. Particularly high levels of conservation were seen in two of three putative exonuclease domains, as well as in the leucine rich region that have been previously defined (35). The extent of amino acid conservation between HRAD1p and Rad1p, 27% identity and 53% similarity, is comparable to that observed between Rad1p and RAD17p (23% identity, 50% similarity). Rad1p and RAD17p have been shown by independent means to be involved in checkpoint control in fission and budding yeast, respectively (44). In different regions, HRAD1p and MRAD1p appear more like each of Rad1p, RAD17p and REC1p. Together with the functional complementation of rad1 mutants by HRAD1, and the extent and pattern of structural similarity within this family, HRAD1 and MRAD1 are highly likely to be involved in mammalian G2 checkpoint regulation.

While it has been clearly demonstrated that REC1p is a 3[prime]->5[prime] exonuclease, it has also been demonstrated that this function is not required for checkpoint control by this protein (35). The sequence similarity between HRAD1p, MRAD1p and other members of the family over the exo II and exo III domains is high, but less so in the exo I domain. The role of the putative 3[prime]->5[prime] exonuclease in HRAD1p function is questionable at this point.

We were able to show that HRAD1 can partially rescue radiation sensitivity in rad1 mutant yeast. This rescue is due to partial restoration of the G2 checkpoint defect of these mutants, which is shown by the radiation-dose dependent delay experiment (Fig. 4). Checkpoint deficient vector transformed yeast begin to transit mitosis within 40 min of being released to the permissive temperature, regardless of the dose received. The checkpoint proficient yeast overexpressing Rad1p undergo a dose dependent delay in entry into mitosis. The unirradiated cells do not begin to transit mitosis until 60 min after release to the permissive temperature, which is 20 min later than the vector transformed cells. This difference is due to the additive effect of two cell cycle delaying influences, the overexpression of Rad1p and the cdc25-22 mutation, which is not completely wild type even at the permissive temperature. Neither overexpression of Rad1p nor the cdc25-22 allele alone is sufficient to cause the observed delay. Yeast rad1 mutants overexpressing HRAD1p also undergo a dose dependent delay in entry into mitosis. The observed delay is not equivalent to that of the Rad1p expressing cells, but this is what one would expect for partial rescue. The maximal percentage of cells passing mitosis in both Rad1p and HRAD1p expressing yeast is lower than yeast carrying empty vector. This is due to the quality of the synchrony of cells passing mitosis. As the delay increases, the synchrony of the cells begins to diminish. Therefore, the highest percentage of cells passing mitosis is observed in the checkpoint deficient cells, where release from the block is quick. Checkpoint proficient cells will gradually lose synchrony over time and the maximal percentage of cells passing mitosis is lower.

This partial complementation suggests that HRAD1 is the human homologue of fission yeast rad1+. Cross species complementation by checkpoint genes has been demonstrated in other cases, but full complementation of all the defects of any particular mutant has not been observed. HRAD9, the human homologue of S.pombe rad9+, restores resistance to HU in rad9 null mutants, but fails to rescue UV sensitivity (27). FRP1/ATR is the human homologue of S.cerevisiae MEC1/ESR1 and S.pombe rad3+ (28,29,45). While FRP1/ATR will rescue some of the checkpoint defects of MEC1/ESR1 mutants, it will not restore checkpoint proficiency to rad3 mutants (29). Further analysis of HRAD1 will be necessary to clearly define its role in human cell cycle checkpoint control.

In mammalian cells, the G1 checkpoint is regulated in part by the p53 and ATM genes, and defects in these genes have been associated with a variety of human cancers (3,4,8-11,16,18,19,21,46,47). By contrast, very little is known about the molecular control of the G2 checkpoint in mammalian cells. Like yeast, mammalian cells will respond to DNA damage or incompletely replicated DNA by arresting the cell cycle in G2, prior to entry into mitosis. The presence of such a G2 checkpoint has been shown to correlate with viability after exposure to radiation (48-52).


Figure 5. HRAD1 expression does not restore resistance to transient DNA synthesis inhibition in rad1::ura4+ mutants of S.pombe. Sp337 was cultured to mid-logarithmic phase at 32°C, HU was added to 12 mM (time zero), and aliquots of cells were removed at the indicated times and plated on PM media. Relative viability is expressed as the number of drug-treated versus untreated cells that were able to form colonies. The symbols represent Sp337 carrying either pART1 ([circle]), pART1-rad1+ ([square]) or pART1-HRAD1 ([triangle]). The experiment was performed in duplicate and the error bars represent standard error of the mean.

There are now three candidates for human G2 checkpoint control genes: HRAD1, HRAD9 and FRP1/ATR, homologues of the rad1+, rad9+ and rad3+ genes of S.pombe. To date, none of these has been shown to function in human G2 checkpoint control, though HRAD1, HRAD9 and FRPI/ATR have been shown to rescue some of the defects in checkpoint deficient fission or budding yeast. Interestingly, BRCA1p co-localizes with the repair protein RAD51p, and both are found in regions of meiotic chromosomes similar to where FRP1p/ATRp is located (53,54). This spatial association with RAD51p and FRP1p/ATRp, and evidence that developmental arrest in Brca1 null mice is partially rescued by a p53 mutation indicates a role for BRCA1p in DNA damage repair (55). Genetic evidence from yeast indicates that rad1+, rad3+ and rad9+ are part of the same G2 checkpoint control pathway, and may form a physical complex. This suggests that HRAD1p, as the homologue of Rad1p, may be part of a multisubunit complex that includes other checkpoint proteins including HRAD9p, FRP1p/ATRp, RAD51p and BRCA1p.

It has been shown that caffeine treatment partially restores sensitivity to radiation in cell lines which have lost G1 checkpoint control through the loss of p53 (56,57). Presumably, the loss of the ability to undergo apoptosis in response to radiation in p53 mutant cells leads to radiation resistance. Caffeine is presumed to eliminate the G2 checkpoint in these cells, leading to radiation-induced death by premature mitosis, typical of checkpoint defective cells. Directly targeting HRAD1 or HRAD1p could be an efficient way of targeting human G2 checkpoint control. If elimination of G2 checkpoint function would restore sensitivity to radiation or chemotherapeutic drugs to cells which have lost G1 checkpoint function (i.e. p53-/- cells), there will be therapeutic benefits to inhibiting HRAD1 or other G2 checkpoint control genes and protein functions, in conjunction with radio- or chemotherapies.

ACKNOWLEDGEMENTS

We thank S.E.Sorensen for providing us with pGR4-rad1+, P.A.Greer for providing us with the mouse cDNA library, D.Beach for providing us with the HaCaT cDNA library, J.Schreiner and J.Robins at the Kingston Regional Cancer Center for assistance using the Clinac 2100 C/D, J.Greer for excellent technical assistance, and V.Bubbar for help with strain constructions. C.M.U. is a recipient of the Queen's University Department of Pathology Special Studentship and S.K.L. is a participant in the Queen's University Summer Work Experience Program. This work was supported in part by Medical Research Council of Canada Grant MT-14352 and by startup and special research funds from Cancer Care Ontario to S.D. S.D. is a career scientist of Cancer Care Ontario.

REFERENCES

1. Elledge,S.J. (1996) Science, 274, 1664-1672. MEDLINE Abstract

2. Weinert,T.A. and Hartwell,L.H. (1990) Mol. Cell. Biol., 10, 6554-6564. MEDLINE Abstract

3. Livingstone,L.R., White,A., Sprouse,J., Livanos,E., Jacks,T. and Tlsty,T.D. (1992) Cell, 70, 923-935. MEDLINE Abstract

4. Yin,Y., Tainsky,M.A., Bischoff,F.Z., Strong,L.C. and Wahl,G.M. (1992) Cell, 70, 937-948. MEDLINE Abstract

5. Nowell,P.C. (1976) Science, 194, 23-28. MEDLINE Abstract

6. Tlsty,T.D., Briot,A., Gualberto,A., Hall,I., Hess,S., Hixon,M., Kuppuswamy,D., Romanov,S., Sage,M. and White,A. (1995)Mutat. Res., 337, 1-7. MEDLINE Abstract

7. German,J. (1995) Dermatol. Clin., 13, 7-18. MEDLINE Abstract

8. Malkin,D., Li,F.P., Strong,L.C., Fraumeni,J.F.,Jr, Nelson,C.E., Kim,D.H., Kassel,J., Gryka,M.A., Bischoff,F.Z., Tainsky,M.A. and Friend,S.H. (1990) Science, 250, 1233-1238. MEDLINE Abstract

9. Srivastava,S., Zou,Z.Q., Pirollo,K., Blattner,W. and Chang,E.H. (1990) Nature, 348, 747-749. MEDLINE Abstract

10. Swift,M., Morrell,D., Massey,R.B. and Chase,C.L. (1991) N. Engl. J. Med., 325, 1831-1836. MEDLINE Abstract

11. Savitsky,K., Bar-Shira,A., Gilad,S., Rotman,G., Ziv,Y., Vanagaite,L., Tagle,D.A., Smith,S., Uziel,T., Sfez,S. et al.) (1995) Science, 268, 1749-1753. MEDLINE Abstract

12. Savitsky,K., Sfes,S., Tagle,D.A., Ziv,Y., Sartiel,A., Collins,F.S., Shiloh,Y. and Rotman,G. (1995) Hum. Mol. Genet., 4, 2025-2032. MEDLINE Abstract

13. Funk,W.D., Pak,D.T., Karas,R.H., Wright,W.E. and Shay,J.W. (1992)Mol. Cell. Biol., 12, 2866-2871. MEDLINE Abstract

14. O'Rourke,R.W., Miller,C.W., Kato,G.J., Simon,K.J., Chen,D.L., Dang,C.V. and Koeffler,H.P. (1990) Oncogene, 5, 1829-1832. MEDLINE Abstract

15. Raycroft,L., Schmidt,J.R., Yoas,K., Hao,M.M. and Lozano,G. (1991)Mol. Cell. Biol., 11, 6067-6074. MEDLINE Abstract

16. Dulic,V., Kaufmann,W.K., Wilson,S.J., Tlsty,T.D., Lees,E., Harper,J.W., Elledge,S.J. and Reed,S.I. (1994) Cell, 76, 1013-1023. MEDLINE Abstract

17. Imray,F.P. and Kidson,C. (1983) Mutat. Res., 112, 369-382. MEDLINE Abstract

18. Kastan,M.B., Onyekwere,O., Sidransky,D., Vogelstein,B. and Craig,R.W. (1991) Cancer Res., 51, 6304-6311. MEDLINE Abstract

19. Kuerbitz,S.J., Plunkett,B.S., Walsh,W.V. and Kastan,M.B. (1992)Proc. Natl Acad. Sci. USA, 89, 7491-7495. MEDLINE Abstract

20. Nelson,W.G. and Kastan,M.B. (1994) Mol. Cell. Biol., 14, 1815-1823. MEDLINE Abstract

21. O'Connor,P.M., Jackman,J., Jondle,D., Bhatia,K., Magrath,I. and Kohn,K.W. (1993) Cancer Res., 53, 4776-4780. MEDLINE Abstract

22. Painter,R.B. and Young,B.R. (1980) Proc. Natl Acad. Sci. USA, 77, 7315-7317. MEDLINE Abstract

23. Taylor,A.M.R., Harnden,D.G., Arlett,C.F., Harcourt,S.A., Lehmann,A.R., Stevens,S. and Bridges,B.A. (1975.) Nature, 258, 427-429.

24. Ellis,N.A., Groden,J., Ye,T.Z., Straughen,J., Lennon,D.J., Ciocci,S., Proytcheva,M. and German,J. (1995) Cell, 83, 655-666. MEDLINE Abstract

25. Davey,S., Han,C.S., Ramer,S.A., Klassen,J.C., Jacobson,A., Eisenberger,A., Hopkins,K.M., Lieberman,H.B. and Freyer,G.A. (1998) Mol. Cell. Biol., 19, 2721-2728.

26. Kaufmann,W.K., Schwartz,J.L., Hurt,J.C., Byrd,L.L., Galloway,D.A., Levedakou,E. and Paules,R.S. (1997) Cell Growth Differ., 8, 1105-1114. MEDLINE Abstract

27. Lieberman,H.B., Hopkins,K.M., Nass,M., Demetrick,D. and Davey,S. (1996) Proc. Natl Acad. Sci. USA, 93, 13890-13895. MEDLINE Abstract

28. Cimprich,K.A., Shin,R.B., Keith,C.T. and Schreiber,S.L. (1996) Proc. Natl Acad. Sci. USA, 93, 2850-2855. MEDLINE Abstract

29. Bentley,N.J., Holtzman,D.A., Flaggs,G., Keegan,K.S., DeMaggio,A., Ford,J.C., Hoekstra,M. and Carr,A.M. (1996) EMBO J., 15, 6641-6651. MEDLINE Abstract

30. al-Khodairy,F. and Carr,A.M. (1992) EMBO J., 11, 1343-1350. MEDLINE Abstract

31. Rowley,R., Subramani,S. and Young,P.G. (1992) EMBO J., 11, 1335-1342. MEDLINE Abstract

32. al-Khodairy,F., Fotou,E., Sheldrick,K.S., Griffiths,D.J., Lehmann,A.R. and Carr,A.M. (1994) Mol. Cell. Biol., 5, 147-160.

33. Enoch,T., Carr,A.M. and Nurse,P. (1992) Genes Dev., 6, 2035-2046. MEDLINE Abstract

34. Siede,W., Nusspaumer,G., Portillo,V., Rodriguez,R. and Friedberg,E.C. (1996) Nucleic Acids Res., 24, 1669-1675. MEDLINE Abstract

35. Onel,K., Koff,A., Bennett,R.L., Unrau,P. and Holloman,W.K. (1996) Genetics, 143, 165-174. MEDLINE Abstract

36. Thelen,M.P., Onel,K. and Holloman,W.K. (1994) J. Biol. Chem., 269, 747-754. MEDLINE Abstract

37. Sambrook,J., Fritsch,E.F. and Maniatis,T. (1989) Molecular Cloning: A Laboratory Manual, 2nd ed. Cold Spring Harbor Laboratory Press,Cold Spring Harbor, NY.

38. Thompson,J.D., Higgins,D.G. and Gibson,T.J. (1994) Nucleic Acids Res., 22, 4673-4680. MEDLINE Abstract

39. Mcleod,M., Stein,M. and Beach,D. (1987) EMBO J., 6, 729-736. MEDLINE Abstract

40. Leupold,U. (1970.) Meth. Cell Physiol., 4, 169-177.

41. Davey,S. and Beach,D. (1995) Mol. Biol. Cell, 6, 1411-1421. MEDLINE Abstract

42. Okazaki,K., Okazaki,N., Kume,K., Jinno,S., Tanaka,K. and Okayama,H. (1990) Nucleic Acids Res., 18, 6485-6489. MEDLINE Abstract

43. Soares,M.B., Bonaldo,M.F., Jelene,P., Su,L., Lawton,L. and Efstratiadis,A. (1994) Proc. Natl Acad. Sci. USA, 91, 9228-9232. MEDLINE Abstract

44. Lydall,D. and Weinert,T. (1995) Science, 270, 1488-1491. MEDLINE Abstract

45. Kato,R. and Ogawa,H. (1994) Nucleic Acids Res., 22, 3104-3112. MEDLINE Abstract

46. Kastan,M.B., Zhan,Q., el-Deiry,W.S., Carrier,F., Jacks,T., Walsh,W.V., Plunkett,B.S., Vogelstein,B. and Fornace,A.J., Jr (1992) Cell, 71, 587-597. MEDLINE Abstract

47. Swift,M., Reitnauer,P.J., Morrell,D. and Chase,C.L. (1987) N. Engl. J. Med., 316, 1289-1294. MEDLINE Abstract

48. Cheong,N., Wang,Y., Jackson,M. and Iliakis,G. (1992) Mutat. Res., 274, 111-122. MEDLINE Abstract

49. Knox,S.J., Sutherland,W. and Goris,M.L. (1993) Radiat. Res., 135, 24-31. MEDLINE Abstract

50. McKenna,W.G., Iliakis,G., Weiss,M.C., Bernhard,E.J. and Muschel,R.J. (1991) Radiat. Res., 125, 283-287. MEDLINE Abstract

51. Nagasawa,H., Keng,P., Harley,R., Dahlberg,W. and Little,J.B. (1994) Int. J. Radiat. Biol., 66, 373-379. MEDLINE Abstract

52. Su,L.N. and Little,J.B. (1993) Radiat. Res., 133, 73-79. MEDLINE Abstract

53. Keegan,K.S., Holtzman,D.A., Plug,A.W., Christenson,E.R., Brainerd,E.E., Flaggs,G., Bentley,N.J., Taylor,E.M., Meyn,M.S., Moss,S.B., Carr,A.M., Ashley,T. and Hoekstra,M.F. (1996) Genes Dev., 10, 2423-2437. MEDLINE Abstract

54. Scully,R., Chen,J., Plug,A., Xiao,Y., Weaver,D., Feunteun,J., Ashley,T. and Livingston,D.M. (1997) Cell, 88, 265-275. MEDLINE Abstract

55. Brugarolas,J. and Jacks,T. (1997) Nature Med., 3, 721-722.

56. Russell,K.J., Wiens,L.W., Demers,G.W., Galloway,D.A., Plon,S.E. and Groudine,M. (1995) Cancer Res., 55, 1639-1642. MEDLINE Abstract

57. Yao,S.-L., Akhtar,A.J., McKenna,K.A., Bedi,G.C., Sidransky,D., Mabry,M., Ravi,R., Collector,M.I., Jones,R.J., Sharkis,S.J., Fuchs,E.J. and Bedi,A. (1996) Nature Med., 2, 1140-1143.

*To whom correspondence should be addressed at: Botterell Hall, Room A309A, Queen's University, Kingston K7L 3N6, Canada. Tel: +1 613 545 6923; Fax: +1 613 545 6830; Email: sd13@post.queensu.ca

This page is run by Oxford University Press, Great Clarendon Street, Oxford OX2 6DP, as part of the OUP Journals
Comments and feedback: www-admin{at}oup.co.uk
Last modification: 14 Aug 1998
Copyright©Oxford University Press, 1998.
Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
 Mol. Cell. Biol.Home page
K. M. Hopkins, W. Auerbach, X. Y. Wang, M. P. Hande, H. Hang, D. J. Wolgemuth, A. L. Joyner, and H. B. Lieberman
Deletion of Mouse Rad9 Causes Abnormal Cellular Responses to DNA Damage, Genomic Instability, and Embryonic Lethality
Mol. Cell. Biol., August 15, 2004; 24(16): 7235 - 7248.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
I. Hirai and H.-G. Wang
A Role of the C-terminal Region of Human Rad9 (hRad9) in Nuclear Transport of the hRad9 Checkpoint Complex
J. Biol. Chem., July 5, 2002; 277(28): 25722 - 25727.
[Abstract] [Full Text] [PDF]

Home page
 Mol. Cell. Biol.Home page
K. Yoshida, K. Komatsu, H.-G. Wang, and D. Kufe
c-Abl Tyrosine Kinase Regulates the Human Rad9 Checkpoint Protein in Response to DNA Damage
Mol. Cell. Biol., May 15, 2002; 22(10): 3292 - 3300.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
R. P. St.Onge, B. D. A. Besley, M. Park, R. Casselman, and S. Davey
DNA Damage-dependent and -independent Phosphorylation of the hRad9 Checkpoint Protein
J. Biol. Chem., November 2, 2001; 276(45): 41898 - 41905.
[Abstract] [Full Text] [PDF]

Home page
 Nucleic Acids ResHome page
H. Hang, S. J. Rauth, K. M. Hopkins, and H. B. Lieberman
Mutant alleles of Schizosaccharomyces pombe rad9+ alter hydroxyurea resistance, radioresistance and checkpoint control
Nucleic Acids Res., November 1, 2000; 28(21): 4340 - 4349.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
T. Bessho and A. Sancar
Human DNA Damage Checkpoint Protein hRAD9 Is a 3' to 5' Exonuclease
J. Biol. Chem., March 10, 2000; 275(11): 7451 - 7454.
[Abstract] [Full Text] [PDF]

Home page
 J. Cell Sci.Home page
D Griffiths, M Uchiyama, P Nurse, and T. Wang
A novel mutant allele of the chromatin-bound fission yeast checkpoint protein Rad17 separates the DNA structure checkpoints
J. Cell Sci., January 3, 2000; 113(6): 1075 - 1088.
[Abstract] [PDF]

Home page
 Mol. Biol. CellHome page
R. P. St. Onge, C. M. Udell, R. Casselman, and S. Davey
The Human G2 Checkpoint Control Protein hRAD9 Is a Nuclear Phosphoprotein That Forms Complexes with hRAD1 and hHUS1
Mol. Biol. Cell, June 1, 1999; 10(6): 1985 - 1995.
[Abstract] [Full Text]

Home page
 J. Biol. Chem.Home page
E. Volkmer and L. M. Karnitz
Human Homologs of Schizosaccharomyces pombe Rad1, Hus1, and Rad9 Form a DNA Damage-responsive Protein Complex
J. Biol. Chem., January 8, 1999; 274(2): 567 - 570.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
R. L. Cai, Y. Yan-Neale, M. A. Cueto, H. Xu, and D. Cohen
HDAC1, a Histone Deacetylase, Forms a Complex with Hus1 and Rad9, Two G2/M Checkpoint Rad Proteins
J. Biol. Chem., September 1, 2000; 275(36): 27909 - 27916.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
M. A. Burtelow, S. H. Kaufmann, and L. M. Karnitz
Retention of the Human Rad9 Checkpoint Complex in Extraction-resistant Nuclear Complexes after DNA Damage
J. Biol. Chem., August 18, 2000; 275(34): 26343 - 26348.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
M. Rauen, M. A. Burtelow, V. M. Dufault, and L. M. Karnitz
The Human Checkpoint Protein hRad17 Interacts with the PCNA-like Proteins hRad1, hHus1, and hRad9
J. Biol. Chem., September 15, 2000; 275(38): 29767 - 29771.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
M.-J. Chen, Y.-T. Lin, H. B. Lieberman, G. Chen, and E. Y.-H. P. Lee
ATM-dependent Phosphorylation of Human Rad9 Is Required for Ionizing Radiation-induced Checkpoint Activation
J. Biol. Chem., May 4, 2001; 276(19): 16580 - 16586.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
D. J. Mazur and F. W. Perrino
Structure and Expression of the TREX1 and TREX2 3'right-arrow5' Exonuclease Genes
J. Biol. Chem., April 27, 2001; 276(18): 14718 - 14727.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
M. A. Burtelow, P. M. K. Roos-Mattjus, M. Rauen, J. R. Babendure, and L. M. Karnitz
Reconstitution and Molecular Analysis of the hRad9-hHus1-hRad1 (9-1-1) DNA Damage Responsive Checkpoint Complex
J. Biol. Chem., July 6, 2001; 276(28): 25903 - 25909.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
H. Zhang, Z. Zhu, G. Vidanes, D. Mbangkollo, Y. Liu, and W. Siede
Characterization of DNA Damage-stimulated Self-interaction of Saccharomyces cerevisiae Checkpoint Protein Rad17p
J. Biol. Chem., July 6, 2001; 276(28): 26715 - 26723.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Print PDF (250K) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (27)
Right arrowRequest Permissions
Right arrow Commercial Re-use Guidelines
for Open Access NAR Content
Google Scholar
Right arrow Articles by Udell, C. M.
Right arrow Articles by Davey, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Udell, C. M.
Right arrow Articles by Davey, S.
Social Bookmarking
Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?