Nucleic Acids Research

Gel shift analyses

Gel shift assays were performed in a total volume of 20 µl using a ³²P-labeled DNA probe generated by annealing complementary 26 bp oligos comprising the PED element. The sequences ofthese oligos are: TCGAGCCGTAAATAGTTATCTTCCAC andTCGAGTGGAAGATAACTATTTACGGC; bolded sequences correspond to XhoI sites. Annealed oligos were labeled as previously described (19,20). Typical probe specific activity was [ge]5000 c.p.m./fmol DNA and 20 fmol of labeled DNA (~100 000 c.p.m.) was used in each assay. Binding reactions were incubated at room temperature for 20 min and protein-DNA complexes were separated from unbound DNA as previously described (19).

In some experiments a double-stranded oligo termed PEP (TBP positive element proximal) was used as a non-specific competitor, the sequence of which is: TCGAGGGGAAAAGAAAAAAATTTTC (9). A double-stranded ABF1 consensus oligo was also used, the sequence of which is: TCGAGATCACTTATCACGAC. In the antibody gel shift experiments, DNA binding assays were conducted as detailed above except either non-immune or anti-Abf1p IgGs were added as indicated in the figure legends. IgGs were pre-incubated with extract at room temperature for 15 min prior to addition of binding buffer and probe.

Chemical interference assays

To generate fragments for chemical interference DNA binding assays, duplex oligos comprising the PED element described above were ligated into XhoI digested pBluescript II KS+ (Stratagene). Digestion of these constructs with BamHI and KpnI restriction endonucleases generated fragments which could be singly end-labeled on either strand at the BamHI site (20). Specific activities of the labeled PED probes averaged 2000 c.p.m./fmol DNA. These end-labeled probes were partially reacted with either DMS or DEPC and used in chemical interference assays as described (21,22).

Site-directed mutagenesis

Site-directed mutagenesis was performed using plasmid pTW-1076 as template as described previously (9). Oligos complementary to TBP promoter sequences from -147 to -128 were used for mutagenesis (Fig. 2A). Sequencing was performed to ensure that only the correct mutations were introduced and that the spt15::lacZ fusion gene was in frame.

[beta]-galactosidase and genomic footprinting assays

[beta]-galactosidase assays were performed exactly as described previously (9). DMS genomic footprinting was performed as described (9).

Purification of PED binding activity

The protease deficient yeast strain BJ5457 (23) (MATa ura3-52 trp1 lys2-801 his3[Delta]200 pep4::HIS3 prb1[Delta]1.6R can1 Gal⁺) was used for PEDBF purification (details available upon request). Whole cell extract (WCE) was prepared as described previously (24). WCE [1.3 × 10⁸ U of ABF1 DNA binding/SA 14.35 U/µg protein (1 U of binding activity is the amount of protein required to shift 1 fmol of labeled probe in the EMSA assay)] was subjected to standard heparin-Sepharose chromatography (recovered 3 × 10⁷ U; SA 17.3 U/µg) and DEAE Sepharose chromatography (recovered2.6 × 10⁷ U; SA 128 U/µg) prior to two cycles of chromatography on a PED-DNA affinity column (second pass recovered 1.4 × 10⁶ U; SA 23 000 U/µg protein). The PED-DNA affinity column was generated as described (25) using an oligo containing PED sequences fused to oligo dA, of sequence TGAAGCCGTAAATAGTTATCTTCCAA(dA)₁₈.

Immunoblot analysis

Proteins/extracts were fractionated via SDS-PAGE using a 6% polyacrylamide gel, transferred to PVDF membranes (Millipore) and subsequently blocked and incubated with either anti-Abf1p or preimmune antibodies as described by Francesconi and Eisenberg (26).

UV crosslinking

Binding/crosslinking reactions were performed in a final volume of 50 µl. After incubation at room temperature, the reaction mixtures were then transferred to a 96-well microtiter plate. Crosslinking was induced by placing a UV lamp (Fisher model UVGL-25) directly over the dish held on ice. After 1 h of irradiation, 50 µl of SDS sample buffer was added to each well and the reactions were denatured by heating to 75°C. Crosslinked proteins were separated from free DNA by electrophoresis on a 7.5% polyacrylamide SDS-PAGE (0.15 cm×11 cm × 50 cm).

Genomic footprinting

The results of our genomic footprinting experiment are presented in Figure 3A and quantitated in Figure 3B. In this experiment the cognate plasmid DNA version of each mutant construct (marked N) was reacted with DMS to serve as a reactivity/cleavage control while the chromosomal genomic DNAs of each strain was reacted with DMS in intact cells (marked G). At the bottom of Figure 3A is a listing of the PED and PEP sequences found in each TBP mutant as well as the DMS-reactive G residues for each mutant (marked with inverted open and filled triangles; see Fig. 3A legend). Protection of PED was observed for the wild-type sequences, as was seen previously (9) (Fig. 3A, top, lanes 1 and 2, compare protection of the two marked G-residues in the gel region bracketed and labeled PED, N and G). From the quantitation of this data it is clear that the PED element is essentially completely occupied [average protection/occupancy = 95 ± 4% (n = 4)] in the wild-type TBP promoter. Significant protection is also observed in the wild-type promoter throughout the PEP and TATA elements (see gel regions bracketed and labeled PEP and TATA; ~50 and 60% occupancy, respectively). However, this pattern of protection over PED, PEP and TATA is altered significantly in strains containing PED mutations. This is particularly true in the strains containing the PED mutants which exhibited large losses of promoter activity [Fig. 3A, compare lanes 3 and 4 (TVN PED), lanes 7 and 8 (MUT #1) and lanes 9 and 10 (MUT#2) with WT lanes 1 and 2]. In these three cases PED occupancy is <5% of wild-type protection levels (Fig. 3B) and there is a concomitant decrease in PEP and TATA protection in these yeast strains to levels [le]10% of WT occupancy. These results suggest that occupancy of the PEP and TATA elements requires an intact and functional PED element. These occupancy results exactly mirror the lacZ reporter expression data of Figure 2B.

Further support that PED plays the dominant positive role in TBP gene transcription comes from an analysis of the constructs carrying either a transversion of the PEP element (TVN PEP) or a mutation in PED region #3 (MUT #3). Both of these mutant constructs retained significant promoter activity (~25 and ~50% of WT, respectively; Fig. 2B) and analysis of the DMS genomic footprints of the PEP mutant [Fig. 3A; lanes 5 and 6 (TVN PEP)] and mutant region #3 [Fig. 3A; lanes 11 and 12 (MUT #3)], showed that PED occupancy is 50-60% in both constructs (Fig. 3B). Both of these constructs exhibit protection of the TATA element roughly consistent with their transcriptional properties (i.e., TVN PEP ~30% TATA occupancy and MUT #3 ~50% TATA occupancy). Overall, therefore, there is good correlation between promoter cis-element occupancy and expression levels.

DNA binding-competition assays

We performed EMSA assays using yeast WCE protein, wild-type PED sequence as the labeled probe, and various mutant forms of the PED element as competitors to test their relative affinities for PEDBF. The results of these assays are presented in Figure 3C. Wild-type PED sequences were able to efficiently compete for formation of the PEDBF + ³²P-PED complex (Fig. 3C, compare lane 2 with lanes 3, 4 and 5) while two deletion mutations in PED and a transversion mutant of the entire PED sequence were unable to compete efficiently for complex formation even when present in the binding reaction at a 100-fold molar excess relative to the probe (Fig. 3C, compare lanes 6, 7 and 8 with lane 2). Importantly, point mutations in either PED region #1 or region #2 were unable to compete efficiently (Fig. 3C, lanes 9 and 10) while a mutation in region #3 was able to compete, albeit less efficiently than the wild-type sequence (compare lanes 11, 12 and 13 with 2-5). Combinations of the various mutations in PED were predictably unable to compete efficiently, even at a 100-fold molar excess over labeled probe (lanes 14-17; Fig. 3C). Therefore taking the data of Figures 2 and 3 together we conclude that the PED element plays the dominant positive role in driving TBP gene transcription in vivo and that PEDBF is the factor mediating transactivation. This information prompted us to attempt to purify PEDBF.

Purification and characterization of PEDBF

The overall scheme which we developed for the purification of PEDBF is outlined in Figure 4A and briefly summarized in Materials and Methods. PEDBF activity was monitored by EMSA throughout.

Figure 4. Purification and immunological characterization of PEDBF. (A) Purification of PEDBF. Shown at the top of the figure is a flowchart of the chromatographic steps used to purify PEDBF. In the middle portion of the figure is an autoradiograph of a gel shift assay of 1 µl aliquots of each fraction eluted from the second pass over the PED DNA affinity column (see above). Lane 1, 32P-PED Probe alone (-); lane 2, assay of the pooled input fraction applied to the second pass DNA affinity column (I); lane 3, assay of the breakthrough fraction (B); lane 4, assay of the 100 mM NaCl wash step (W); lanes 5-29, assay of the column fractions obtained following NaCl gradient elution of the second DNA affinity column. The approximate magnitude of the NaCl gradient is shown by the inclined plane (100-1000 mM NaCl) above lanes 5-29. Free PED probe and the PED.PEDBF complexes are indicated by the labeling and arrows. At the bottom of the figure is a photograph of a silver stained analytical SDS-PAGE analysis of selected fractions assayed in the gel shift above. Aliquots of 200 µl of the input (I), lane 1; breakthrough (B), lane 2; and second pass affinity pooled peak fractions (P), lane 3 were precipitated with TCA and fractionated on a denaturing 6.5% SDS polyacrylamide gel. The mobility of protein standards (Sigma high molecular weight standard mixture) run in a parallel lane of this gel are indicated at the left side of the gel. The arrow to the right of the gel indicates the 120 kDa PEDBF polypeptide. (B) Immunoblotting shows that PEDBF is Abf1p. Increasing amounts of PED affinity purified PEDBF [(Affinity Pure Abf1p) lanes 2-4, ~10, 25 and 50 ng and WCE protein (WCE) lanes 5-7, ~32.5, 65 and 130 µg] were fractionated by SDS-PAGE (6% polyacrylamide, the dye front was purposely run off the gel) along with 50 ng of pure Abf1p (control), lane 1. Fractionated proteins were blotted and duplicate sets of these samples were probed with either anti-Abf1p IgG or non-immune IgG as indicated. The mobility of prestained molecular weight standards (GIBCO BENCHMARK Protein Ladders, prestained standards) is indicated at the left of each blot. (C) EMSA IgG-induced inhibition assays confirm that PEDBF is Abf1p. Standard EMSA assays were performed except 2 µg of IgG were pre-incubated with the WCE added to eight identical 32P-PED DNA binding assays. These assays contained a mixture of non-immune and anti-Abf1p IgG (indicated by the + in the insert). The reaction in lane 2 contained 2 µg non-immune IgG while the reaction fractionated in lane 9 contained 2 µg of anti-Abf1 IgG. The lanes between, lanes 3-8, contained the amounts of anti-Abf1p IgG shown on the ordinate of the plot. The reaction fractionated in lane 1 was a control reaction in which no IgG was added in the binding reaction. Following EMSA, the gel was exposed to X-ray film (insert) and the amount of Abf1p-DNA complex quantitated using a BioRad PhosphorImager and software and is plotted as a function of anti-Abf1p IgG present in the assay.

A    B    C

Shown in the middle portion of Figure 4A are the results of an EMSA following the second pass over the DNA affinity column. No PEDBF DNA binding activity was observed in either the column breakthrough (B) or the low salt wash fraction (W) [Fig. 4A, compare lanes 3 and 4 with lane 2 (input, I)]. In this experiment, equal volumes of all fractions were assayed, thus it is clear from the column activity profile that a significant concentration of the PED binding activity was affected by this purification step [compare the amount of PEDBF-PED complex (input, I) lane 2 with lanes 11-20]. When the individual fractions from the PED-Sepharose column were analyzed by SDS-PAGE, an M_r = 120 000 protein tracked with PEDBF activity (data not shown). We therefore deduced that the M_r = 120 000 polypeptide was PEDBF. A silver-stained analytical SDS-PAGE gel analysis of the input (I), breakthrough (B) and pooled peak fractions (P) from the second pass over the DNA affinity column is presented in the lower portion of Figure 4A. The pooled peak fraction contained a prominent polypeptide of M_r = ~120 000 that was much reduced in concentration in the breakthrough fraction (Fig. 4A, compare lanes 2 and 3). This polypeptide was also present in the input fraction, although at reduced levels relative to the pooled peak fraction.

The entire preparation of second pass DNA-affinity purified PEDBF was subjected to preparative SDS-PAGE, transferred to a PVDF membrane, stained with Ponceau S, the 120 kDa protein excised, proteolyzed and the resulting peptides were fractionated by HPLC (Harvard University Microchemistry Facility). Two of the peptides derived from this digest were sequenced by mass spectrometry and Blast searches of the GenBank database indicated that both were derived from the same previously cloned and sequenced yeast protein. This protein, Abf1p, is the protein product of ABF1 (ARS binding factor 1; GenBank accession no Z228111x1). The two peptides LDFVTDDLEYHLANTHPDDTNDK and EVENLHQNNDDDVDDVMVDVDVESQYNK comprise Abf1p amino acids 134-156 and 660-687, respectively.

Immunological analyses indicate that PEDBF is Abf1p

The fact that PEDBF was Abf1p was confirmed by immunological experiments. The first was to show that PED DNA-affinity chromatography purified protein specifically reacted with anti-Abf1p antibodies. The second experiment was an anti-Abf1p IgG-induced inhibition EMSA DNA binding assay. The results of these two experiments are presented in Figure 4B and C. We utilized an anti-Abf1p antibody and purified yeast Abf1p (positive control) provided by Dr Eisenberg (30) for these experiments. In the experiment presented in Figure 4B, this control Abf1p as well as our own crude yeast whole cell extract and PED-DNA affinity purified Abf1p/PEDBF preparations, were subjected to SDS-PAGE fractionation, blotted and reacted with control non-immune and anti-Abf1p rabbit IgGs. A band of roughly M_r = 120 kDa was observed when the blots are exposed to anti-Abf1p IgG (Fig. 4B, top, compare lane 1 with lanes 2, 3 and 4 and lanes 5, 6 and 7). The specificity of this immunoreactivity is shown by comparing this pattern with the lanes where non-immune IgG was used for detection (Fig. 4B, bottom). These data indicate that PED-DNA affinity-chromatography purified the same Abf1p polypeptide present in WCE. Similarly, the EMSA IgG inhibition data with these same antibodies indicates that PEDBF is really Abf1p since PED binding activity is specifically inhibited by the addition of anti-Abf1p IgG (Fig. 4C, compare lane 1 with lanes 2-9). Clearly both immunological assays show that PEDBF is Abf1p.

Biochemical assays show that Abf1p binds indistinguishably to PED and ABF1 sites in vitro

We were surprised by the discovery that PEDBF was Abf1p since our own previous computer analyses had failed to indicate that the PED element was similar to the Abf1p binding site. With the exception of two examples of variant cis-elements, both of which bind Abf1p very poorly in vitro (RPL2A and RPL45; 33,34), all previous descriptions of Abf1p binding sites have matched the consensus sequence shown at the top of Figure 5A (35). Detailed mutagenesis experiments have demonstrated that two regions of this site are particularly critical for Abf1p binding, ABF1 element residue C₃ and ABF1 residues A₁₁, C₁₂ and G₁₃ (underlined in Fig. 5A). Modification of these four critical residues by changing either their sequence or their spacing was found to result in dramatic reductions in Abf1p binding as well as decreased gene expression levels in vivo (35). Strikingly, five separate studies have been reported where the ABF1 binding site was mutagenized at the C₃ residue (31-33,36,37). In each and every case, mutagenesis of residue C₃ alone resulted in a decrease in binding of >90% and a corresponding decrease in reporter gene activity was noted. Clearly, the TBP gene PED element does not match the consensus Abf1p binding site at position 3 (A₃ versus C₃; one of the critical bases).

Figure 5. Abf1p binds equally well to a consensus ABF1 site and the non-consensus PED-variant ABF1 site. (A) Gel shift competition analyses. An alignment of the TBP gene PED element to the consensus ABF1 sequence is shown at the top of the figure. The PED element (residues -146 to -132) was aligned with the 13 nt long consensus ABF1 site; N = and nucleotide, R = G or A, and B = any nucleotide except C. Underlined sequences denote the two sets of invariant residues of the consensus ABF1 site (C3 and A11, C12, G13). Asterisks indicate PED residues which match the ABF1 consensus site. Using 32P-labeled PED as a probe and yeast WCE as a source for PEDBF, the relative affinities of PEDBF for PED and ABF1 sites was determined using a competition DNA binding assay. Equivalent increasing amounts of unlabeled PED or ABF1 DNA (0-100-fold molar excesses) were added to the binding reactions. Bound and free 32P-PED probe was separated via non-denaturing gel electrophoresis, and these two populations of DNA were quantitated using a phosphorimager. The results of these assays are depicted (graph and insert of gel). Use of PED competitor is depicted with the filled triangles while the ABF1 competition curve is indicated with the open circles. (B) UV crosslinking of PEDBF to PED and ABF1 sequences. Autoradiograph of results of gel shift and SDS-PAGE gel. WCE (1 µg) or 0.1 ng of affinity-purified PEDBF were used in each assay. 25- and/or 100-fold molar excesses of `cold' competitors were used as depicted at the top of lanes. Prior to crosslinking, 1 µl of each sample was loaded onto a gel shift gel (shown; labeled Gel Shift) while the remaining sample was crosslinked. Crosslinked reactions were heated with SDS sample buffer as described in Materials and Methods and were fractionated on a 7.5% polyacrylamide SDS-PAGE. Uncrosslinked (labeled Gel Shift) and crosslinked (labeled SDS-PAGE) protein-DNA complexes are indicated by the arrows. The apparent lack of competition of crosslinking seen in lane 19 is an anomaly; numerous additional though not exact replicates of this experiment showed the expected efficient competition of crosslinking (data not shown). (C) Off-rate measurements of Abf1p bound to ABF1 and PED sites. Autoradiographs and graphs of off-rate measurements. Abf1p-DNA complexes were formed in 10×-scaled-up binding reactions by incubation at 37°C for 20 min. At time zero a 100-fold excess of the competitor DNA listed (+PED or +ABF) was added to the reactions and at the indicated times 20 µl aliquots of the 10× reactions were removed and immediately applied to a standard EMSA gel that already had a voltage potential of 100 V applied.

A    B    C

In order to directly assess the inter-relationships of PED and ABF1 sites, we performed a series of experiments to examine the relative affinity of Abf1p for PED and a consensus ABF1 site. We utilized three types of experiments for this purpose, a DNA binding competition assay, a UV crosslinking DNA competition experiment and measurements of the off-rates of dissociation of Abf1p from both ABF1 and the TBP gene-PED site.

The results of the gel shift competition DNA-binding experiment which utilized ³²P-labeled PED as a probe and WCE protein as the source of Abf1p are presented in Figure 5A. The molar excesses of `unlabeled' PED or ABF1 sites were varied from 0.5- to 100-fold (Fig. 5A insert). This gel was imaged and quantitated and a graphical representation of the competition data is shown. It is clear that there is no significant difference in competition profiles between PED and ABF1 elements. Equivalent results were obtained when these analyses were repeated with PED-affinity purified Abf1p (data not shown). These competition results were quite striking since sites which more closely match the ABF1 site than our PED site (i.e. have fewer mismatches) show reduced affinity of binding when tested by similar assays (36,37). Alteration of the ABF1 site at residue C₃ resulted in order of magnitude differences in in vitro binding compared to wild-type sequences and large decreases in transcription in vivo (31-33,36,37).

Results of our UV-crosslinking experiment using both ³²P-labeled PED and ³²P-labeled ABF1 sequences as probes are presented in Figure 5B. Analysis of the results of this experiment [Fig. 5B; compare top (gel shift) and bottom (crosslinked protein)] indicates that these two probes crosslink to a protein of identical molecular weight (M_r = ~120 kDa) in both preparations. This indicates that PEDBF is unlikely to be a differentially modified minor isoform of Abf1p. Moreover, these protein bands are competed equally well with either `cold' PED or `cold' ABF1 as predicted from the data of Figure 5A.

In Figure 5C are results of off-rate measurements of Abf1p from both a consensus ABF1 site and the PED site measured at 37°C. The dissociation rates of Abf1p from both sequences were approximately identical, t_1/2 = ~15 min. At 25°C the t_1/2s of these two sites are approximately doubled (data not shown). We reached several conclusions from these experiments. First, Abf1p binds equally well to the PED-variant ABF1 sequence and the consensus ABF1 site. Second, the same form of Abf1p is able to bind to both DNA sequence elements. Third, since previous work suggested that the PED-variant ABF1 site should not bind Abf1p (ie. [ge]10-fold decrease in binding), we conclude that flanking sequences (i.e. region #3) which lie outside of the consensus ABF1 binding site contribute substantially to the affinity of Abf1p binding to the PED binding site.

Table 1. Saccharomyces cerevisiae genes involved in transcription which contain Abf1p binding sites within 500 bp upstream of their ATGs
*Shared subunits.

DISCUSSION

In this study we have conducted a detailed analysis of a positive acting cis-element, termed PED, which we had previously crudely characterized. Through a series of genetic and biochemical experiments we have determined that appropriate PED cis/trans function is essential for high level TBP gene transcription. Indeed, PED integrity is crucial for driving sufficient TBP gene transcription to support cell growth. Using several types of DNA binding analyses coupled with various protein purification and immunological techniques, we have identified, purified, characterized and sequenced the trans-acting factor which binds to the PED element and determined that this protein factor is Abf1p.

Abf1p as a global regulator of macromolecular biosynthetic events

Our hope when we initiated our dissection of the cis- and trans-acting factors which control TBP gene expression was to identify a transcription factor(s) that was responsible for the global control of yeast macromolecular biosynthesis. We reasoned that given the central role of TBP in transcription that the regulatory network(s) which converged on the TBP-encoding gene might also participate directly in controlling expression of other proteins involved in the processes of transcription, replication and translation. Abf1p appears to fit this criterion since ABF1 consensus sites have been found not only in replication origins, hence the name ARS binding factor, but ABF1 sites have also been described upstream of genes encoding subunits of the translational machinery, subunits of all three nuclear DNA-dependent RNA polymerases and many other genes.

We scanned the yeast genome to identify all genes which contain a consensus Abf1p binding site within the 1000 nucleotides of DNA upstream of the initiator ATG codon of the relevant ORF. In Table 1 we present a list of a subset of these genes, those which encode proteins involved in transcription that contain consensus ABF1 sites. These genes include those encoding DNA-dependent RNA polymerase subunits, TAFs, and general factors involved in transcription by all three nuclear RNA polymerases. Several of these genes have previously been reported to contain Abf1p binding sites (33,35), corroborating our search parameters. Three genes involved in transcription were found to contain the PED-variant Abf1p site. These genes are RPB11, SRB4 and SRB7. The fact that ABF1 consensus and PED-variant ABF1 sites frequently occur in the regulatory regions of these genes suggests that Abf1p could very well play a central and global role in regulating transcription by acting as a master switch to modulate the levels of these many mRNAs. Based upon similar reasoning, since genes encoding replication and translation proteins also contain ABF1 sites, other macromolecular biosynthetic reactions such as DNA and protein synthesis could similarly be regulated. That Abf1p is also apparently involved in modulating rDNA transcription by RNA polymerase I (38) provides further support for this hypothesis.

Our previous computer-based sequence analyses were unable to uncover any large regions of sequence similarity between the 5[prime]-flanking region of the gene encoding Saccharomyces cerevisiae TBP and the 5[prime]-flanking regions of genes encoding TBP in other organisms. However, armed with the knowledge that Abf1p binds to the PED element in the gene encoding TBP in S.cerevisiae, we directly searched for Abf1p binding sites in the 5[prime]-flanking regions of genes encoding TBP in other organisms. Interestingly we found ABF1 sites in the promoters of the TBP-encoding genes of Schizosaccharomyces pombe (10) and Drosophila melanogaster (39). It is not yet clear if these organisms contain an activity which binds specifically to an ABF1 site. However, this finding does raise the intriguing possibility that not only is Abf1p responsible for modulating the expression of the multitude of genes in S.cerevisiae which encode components of the general transcription machinery, but that this regulatory network could be conserved among other disparate eukaryotic organisms. These considerations suggest that the Abf1p regulatory system described herein could be both ancient and important to cellular function in many different eukaryotic organisms. Additional experimentation will be required to address this idea.

ACKNOWLEDGEMENTS

We would like to thank Dr Shlomo Eisenberg for providing pure Abf1p and antibodies, our colleagues in the laboratory for their constructive criticisms, support and advice throughout the course of this work, and Drs S. Johnston, J. Segall and M. Groudine for their critical comments on our manuscript. This work was supported by a grant from the NIH (GM52461).

REFERENCES

1. Comai,L., Tanese,N. and Tjian,R. (1992) Cell, 68, 965-976. MEDLINE Abstract

2. Cormack,B.P. and Struhl,K. (1992) Cell, 69, 685-696. MEDLINE Abstract

3. Schultz,M.C., Reeder,R.H. and Hahn,S. (1992) Cell, 69, 697-702. MEDLINE Abstract

4. Yamashita,S., Hisatake,K., Doi,K., Roeder,R.G., Horikoshi,M. and Nakatani,Y. (1993) Science, 261, 463-466. MEDLINE Abstract

5. Hernandez,N. (1993) Genes Dev., 7, 1291-1308. MEDLINE Abstract

6. Sadovsky,Y., Webb,P., Lopez,G., Baxter,J.D., Fitzpatrick,P.M., Gizang-Ginsberg,E., Cavailles,V., Parker,M.G. and Kushner,P.J. (1995) Mol. Cell. Biol., 15, 1554-1563. MEDLINE Abstract

7. Colgan,J. and Manley,J.L. (1992) Genes Dev., 6, 304-315. MEDLINE Abstract

8. Trivedi,A., Vilalta,A., Gopalan,S. and Johnson,D. (1996) Mol. Cell. Biol., 16, 6909-6916. MEDLINE Abstract

9. Schroeder,S.C., Wang,C.K. and Weil,P.A. (1994) J. Biol. Chem., 269, 28335-28346. MEDLINE Abstract

10. Hoffmann,A., Horikoshi,M., Wang,C.K., Schroeder,S., Weil,P.A. and Roeder,R.G. (1990) Genes Dev., 4, 1141-1148. MEDLINE Abstract

11. Wong,J.M., Liu,F. and Bateman,E. (1992) Nucleic Acids Res., 20, 4817-4824. MEDLINE Abstract

12. Liu,F. and Bateman,E. (1993) Nucleic Acids Res., 21, 4321-4329. MEDLINE Abstract

13. Huang,W. and Bateman,E. (1995) J. Biol. Chem., 270, 28839-28847. MEDLINE Abstract

14. Chalut,C., Gallois,Y., Poterszman,A., Moncollin,V. and Egly,J.M. (1995) Gene, 161, 277-282. MEDLINE Abstract

15. Sumita,K., Makino,Y., Katoh,K., Kishimoto,T., Muramatsu,M., Mikoshiba,K. and Tamura,T. (1993) Nucleic Acids Res., 21, 2769. MEDLINE Abstract

16. Lira-DeVito,L., Burke,T. and Kadonaga,J. (1995) Gene, 153, 203-207. MEDLINE Abstract

17. Foulds,C.E. and Hawley,D.K. (1997) Nucleic Acids Res., 25, 2485-2494. MEDLINE Abstract

18. Liu,F. and Bateman,E. (1994) J. Biol. Chem., 269, 18541-18548. MEDLINE Abstract

19. Poon,D., Knittle,R.A., Sabelko,K.A., Yamamoto,T., Horikoshi,M., Roeder,R.G. and Weil,P.A. (1993) J. Biol. Chem., 268, 5005-5013. MEDLINE Abstract

20. Sambrook,J., Fritsch,E.F. and Maniatis,T. (1989) Molecular Cloning: A Laboratory Manual, 2nd Edn. Cold Spring Harbor Laboratory Press, Cold Spring Harbor.

21. Revzin,A. (1993) Footprinting of Nucleic Acid-Protein Complexes, 1st Edn. Academic Press, Inc., San Diego, CA.

22. McCarthy,J.G. and Rich,A. (1991) Nucleic Acids Res., 19, 3421-3429. MEDLINE Abstract

23. Jones,E.W. (1991) Methods Enzymol., 194, 428-453. MEDLINE Abstract

24. Poon,D. and Weil,P.A. (1993) J. Biol. Chem., 268, 15325-15328. MEDLINE Abstract

25. Goss,T.A. and Bard,M. (1990) J. Chrom., 508, 279-287.

26. Francesconi,S.C. and Eisenberg,S. (1989) Mol. Cell. Biol., 9, 2906-2913. MEDLINE Abstract

27. Poon,D., Schroeder,S., Wang,C.K., Yamamoto,T., Horikoshi,M., Roeder,R.G. and Weil,P.A. (1991) Mol. Cell. Biol., 11, 4809-4821. MEDLINE Abstract

28. Sikorski,R. and Hieter,P. (1989) Genetics, 122, 19-27. MEDLINE Abstract

29. Boeke,J., Trueheart,J., Natsoulis,G. and Fink,G. (1987) Methods Enzymol., 154, 164-175. MEDLINE Abstract

30. Upton,T., Wiltshire,S., Francesconi,S. and Eisenberg,S. (1995) J. Biol. Chem., 270, 16153-16159. MEDLINE Abstract

31. Buchman,A.R. and Kornberg,R.D. (1990) Mol. Cell. Biol., 10, 887-897. MEDLINE Abstract

32. Gailus-Durner,V., Xie,J., Chintamaneni,C. and Vershon,A.K. (1996)Mol. Cell. Biol., 16, 2777-2786. MEDLINE Abstract

33. Della Seta,F.D., Ciafre,S., Marck,C., Santoro,B., Presutti,C., Sentenac,A. and Bozzoni,I. (1990) Mol. Cell. Biol., 10, 2437-2441. MEDLINE Abstract

34. Mager,W.H. and Planta,R.J. (1990) Biochim Biophys Acta, 1050, 351-355. MEDLINE Abstract

35. Dorsman,J.C., van Heeswijk,W.C. and Grivell,L.A. (1990)Nucleic Acids Res., 18, 2769-2776. MEDLINE Abstract

36. Buchman,A.R., Kimmerly,W.J., Rine,J. and Kornberg,R.D. (1988)Mol. Cell. Biol., 8, 210-225. MEDLINE Abstract

37. Della Seta,F., Treich,I., Buhler,J.M. and Sentenac,A. (1990)J. Biol. Chem., 265, 15168-15175. MEDLINE Abstract

38. Kang,J.J., Yokoi,T.J. and Holland,M.J. (1995) J. Biol. Chem., 270, 28723-28732. MEDLINE Abstract

39. Hoey,T., Dynlacht,B.D., Peterson,M.G., Pugh,B.F. and Tjian,R. (1990) Cell, 61, 1179-1186. MEDLINE Abstract

---

*To whom correspondence should be addressed. Tel: +1 615 322 7007; Fax +1 615 322 7236; Email: tony.weil@mcmail.vanderbilt.edu

---

This page is run by Oxford University Press, Great Clarendon Street, Oxford OX2 6DP, as part of the OUP Journals
Comments and feedback: www-admin{at}oup.co.uk
Last modification: 29 Aug 1998
Copyright©Oxford University Press, 1998.
CiteULike    Connotea    Del.icio.us    What's this?

This article has been cited by other articles:

				A. Yarragudi, L. W. Parfrey, and R. H. Morse Genome-wide analysis of transcriptional dependence and probable target sites for Abf1 and Rap1 in Saccharomyces cerevisiae Nucleic Acids Res., January 12, 2007; 35(1): 193 - 202. [Abstract] [Full Text] [PDF]

				S. Thuault, Y.-G. Gangloff, J. Kirchner, S. Sanders, S. Werten, C. Romier, P. A. Weil, and I. Davidson Functional Analysis of the TFIID-specific Yeast TAF4 (yTAFII48) Reveals an Unexpected Organization of Its Histone-fold Domain J. Biol. Chem., November 15, 2002; 277(47): 45510 - 45517. [Abstract] [Full Text] [PDF]

				S. L. Sanders, E. R. Klebanow, and P. A. Weil TAF25p, a Non-histone-like Subunit of TFIID and SAGA Complexes, Is Essential for Total mRNA Gene Transcription in Vivo J. Biol. Chem., July 2, 1999; 274(27): 18847 - 18850. [Abstract] [Full Text] [PDF]

				U. Banik, J. M. Beechem, E. Klebanow, S. Schroeder, and P. A. Weil Fluorescence-based Analyses of the Effects of Full-length Recombinant TAF130p on the Interaction of TATA Box-binding Protein with TATA Box DNA J. Biol. Chem., December 21, 2001; 276(52): 49100 - 49109. [Abstract] [Full Text] [PDF]

This Article Abstract Print PDF (219K) Alert me when this article is cited Alert me if a correction is posted Services Email this article to a friend Similar articles in this journal Similar articles in ISI Web of Science Similar articles in PubMed Alert me to new issues of the journal Add to My Personal Archive Download to citation manager Search for citing articles in: ISI Web of Science (5) Request Permissions Commercial Re-use Guidelines for Open Access NAR Content Google Scholar Articles by Schroeder, S. C. Articles by Weil, P. A. Search for Related Content PubMed PubMed Citation Articles by Schroeder, S. C. Articles by Weil, P. A. Social Bookmarking          What's this?