Skip Navigation

This Article
Right arrow Abstract Freely available
Right arrow Print PDF (35K) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (39)
Right arrowRequest Permissions
Right arrow Commercial Re-use Guidelines
for Open Access NAR Content
Google Scholar
Right arrow Articles by Foulds, G. J.
Right arrow Articles by Etzkorn, F. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Foulds, G. J.
Right arrow Articles by Etzkorn, F. A.
Social Bookmarking
Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Nucleic Acids Research Pages 4304-4305  

A capillary electrophoresis mobility shift assay for protein-DNA binding affinities free in solution
Acknowledgements
References

A capillary electrophoresis mobility shift assay for protein-DNA binding affinities free in solution

A capillary electrophoresis mobility shift assay for protein-DNA binding affinities free in solution

Glenn J. Foulds and Felicia A. Etzkorn*

Department of Chemistry, University of Virginia, McCormick Road, Charlottesville, VA 22901, USA

Received June 4, 1998; Revised and Accepted July 28, 1998

ABSTRACT

Quantitative determination of dissociation constants for DNA-protein complexes will help clarify the molecular mechanisms of transcription, replication and DNA repair. A practical capillary electrophoresis mobility shift assay (CEMSA) for protein-DNA affinities free in solution is presented. The method is fast and simple, precise and general. The speed (<2 min separations) and simplicity derive from the use of an uncoated capillary with no gel matrix. The dissociation constant for GCNK58, a DNA-binding-region construct of the yeast transcription factor GCN4, binding to the AP1 DNA site was measured (Kd = 35 ± 4 nM) to demonstrate the utility of the method.

The quantitative assessment of DNA-protein affinities is essential to understanding transcription, the beginning of biological processes including normal cellular function, development and many diseases (1). Existing art for the determination of DNA-binding affinities is the electrophoresis mobility shift assay (EMSA) (2). A capillary electrophoresis mobility shift assay (CEMSA) (3) for the precise determination of protein-DNA dissociation constants free in solution is described in this paper. The key features of the method are the rapid separation and quantitation of complex and free DNA, in uncoated capillaries with no gel matrixes, using high sensitivity laser-induced-fluorescence (LIF) detection of fluorescein-labeled DNA. The caging effect of the gel matrix on dissociation constant measurements (4) is absent in this method. Similar Kd values are observed as in EMSA (5) and microcalorimetry (6).

Capillary electrophoresis (CE) separates analytes on the basis of their mass-to-charge ratio. Our method takes particular advantage of the electroosmotic flow generated by the negatively charged silanol groups on the capillary walls at [ge]pH 6 (7). This CE assay uses the reverse polarity of EMSA, and the order of elution is reversed: free protein, protein/DNA complex, then DNA.

CEMSA has the advantages of automation, high resolution, fast assay times, on-line detection and the use of small amounts of precious samples. CE has been applied to the study of DNA-protein complexes using fluorescently-labeled DNA with LIF detection, but not free in solution (8-10). In our method, 2 min separations in short, uncoated capillaries, without sieving matrixes, are coupled with precise quantitation of Kd values. We used the yeast transcriptional activator GCNK58 construct (11) as the prototype for measuring DNA-binding affinity by the new CEMSA method. The method is general for different classes of DNA-binding proteins, including zinc-finger and basic-helix-loop-helix-leucine-zipper (b-HLH-ZIP; G.J.Foulds and F.A.Etzkorn, unpublished results).

Excellent separation of the free AP1, complex and GCNK58 was obtained using CE in uncoated, gel-free capillaries with LIF detection of fluorescein-labeled DNA. In a benchmark assay, we measured the dissociation constant of the DNA-binding protein GCNK58 and a 20 bp oligonucleotide including the recognition site AP1 (11).

For CEMSA, the zwitterionic buffer 3-(N-morpholino)-propane sulfonic acid (MOPS) with the soft counterion triethylamine (Et3N) was found to yield better peak shape and resolution with low current at high voltage (25 kV) than the phosphate buffer used in the EMSA of GCNK58 (5). High voltage gave fast separation and low current gave less Joule heating, allowing the complex to stay intact during electrophoresis. The difference in ionic strength between the sample buffer (50 mM MOPS·Et3N, 50 mM KCl) and the run buffer (10 mM MOPS·Et3N) helped maintain the original concentration of complex during the separation (2). The minimum-length capillary column that fits the Beckman CE cartridge (27 or 20 cm from inlet to detector) was used. The ratio of complex peak area to total DNA (R, see below) was found to be independent of the applied voltage at 25 kV and below, so 25 kV was used as the standard applied voltage in our CEMSA. Adsorbed ions were removed and the charged capillary wall was regenerated by washing with 0.1 M NaOH and run buffer between runs.


Figure 1. Electropherograms of AP1 at 1 nM and GCNK58 at the indicated concentrations in 50 mM MOPS·Et3N pH 7.5, 50 mM KCl, 133 µg/ml poly(dA-dT)·poly(dA-dT), 100 µg/ml bovine serum albumin, 5% glycerol. DNA was synthesized (Biomolecular Research Facility, University of Virginia) with 5[prime]-carboxyfluorescein phosphoramidite (Glen Research) attached. d(AAACTGGATGAGTCATAGGA) (3 nM) and Xd(TTCCTATGACTCATCCAGTT) (2 nM) where X is fluorescein (AP1), were freshly annealed at 90°C for 5 min and cooled slowly to room temperature. Serial dilutions of GCNK58 were mixed with an equal volume (10 µl) of annealed AP1 and preincubated at 4°C for 2-3 h. CE was performed on a Beckman P/ACE 2100 with Laser Module 488, LIF detector and System Gold software (v. 8.1) in 75 µm ID uncoated capillaries (Polymicro Technologies), 27 cm long, 20 cm effective length to the detector, with a cooled sample tray. Before runs, the capillary was rinsed for 2 min with 0.1 M NaOH and 2 min with run buffer: 10 mM MOPS·Et3N pH 7.5. Samples were injected for 2 s at low pressure and electrophoresed at 25 kV in run buffer at 22°C, at normal CE polarity (cathode at the detector end).

Figure 1 shows the set of electropherograms obtained at varying concentrations of GCNK58 and 1 nM AP1. The saturation of AP1 (R), defined as:

R = [GCNK582·AP1]/{[GCNK582·AP1] + [AP1]},

was plotted against increasing concentrations of GCNK58 (Fig. 2). For determination of Kd, the data were fit to equation 1:

R = 0.5[GCNK58]/{Kd + 0.5[GCNK58]} 1

The equilibrium dissociation constant for homodimer-DNA complex formation, Kd, was found to be 35 ± 4 nM. This value is the same as determined by isothermal calorimetry in the sample buffer: 50 mM Tris-HCl, pH 7.5, 10 mM NaCl, 10 mM MgCl2 (35.1 ± 8.9 nM) (6), and reasonably close to a Kd value previously determined by EMSA in 50 mM KxPO4 pH 7.5, 50 mM KCl(2 × 10-8 M) (5), both without non-specific DNA included in the sample buffer. Inclusion of the non-specific DNA, poly(dA·dT), gives a Kd value representative of specific DNA binding only (12).

In the absence of the non-specific DNA, as in the EMSA (5), a lower Kd value of 1.6 ± 0.2 nM was obtained (data not shown). In this case, cooperativity of dimerization and DNA-binding was observed. We used equation 2:

R = (570 nM)-1[GCNK58]2/{Kd + (570 nM)-1[GCNK58]2} 2

including the dimerization constant of 0.57 ± 0.19 µM (13) to fit the data. This result is unexpected in light of observations that sequestration (14) and caging (4) effects stabilize some protein/DNA complexes during gel electrophoresis (15). The fast separations of our assay may prevent dissociation of the complex even in the absence of gel matrix.

We have developed a fast, precise and practical CEMSA for DNA-protein affinities. Each concentration was analyzed in 3 min with a 4 min wash cycle. A series of six concentrations was performed in duplicate in ~85 min on a single column CE instrument. The assay uses open, uncoated capillaries, no radioactivity and an automatic sample tray, permitting hands-off assays to be performed routinely. The measured affinity of the GCNK58/AP1 complex was 35 ± 4 nM.


Figure 2. Saturation of AP1 (R) versus concentration of GCNK58. Kd was calculated to be 35 ± 4 nM by non-linear least squares fit of the data to equation 1 using KaleidaGraph v. 3.0.5.

ACKNOWLEDGEMENTS

We thank Professor Tom Ellenberger of Harvard Medical School for supplying us with generous quantities of GCNK58 protein. We thank Mike Black of Beckman Instruments for his assistance in preliminary development of the assay. This work was supported in part by a New Zealand Science and Technology Postdoctoral Fellowship to G.J.F., Grant no. UOV701, and by NIH Grant no. 1 R29 GM52516-01 to F.A.E.

REFERENCES

1. Maddox,J. (1994) Nature, 368, 95.

2. Garner,M.M. and Revzin,A. (1981) Nucleic Acids Res., 9, 3047-3060. MEDLINE Abstract

3. Heegaard,N.H.H. and Robey,F.A. (1993) J. Liq. Chromatogr., 16, 1923-1939.

4. Fried,M.G. and Crothers,D.M. (1981) Nucleic Acids Res., 9, 6505-6525. MEDLINE Abstract

5. Weiss,M.A., Ellenberger,T., Wobbe,C.R., Lee,J.P., Harrison,S.C. and Struhl,K. (1990) Nature, 347, 575-578. MEDLINE Abstract

6. Berger,C., Jelesarov,I. and Bosshard,H.R. (1996) Biochemistry, 35, 14984-14991. MEDLINE Abstract

7. Grossman,P.D. and Colburn,J.C. (1992) Capillary Electrophoresis: Theory and Practice. Academic Press, San Diego.

8. Xian,J., Harrington,M.G. and Davidson,E.H. (1996) Proc. Natl Acad. Sci. USA, 93, 86-90. MEDLINE Abstract

9. Stebbins,M.A., Hoyt,A.M., Sepaniak,M.J. and Hurlburt,B.K. (1996) J. Chromatogr. B, 683, 77-84.

10. Janini,G.M., Fisher,R.J., Henderson,L.E. and Issaq,H.J. (1995)J. Liq. Chromatogr., 18, 3617-3628.

11. Ellenberger,T.E., Brandl,C.J., Struhl,K. and Harrison,S.C. (1992) Cell, 71, 1223-1237. MEDLINE Abstract

12. Ausubel,F.M., Brent,R., Kingston,R.E., Moore,D.D., Seidman,J.G., Smith,J.A. and Struhl,K. (eds) (1992) Short Protocols in Molecular Biology. 2nd Ed. Greene Publishing Assoc. and John Wiley & Sons, NY, pp. 12-5 to 12-7.

13. Wendt,H., Baici,A. and Bosshard,H.R. (1994) J. Am. Chem. Soc., 116, 6973-6974.

14. Fried,M.G. and Liu,G. (1994) Nucleic Acids Res., 22, 5054-5059. MEDLINE Abstract

15. Lane,D., Prentki,P. and Chandler,M. (1992) Microbiol. Rev., 56, 509-528. MEDLINE Abstract

*To whom correspondence should be addressed. Tel: +1 804 924 3135; Fax: +1 804 924 3567; Email: fae8m@virginia.edu

This page is run by Oxford University Press, Great Clarendon Street, Oxford OX2 6DP, as part of the OUP Journals
Comments and feedback: www-admin{at}oup.co.uk
Last modification: 29 Aug 1998
Copyright©Oxford University Press, 1998.
Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
 J. Biol. Chem.Home page
A. A. Ouameur and H.-A. Tajmir-Riahi
Structural Analysis of DNA Interactions with Biogenic Polyamines and Cobalt(III)hexamine Studied by Fourier Transform Infrared and Capillary Electrophoresis
J. Biol. Chem., October 1, 2004; 279(40): 42041 - 42054.
[Abstract] [Full Text] [PDF]

Home page
 Nucleic Acids ResHome page
M. F. Fraga, E. Ballestar, G. Montoya, P. Taysavang, P. A. Wade, and M. Esteller
The affinity of different MBD proteins for a specific methylated locus depends on their intrinsic binding properties
Nucleic Acids Res., March 15, 2003; 31(6): 1765 - 1774.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Print PDF (35K) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (39)
Right arrowRequest Permissions
Right arrow Commercial Re-use Guidelines
for Open Access NAR Content
Google Scholar
Right arrow Articles by Foulds, G. J.
Right arrow Articles by Etzkorn, F. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Foulds, G. J.
Right arrow Articles by Etzkorn, F. A.
Social Bookmarking
Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?