| Nucleic Acids Research | Pages |
p59OASL, a 2[prime]-5[prime] oligoadenylate synthetase like protein: a novel human gene related to the 2[prime]-5[prime] oligoadenylate synthetase family
Introduction
Materials And Methods
Cloning and sequencing
Rapid amplification of cDNA ends (RACE)
Alignment
Construction of phylogenetic trees
Northern blotting
RNase protection assay
Cell culturing
Results And Discussion
EST identification and sequencing
Gene structure
Primary structure of the p59OASL protein
Phylogenetic studies
The expression pattern of p59OASL
The functions of p59OASL
Acknowledgements
References
p59OASL, a 2[prime]-5[prime] oligoadenylate synthetase like protein: a novel human gene related to the 2[prime]-5[prime] oligoadenylate synthetase family
DDBJ/EMBL/GenBank accession nos AJ225089 and AJ225090
ABSTRACT
INTRODUCTION
The 2[prime]-5[prime] oligoadenylate (2-5A) system is a regulated RNA decay pathway, consisting of a number of 2[prime]-5[prime] oligoadenylate synthetases (2-5A synthetases) and a 2-5A activated ribonuclease, normally referred to as RNase L. The 2-5As were originally described as low molecular weight inhibitors of protein synthesis, which were produced in cell free extracts of interferon treated cells, especially following incubation with Poly I·Poly C (1,2). The ability of 2-5As to bind to and activate RNase L, resulting in a general RNA degradation, makes them potent inhibitors of protein synthesis (3,4).
The 2-5As are produced by a family of enzymes, the 2[prime]-5[prime] oligoadenylate synthetases (2-5A synthetase or OAS, EC 2.7.7.-). Hitherto, two human genes encoding highly homologous 2-5A synthetases have been described, referred to as the p42OAS gene and the p69OAS gene. Both genes are situated on chromosome 12 (5). The p42OAS gene encodes two splice variants, which differ only at their C-termini, having a molecular weight of 42 and 46 kDa (6,7). Also the p69OAS gene encodes two splice variants differing at their C-termini, having theoretical molecular weights of 79 and 83 kDa, but migrating with apparent molecular weights of 69 and 71 kDa, respectively (8). Most likely, the p69OAS gene arose from a duplication of an ancestral 2-5A synthetase gene, since it harbours two repeated regions, each with ~40% homology to the p42OAS form (8). Furthermore, immunological evidence exists for a 2-5A synthetase with an apparent molecular weight of 100 kDa (9), which has also been found by purification procedures (10).
The biosynthesis of all the known 2-5A synthetases is stimulated by interferon (reviewed in 11). 2-5A synthetase is produced as a latent enzyme which is activated by certain classes of RNA, mainly double stranded RNA (dsRNA) (12). Several studies have dealt with stimulation of semipurified 2-5A synthetases by Poly I·Poly C and analogues thereof (reviewed in 13). Recently, we addressed the structural requirements of the RNA activator of pure 2-5A synthetase (p46 isoform) (12).
The involvement of the 2-5A system in the interferon induced antiviral effect has been inferred from several sets of experiments. For instance, over-expression of the p42OAS in Chinese hamster ovary (CHO) cells gives resistance to infection by picornavirus, but not to vesicular stomatitis virus (VSV) (14). In addition, transgenic plants expressing 2-5A synthetase as well as RNase L show a remarkable increase in their resistance to viral infections (15,16). The 2-5A system has also been suggested to play a role in the growth suppression engendered by interferons (17). Expression of a dominant negative RNAse L mutant in murine cells resulted in suppression of both the interferon mediated protection against picornavirus and the antiproliferative effect otherwise exerted by interferon (18). Recent evidence from RNase L deficient mice strongly suggests that apoptosis can be induced via the 2-5A system. The RNase L -/- mice had an enlarged thymus, caused by the lack of normal apoptosis of thymocytes and fibroblasts in the thymus (19).
In general, RNase L is expressed in all tissues and only weakly induced by interferon, (reviewed in 20), therefore the synthesis of 2-5As seems to be the controlling step in inducing RNA decay by the 2-5A pathway. The different isoforms of 2-5A synthetase apparently have similar enzymatic capacities, but the isoforms seem to have different tissue specific expression patterns and to respond differently to treatment with various cytokines including interferons (reviewed in 11).
The recent development of Expressed Sequence Tag (EST) databases and the increasing complexity of these databases (reviewed in 21) gives an opportunity for the identification of new members of a given protein family. We therefore searched the EST database for sequences displaying homology to 2-5A synthetase. In the following, we thus present the cloning and characterisation of a novel member of the human 2-5A synthetase family and the corresponding gene.
MATERIALS AND METHODS
Cloning and sequencing
An EST clone (HG# 1173451) encoding a putative novel 2-5A syntethase was identified in an EST database by searching with the known human 2-5A family members P69OAS (M87284) and p42OAS (P00973) using the BLAST search algorithm (22). This clone was obtained from Human Genome Sciences and sequenced in its full length by the primer walking approach. Sequencing was performed on an Applied Biosystems 373A sequencer, using the ABI Prism Dye Terminator Cycle Sequencing kit (Perkin Elmer). Each strand was sequenced twice.
Rapid amplification of cDNA ends (RACE)
The RACE was performed as described in (23). Total RNA from HeLa cells was used as the RNA source. The primers for the second nested PCR contained a BamHI/XhoI restriction site, respectively, which allowed cloning of the resulting PCR product in the BamHI/XhoI sites of the pBluescript SK vector (Stratagene). The clones were sequenced using the general sequencing primers M13-21 and M13 reverse (DNA technology, Aarhus, Denmark). Primer sequences were as follows:
Gene Specific Primer 1 (GSP1) TCCATATCAGCCTCAGAAC; GSP 2 (including a BamHI site) CGCGGATCCGGAAGCTGTGGAAACAGCTC; Linker primer 1 CAATCAAGAATCCCTGCTCAGCGTAA; and Linker primer 2 (including a XhoI site) CGCCCTCGAGCCTCAACACCTACCCTATC.
Alignment
The alignment was established using the following sequences: Human P69OAS (M87284), Human p59OASL (AJ225089), Human p42OAS (Swissprot P00973), Mouse OAS (L3) (M33863), Rat OAS (Z18877), Porcine OAS (AJ225090) and Chicken OAS (AB002585) (accession numbers in parentheses). Alignment was performed with the clustalw programme (clustalw, an interactive service at the http://www2.ebi.ac.uk/clustalw ) using default parameters (24). The alignment was resistant to changes of parameters. The output was embellished using the BOXSHADE software (http://ulrec3.unil.ch/software/BOX_form.html ).
Construction of phylogenetic trees
The phylogenetic tree was constructed using the software supplied with the Phylip package (version 3.57) (25). The tree shown was created using maximum parsimony analysis on multiple aligned sequences (program PROTPARS, default parameters). The bootstrap re-sampling method was used (100 replicates) to assess the confidence of each node in the maximum parsimoni tree (programs SEQBOOT and CONSENSE). Phylogenetic trees constructed using the neighbour-joining algorithm on the same set of data gave a congruent phylogeny [programs PROTDIST (setting DAYHOFF matrix) and NEIGHBOR (default parameters), or using Maximum Likelihood analysis (program PROTML, default settings)].
Northern blotting
Northern blots were performed using MTN filters from Clontech. The filters were hybridised in Hybrisol (Oncor) overnight at 42°C, at a probe concentration of ~1.5 × 106 c.p.m./ml. After hybridisation the blots were washed at high stringency at 65°C and exposed to a film. The probe was prepared by isolating a BamHI/XhoI fragment of the p59 coding sequence (nucleotides 374-919) or a 1.3 kb EcoRI fragment from the p42 cDNA (nucleotides 1-1275), from an agarose gel (Qiagen Gel Extraction kit). The isolated fragment was radioactively labelled using Stratagene Prime-it II kit and [[alpha]-32P]dCTP.
RNase protection assay
A XhoI/KpnI fragment of the p59 cDNA (280 bp) was cloned in to the appropriate sites in the pBluescript SK(+) vector. After linearisation with XhoI, T7 transcription was performed according to standard protocols using [[alpha]-32P]UTP as incorporated label. The specific activity of the probe was ~1 × 1020 c.p.m./mol. The [gamma]-actin probe was prepared as described by Gunning et al. (26).
RNase protection was performed using the Ambion RPA II kit (Cat. #1410), following the manufacturer's instruction. p59 probe (3 × 10-16 mol) and 1 × 10-15 mol of the [gamma]-actin probe was hybridised to 10 µg of total RNA from amniotic fluid (AMA) cells, treated as indicated.
Cell culturing
AMA cells (gift from J. E. Celis, Aarhus, Denmark) were grown in glutamax medium containing 10% newborn calf serum and penicillin/streptomycin, induced with 500 U/ml interferon-[alpha] or 100 U/ml interferon-[gamma] for the indicated time. RNA samples were prepared by the acid guanidinium thiocyanate/phenol/chloroform extraction method (27).
RESULTS AND DISCUSSION
EST identification and sequencing
We searched the EST database for clones showing similarity to already known forms of 2-5A synthetase as described by Adams et al. (28). An EST clone appeared that revealed homology to the known forms of 2-5A synthetase and this clone was sequenced in its full length. The clone displayed a long open reading frame (ORF) and the corresponding amino acid sequence showed strong homology to known 2-5A synthetase proteins (Figs
To obtain the missing 5[prime] part of the cDNA clone we performed the new RACE procedure on total RNA from HeLa cells (Fig.
The additional 19 bp that were found by `new RACE' contained two in frame start codons. As the two AUG codons are only separated by 6 nt it is possible that either one could be used as an initiation codon (29). In this case, however, the second AUG codon is placed in a context making it highly unlikely to be used as the principal start codon (30) (the normal adenine in position -3 and the normal guanine in position +4 are both substituted by a cytosine). The complete cDNA clone contains 1819 bp and has one ORF coding for a 514 amino acid protein with a predicted molecular mass of 59 226 Da, hence called p59OASL (59 kDa 2-5 oligoadenylate synthetase-like protein) (accession number AJ225090). The size of the cDNA agrees well with the observed size of the messenger (1.8 kb) in northern blots (Fig.
A 3[prime] fragment of the p59 gene has previously been described as a thyroid receptor interactor (TRIP14) due to a yeast two-hybrid screening (31), where a part of p59 (amino acids 260-413) is reported (Q15646). We have not investigated the possible link of p59OASL to the thyroid hormone system.
Gene structure
Using the cDNA sequence as input we searched the High Throughput Genomic Sequences databases using the BLAST algorithm. We found a clear match to a bac-clone 92N15 currently under sequencing at the Sanger center (Cambridge, UK). This clone is part of the MODY3 (Maturity onset of diabetes 3) region, which maps to chromosome 12q24.2 (32). The highly homologous genes p42OAS and p69OAS genes (5) also map to chromosome 12 where they link to the marker d12s1718 (Unigene Hs.82396 and Hs.24815, NCBI) with the genetic map position 129 cM and Radiation Hybrid map position 576 cR. The bac-clone 92N15 contains the marker d12s2088 (R. Cox, personal communication), so the p59OASL gene maps in the MODY3 region at map positions 138 cM and 580 cR. The two markers d12s1718 and d12s2088 are both contained in the WC12.8 contig (singly linked) (Whitehead Institute, MA, USA).
Based upon the sequence data of bac-clone 92N15 from the Sanger centre, we determined the structure of the p59OASL gene to be composed of 6 exons. Exons 1-5 encode the 349 amino acid N-terminal domain that has high homology to other 2-5A synthetases, exon 6 encodes a 165 amino acid C-terminal domain that has no homology to any of the known 2-5A synthetases (Fig.
The gene structure of the p42OAS gene has previously been determined (6). This gene is composed of 7 exons with the translational start site situated in exon 3. By comparing the intron exon boundaries of the p59OASL gene to the p42OAS gene, it became evident that exons 3-7 of the p42OAS gene have a structure similar to that of exons 1-5 of the p59OASL gene (Fig.
| Figure 1. (A) Organisation of the p59OASL gene. Upper numbers refer to the first and last nucleotide in an exon, according to the cDNA for p59OASL. Numbers in the lower position indicate the size of a given intron. (B) The amino acid sequence of the p42OAS and p59OASL proteins were aligned using the clustalw program. The first and last amino acid in each exon is highlighted. The single highlighted leucine indicates the possible alternative splice site in the p42 gene, which is used to give the p46 variant. |
A
 B  |
Both the gene structure of p59OASL and the primary structure of the p59OASL protein suggest a two domain structure of the p59OASL protein, consisting of an N-terminal 2-5A synthetase domain of ~350 amino acids encoded by exons 1-5 and a C-terminal domain on 165 amino acids encoded by exon 6.
The promoter region 3000 bases upstream of the initiation site was analysed for the presence of transcription factor binding sites. Among the numerous putative sites several putative ISRE sites around -150, -290, -330 and -960 nt can be linked to classical interferon induction pathways including STAT1 and IRF1 (33). However, we have also found one putative IRF1 and two IRF2 sites in the middle of the ~10 kb intron 1, which might explain the moderate interferon induction detected in the RNase protection assays (see later). However, the activity of these sites has to be determined.
| Figure 2. (A) Alignment of various 2-5A synthetases. The amino acid sequences of the N-terminal part of the indicated 2-5A synthetase proteins (see text), were aligned using the clustalw program. (B) Alignment of the C-terminal part (165 amino acids) of p59OASL coded by exon 6, with ISG15, Human Ubiquitin-like protein GDX (UBIL) and two consecutive ubiquitins separated by XXX. The aligned sequences were subsequently embellished using the BOXHADE program. |
A
 B |
Figure 3. PCR products from the RACE procedure were separated on a 1% agarose gel. A strong band appears when the RNA was decapped prior to ligation, but not if decapping was omitted. Prolonging the extension time to 4 min did not lead to new larger bands. Lane 1, PCR using decapped RNA and an extension time of 1 min; lane 2, decapped RNA and a extension time of 4 min; lane 3, RNA not decapped prior to ligation, extension time 1 min; lane 4, same as lane 3 but the extension time was 4 min.
We aligned the amino acid sequence of seven different 2-5A synthetases, available in the Swissprot or GenBank databases (Fig. Recent mutational studies showed that a LXXXP motif at the N-terminus is important for enzymatic function. If either the leucine or proline were mutated, the enzyme would lose its capability to form 2-5As but would still be able to bind both ATP and dsRNA (36). This motif is conserved except in the chicken 2-5A synthetase form. Generally the amino acids from 190 to 320 are well-conserved (numbers according to the p59OASL sequence). Mutational and biochemical studies placed the high affinity ATP binding domain of p42OAS in the proximity of lysine 199 (p42 numbering) (37). A stretch of ~25 amino acids around lysine 199 is highly conserved, except for some relaxation in the p69N sequence. We also point out two other highly conserved motifs, the YALTLLT(v/i)YAWE motif and the RP(v/i)ILDPADPT motif. No functional data exist for those motifs. Finally, there is a P-loop motif, presumably involved in phosphate binding, in the p42OAS family which is especially homologous to adenylate kinases (myokinases): VVXGXXSGKGT. The last glycine (G) is unique in the P-loop of these two protein families compared to all other P-loops (38). This is a striking phenomenon considering that the substrates for these two very different enzymes actually are rather similar, ATP + ATP versus ATP + AMP. However, in p59OASL the crucial lysine (K) is replaced by an asparagine (N) which could be an indication of the essential differences in the activity of p59OASL compared to all the other 2-5A synthetases, including the most homologous one, chicken 2-5A synthetase. The same region of the p42OAS was proposed to share structural homologies to the rat DNA polymerase [beta] phosphate binding loop (39). The aspartate (D) residues 75 and 77 are presumed to co-ordinate an active site magnesium ion. In p59OASL these aspartates are replaced by glutamates by single nucleotide substitutions. Glutamate remains capable of co-ordinating the crucial magnesium ion, but the change from aspartate to glutamate might lead to a difference in substrate specificity or in the reaction conditions required. Further mutational studies are necessary to shed light on the functional role of the P-loop region of p59OASL, as well as the other members of the 2-5A synthetase family. The C-terminal domain, exon 6, of p59OASL shows homology to the ubiquitin like proteins ISG15 [M13755, (18)] (identities = 40/165) and the ubiquitin-like protein GDX [P11441, (40)] (identities = 31/165) (Fig. Figure 5. Phylogenetic tree for the different 2-5A synthetase forms. Bootstrap values are shown. Using the alignments presented above, we have constructed a hypothetical phylogenetic tree (Fig. From the topology of the phylogenetic tree it is evident that the multiple isoforms seen in humans diverged before the radiation of the mammalian class, meaning that a similar number of isoforms are very likely to exist in other mammalian species. To evaluate the expression of the p59OASL messenger RNA in different tissues we made northern blots using Multiple Tissue Northern from Clontech (Fig. 
Figure 4. Northern blots. Filters containing 2 µg of poly A+ RNA pr. lane from various tissues were probed with (A) a p59OASL specific probe or (B) a p42OAS/p46OAS specific probe. Lane 1, spleen; lane 2, thymus; lane 3, prostate; lane 4, testis; lane 5, uterus; lane 6, small intestine; lane 7, colon (mucosal lining); lane 8, peripheral blood leucocytes. The p42/p46 probe gives distinct bands corresponding to the p42 and p46 isoforms. The origin of the larger bands is unknown.
A
B
Primary structure of the p59OASL protein
Phylogenetic studies
The expression pattern of p59OASL
To our knowledge, the expression patterns of the p42OAS or p69OAS isoforms have not been addressed in detail, but re-probing of the filter with a p42/p46 specific probe showed a more widespread expression of this isoform (Fig.
We investigated the induction of p59OASL by interferon-[alpha] and interferon-[gamma] in AMA cells. The transcription of p59 is stimulated 2-5-fold by the addition of interferon-[alpha] and 2-3-fold by interferon-[gamma], as demonstrated by RNase protection assays (Fig.
The data presented here suggest that the p59OASL expression is strictly controlled, and only expressed in certain tissues. Presumably this regulation correlates with the cellular function of p59OASL. We are currently investigating whether p59OASL is linked to the interferon system in a similar manner as the p42OAS and p69OAS isoforms, or whether p59OASL is part of other cytokine systems. In the view of the prevalence of p59OASL in highly proliferating cells, we believe that a role may exist for p59OASL as part of a general growth control pathway in those cells.
Table 1.
| Tissue | Relative expression | Number of blots where tissue is represented |
| PBL | ++++ | 3 |
| Stomach | +++(+) | 1 |
| Spleen | +++ | 3 |
| Lymph node | +++ | 1 |
| Colon (muscosal lining) | +++ | 2 |
| Fetal brain | +++ | 1 |
| Thyroid | ++(+) | 1 |
| Testis | ++(+) | 3 |
| Thymus | ++ | 3 |
| Fetal liver | ++ | 1 |
| Pancreas | ++ | 1 |
| Adrenal medulla | ++ | 1 |
| Adrenal cortex | ++ | 1 |
| Fetal kidney | ++ | 1 |
| Uterus | ++ | 1 |
| Small intestine | + | 3 |
| Prostate | + | 2 |
| Ovary | + | 1 |
| Fetal lung | + | 1 |
The functions of p59OASL
Escherichia coli expressed histidine-tagged p59OASL does not have any 2-5A synthetase activity using conditions (44), where an equivalent histidine-tagged p42OAS was fully active. This is not surprising, taking into account the differences in the presumed active sites, notably the P-loop.
Figure 6. Regulation of the p59OASL gene by interferon. The induction of the p59OASL gene by interferon-[alpha] or interferon-[gamma] was measured by RNAse protection assays, using total RNA form induced AMA cells. Cells were induced as indicated. The protected fragments were separated on a 5% native polyacrylamide gel, and the interesting bands were quantified using a PhosphorImager. The p59OASL signal was normalised to the [gamma]-actin signal prior to calculation of the induction. Each column represents a mean of four independent samples, the standard deviation is indicated. There are evidently numerous experiments that have to be performed to explore the functions of p59OASL, which could constitute an important new regulatory feature in the 2-5A pathway and connect this to the ubiquitin systems including the proteasome control of cell cycle factors and transcription factors. In particular, p59OASL could be a factor in the 2-5A involvement in apoptosis (19,45).
ACKNOWLEDGEMENTS
We would like to thank the following people: Anette Bejder for excellent help with the RACE experiment and Lars Aagaard for giving invaluable help in using the Phylip package and for many fruitful discussions, Niels Ole Kjeldgaard and Tracey Flint for critical reading of the manuscript and many valuable comments, Andrew King at the Sanger Centre (Cambridge, UK) and R. D. Cox, Welcome Trust Centre for Human Genetics (Oxford, UK) for valuable help with the genomic sequence and finally Cecilia Rosada Kjeldsen for helpful discussion. This work was supported by the Danish Natural Science Research Council (BIOTEK 3 program), The Danish Cancer Society and the Karen Elise Jensen's Foundation.
REFERENCES
This article has been cited by other articles:
This page is run by Oxford University Press, Great Clarendon Street, Oxford OX2 6DP, as part of the OUP Journals
Comments and feedback: www-admin{at}oup.co.uk
Last modification: 29 Aug 1998
Copyright©Oxford University Press, 1998.
CiteULike 
Connotea 
Del.icio.us What's this?
J Tang, Y Gu, M Zhang, S Ye, X Chen, Q Guo, J Qian, C Bao, S Chen, and N Shen
Increased expression of the type I interferon-inducible gene, lymphocyte antigen 6 complex locus E, in peripheral blood cells is predictive of lupus activity in a large cohort of Chinese lupus patients
Lupus,
September 1, 2008;
17(9):
805 - 813.
[Abstract]
[PDF]
R. H. Silverman
Viral Encounters with 2',5'-Oligoadenylate Synthetase and RNase L during the Interferon Antiviral Response
J. Virol.,
December 1, 2007;
81(23):
12720 - 12729.
[Full Text]
[PDF]
S. V. Scherbik, J. M. Paranjape, B. M. Stockman, R. H. Silverman, and M. A. Brinton
RNase L Plays a Role in the Antiviral Response to West Nile Virus
J. Virol.,
March 15, 2006;
80(6):
2987 - 2999.
[Abstract]
[Full Text]
[PDF]
W. Yan, L. Ma, P. Stein, S. A. Pangas, K. H. Burns, Y. Bai, R. M. Schultz, and M. M. Matzuk
Mice Deficient in Oocyte-Specific Oligoadenylate Synthetase-Like Protein OAS1D Display Reduced Fertility
Mol. Cell. Biol.,
June 1, 2005;
25(11):
4615 - 4624.
[Abstract]
[Full Text]
[PDF]
M. J. May, S. E. Larsen, J. H. Shim, L. A. Madge, and S. Ghosh
A Novel Ubiquitin-like Domain in I{kappa}B Kinase {beta} Is Required for Functional Activity of the Kinase
J. Biol. Chem.,
October 29, 2004;
279(44):
45528 - 45539.
[Abstract]
[Full Text]
[PDF]
Y. Kurokawa, R. Matoba, H. Nagano, M. Sakon, I. Takemasa, S. Nakamori, K. Dono, K. Umeshita, N. Ueno, S. Ishii, et al.
Molecular Prediction of Response to 5-Fluorouracil and Interferon-{alpha} Combination Chemotherapy in Advanced Hepatocellular Carcinoma
Clin. Cancer Res.,
September 15, 2004;
10(18):
6029 - 6038.
[Abstract]
[Full Text]
[PDF]
R. V. Warke, K. Xhaja, K. J. Martin, M. F. Fournier, S. K. Shaw, N. Brizuela, N. de Bosch, D. Lapointe, F. A. Ennis, A. L. Rothman, et al.
Dengue Virus Induces Novel Changes in Gene Expression of Human Umbilical Vein Endothelial Cells
J. Virol.,
November 1, 2003;
77(21):
11822 - 11832.
[Abstract]
[Full Text]
[PDF]
S. Falt, K. Holmberg, B. Lambert, and A. Wennborg
Long-term global gene expression patterns in irradiated human lymphocytes
Carcinogenesis,
November 1, 2003;
24(11):
1837 - 1845.
[Abstract]
[Full Text]
[PDF]
S. Eskildsen, J. Justesen, M. H. Schierup, and R. Hartmann
Characterization of the 2'-5'-oligoadenylate synthetase ubiquitin-like family
Nucleic Acids Res.,
June 16, 2003;
31(12):
3166 - 3173.
[Abstract]
[Full Text]
[PDF]
J. B. Smith, T. T. Nguyen, H. J. Hughes, H. R. Herschman, D. P. Widney, K. C. Bui, and L. E. Rovai
Glucocorticoid-attenuated response genes induced in the lung during endotoxemia
Am J Physiol Lung Cell Mol Physiol,
September 1, 2002;
283(3):
L636 - L647.
[Abstract]
[Full Text]
[PDF]
A. A. Perelygin, S. V. Scherbik, I. B. Zhulin, B. M. Stockman, Y. Li, and M. A. Brinton
Positional cloning of the murine flavivirus resistance gene
PNAS,
July 9, 2002;
99(14):
9322 - 9327.
[Abstract]
[Full Text]
[PDF]
S. Kumar, C. Mitnik, G. Valente, and G. Floyd-Smith
Expansion and Molecular Evolution of the Interferon-Induced 2'-5' Oligoadenylate Synthetase Gene Family
Mol. Biol. Evol.,
May 1, 2000;
17(5):
738 - 750.
[Abstract]
[Full Text]
[PDF]
K. M. McAveney, M. L. Book, P. Ling, J. Chebath, and L.-y. Yu-Lee
Association of 2',5'-Oligoadenylate Synthetase with the Prolactin (PRL) Receptor: Alteration in PRL-Inducible Stat1 (Signal Transducer and Activator of Transcription 1) Signaling to the IRF-1 (Interferon-Regulatory Factor 1) Promoter
Mol. Endocrinol.,
February 1, 2000;
14(2):
295 - 306.
[Abstract]
[Full Text]
S. N. Sarkar, A. Ghosh, H.-W. Wang, S.-S. Sung, and G. C. Sen
The Nature of the Catalytic Domain of 2'-5'-Oligoadenylate Synthetases
J. Biol. Chem.,
September 3, 1999;
274(36):
25535 - 25542.
[Abstract]
[Full Text]
[PDF]
D. Rebouillat, A. Hovnanian, I. Marie, and A. G. Hovanessian
The 100-kDa 2',5'-Oligoadenylate Synthetase Catalyzing Preferentially the Synthesis of Dimeric pppA2'p5'A Molecules Is Composed of Three Homologous Domains
J. Biol. Chem.,
January 15, 1999;
274(3):
1557 - 1565.
[Abstract]
[Full Text]
[PDF]
This Article 
Abstract
Print PDF (425K)
Alert me when this article is cited
Alert me if a correction is posted
Services
Email this article to a friend
Similar articles in this journal
Similar articles in ISI Web of Science
Similar articles in PubMed
Alert me to new issues of the journal
Add to My Personal Archive
Download to citation manager
Search for citing articles in:
ISI Web of Science (42)
Request Permissions
Commercial Re-use Guidelines
for Open Access NAR Content
Google Scholar
Articles by Hartmann, R.
Articles by Justesen, J.
Search for Related Content
PubMed
PubMed Citation
Articles by Hartmann, R.
Articles by Justesen, J.
Social Bookmarking
What's this?