| Nucleic Acids Research | Pages |
Different cleavage specificities of RNases III from Rhodobacter capsulatus and Escherichia coli
Introduction
Materials And Methods
Overexpression of R.capsulatus (His)6-RNase III in E.coli
Purification of R.capsulatus (His)6-RNase III
Purification of E.coli RNase III
Construction of DNA templates for in vitro transcription of RNAs
In vitro transcription of RNAs
Enzymatic assays
Mapping of the RNase III cleavage site by primer extension
Immunological methods
Gel electrophoretic mobility shift assay
Results
Purification of R.capsulatus RNase III
Biochemical properties of (His)6-RNase III
Substrate specificity
Binding of RNase III to Rc mini RNA
Position of the cleavage site for RNase III in the Rc mini RNA
Immunological behaviour of RNase III
Discussion
Acknowledgements
References
Different cleavage specificities of RNases III from Rhodobacter capsulatus and Escherichia coli
ABSTRACT
INTRODUCTION
Ribonucleases (RNases) are key components of the cell, converting mostly inactive RNA precursors into biologically active mature RNA molecules. One of these ribonucleases is endoribonuclease III (RNase III, EC 1.3.24). RNase III cleaves rRNA precursors in bacteria and yeast during maturation of rRNA (1,2). The Escherichia coli enzyme participates in precursor rRNA trimming, but is also involved in other pathways of RNA turnover (3,4). Acting on their respective mRNAs, RNase III directly influences the level of a broad variety of corresponding cellular proteins. In E.coli RNase III represents only 0.01% of total cell protein (5) and although the enzyme is not essential for viability (6), its presence and primary sequence are highly conserved in nearly all known bacterial genomes, even in the minimal genome of Mycoplasma genitalium (7). In the [alpha] purple bacterium Rhodobacter capsulatus the 23S rRNA is fragmented in vivo into 16S and 14S rRNA molecules. As shown previously, this fragmentation is RNase III-dependent (8). In contrast to E.coli, Rhodobacter 23S rRNA has an extra stem-loop inserted in helix 46 which serves as the RNase III cleavage site. The two resulting rRNA fragments are joined non-covalently in vivo to generate a functional 23S rRNA. Fragmentation of rRNA occurs in some other bacteria, for instance in Salmonella spp. (9,10), some cyanobacteria (11), Agrobacterium tumefaciens (12) and Rhodobacter sphaeroides (13), a close relative of R.capsulatus. The biological function of rRNA fragmentation still remains unclear (14), although there is some evidence that fragmented rRNA may provide a selective advantage for the bacterium under certain growth conditions (15,16). The amino acid sequence of R.capsulatus RNase III closely resembles other bacterial RNase III proteins (17). The processing specificity of RNase III is still poorly understood. This relates to both participants of this particular RNA-protein recognition system. RNase III substrates consist of structured nucleotide stretches with various patterns of intramolecular base pairing but lacking a consensus on the level of the primary sequence. The resulting double helical structure of ~20 bp (approximately two helical turns) contains one or two scissile internucleotide bonds. The deep and narrow major groove of A-form double-stranded (ds)RNA, inaccessible for potential protein contacts, could explain the lack of a consensus sequence. Cleavage is precise, but is not readily predictable from structure or sequence. Recently, the concept of anti-determinants, well known from tRNA recognition (18), has been applied to RNase III substrates. An RNase III cleavage site would thus be defined by the absence of `disfavoured' sequence motifs (19). On the side of the protein the contribution of the C-terminal dsRNA binding domain (dsRBD) module in creating substrate specificity appears critical. The dsRBD is a ubiquitous protein module present in a widely diverse class of regulatory proteins which bind folded RNAs (20). The module can be present in a protein in multiple copies (21,22). Biological activity in many cases relies only on specific binding without subsequent (nucleolytic) catalysis. In this work we analyse the structural basis for the interaction between R.capsulatus RNase III and the fragmentation signal in 23S rRNA.
MATERIALS AND METHODS
Overexpression of R.capsulatus (His)6-RNase III in E.coli
The rnc gene for RNase III of R.capsulatus was PCR amplified. A pGEM-3Zf(-) plasmid (Promega) harbouring a 1.7 kb PstI fragment containing the entire R.capsulatus rnc gene (23) was used as template. PCR primers were as follows: rncPstIup, 5[prime]-GAAAGTTGCTGCAGACCTCTCTGC-3[prime]; rncHindIIIdown, 5[prime]-CGAATCAAGCTTGCGTTTCTTCGG-3[prime] (PstI and HindIII sites, respectively, are underlined). The resulting product (~700 bp) was purified (Qiaex DNA gel extraction kit; Qiagen) and cloned into the PstI and HindIII sites of the polylinker of the hexahistidine tag vector pQE-30 (Qiagen). For further characterization the resulting plasmid (pQE-30[Rc rnc]) was transformed into E.coli JM109 (Stratagene). The correct sequence was confirmed by DNA sequencing. In addition to the N-terminal hexahistidine tag, the cloned RNase III of R.capsulatus contains 15 vector-encoded N-terminal amino acids not present in the wild-type RNase III. For protein expression the vector was propagated in E.coli M15[pREP4] cells (Qiagen) at 37°C using standard I medium containing ampicillin (200 µg/ml) and kanamycin (25 µg/ml). Overexpression of recombinant RNase III was induced by adding IPTG at a final concentration of 1.5 mM when cells reached an OD600 of 0.8. After continued incubation at 37°C for 2 h, the cells were harvested by centrifugation at 5000 g and stored at -70°C.
Purification of R.capsulatus (His)6-RNase III
All of the following steps were carried out on ice following the protocol for native purification of soluble proteins (Qiagen). An aliquot of 1.4 g induced E.coli cells was resuspended in sonication buffer (50 mM NaCl, 50 mM Tris-HCl, pH 7.5, 0.1 mM PMSF). Lysozyme was added at a final concentration of 1 mg/ml. The suspension was incubated for 30 min on ice and subsequently sonicated five times using a Sonopuls GM 70 sonicator (Bandelin). A sample of 7 ml Ni-NTA-agarose was prepared and equilibrated essentially following the manufacturer's protocol (Qiagen). The His-tagged protein was bound to the agarose in a batch procedure for 2 h with vigorous shaking on ice. The material was packed into a column (1.6 cm diameter) and washed with sonication buffer at a flow rate of 0.5 ml/min until the UV baseline was reached. To remove contaminating proteins the column was then washed extensively with sonication buffer containing 20 mM imidazole. The recombinant protein was eluted with a gradient of 0-500 mM imidazole in sonication buffer (90 min, 0.5 ml/min) using a GradiFrac® chromatography system (Pharmacia). Fractions of 1 ml were collected and kept at 4°C or at -70°C for long-term storage. Prior to use during enzymatic assays the RNase III fractions were dialysed in a cold room against dialysis buffer (50 mM Tris-HCl, pH 7.5, 50 mM NaCl, 0.01% sodium azide, 1 mM DTT). A mock purification under the same conditions was performed with E.coli M15 cells expressing the pQE30 vector alone.
Purification of E.coli RNase III
Escherichia coli RNase III was purified from the overexpressing E.coli strain HMS174(DE3)/pET-11a(mc) as previously described (24).
Construction of DNA templates for in vitro transcription of RNAs
The DNA template for in vitro transcription of the Rc mini RNA was constructed by PCR using genomic DNA of R.capsulatus as template and the following primers: Rcmini23S sense, 5[prime]-GGGGGGAATTCTAATACGACTCACTATAGGTTCTGTGATATAGCACCGCCCGACTTTAGC-3[prime] (60 nt, EcoRI site underlined); Rcmini23S antisense, 5[prime]-GGGGGAAGCTTGTTGACTCATGTCAACATTCTC-3[prime] (30 nt, HindIII site underlined). Primers for amplification of the E.coli mini substrate DNA using E.coli chromosomal DNA as template were: Ecmini23S sense, 5[prime]-GGGGGGAATTCTAATACGACTCACTATAGGTTCTGTAAGCCTGCGAAGGTG TGCTGT-3[prime] (57 nt, EcoRI site underlined); Ecmini23S antisense, 5[prime]-GGGGGAAGCTTGCTGACTTATGTCAGCATTCGC-3[prime] (33 nt, HindIII site underlined). The 5[prime] sense primers carry a T7 promoter region for transcription initiation. PCR was carried out at annealing temperatures of 45°C (45 s), followed by extension at 72°C (30 s). Cycles were repeated 31 times. The resulting PCR products were purified from low melting point agarose gels. Finally, the particular PCR products were cut with HindIII and EcoRI and cloned into pUC18 vectors. Integrity of the insert was confirmed by sequencing of the resulting plasmids.
In vitro transcription of RNAs
The pUC18 vector templates for in vitro transcription carrying the DNA sequence of the particular RNA substrate located behind a T7 promoter were linearized with HindIII (for Rc and Ec mini RNAs, respectively) or HpaII (Hpa mini RNA) to enable run-off transcription. As templates for N26 and N44 we used oligonucleotides with an annealed 18mer promoter oligonucleotide (24,25). In vitro transcription with T7 RNA polymerase (NEB) was performed as described elsewhere (23,26). To generate internally labelled RNAs, [[alpha]-32P]UTP (20 µCi) was included in each transcription reaction. Polynucleotide kinase (PNK) was used for 5[prime]-labelling of dephosphorylated RNAs, with 50 µCi [[alpha]-32P]ATP per reaction added. Radioactively labelled RNA transcripts were purified on a 10% polyacrylamide-7 M urea gel, the bands cut out and the substrates eluted from the crushed gel bands overnight at room temperature in RNA elution buffer (0.5 M NaOAc, pH 5.0, 1 mM EDTA, pH 8.0, 2.5% v/v phenol). Specific activities of the RNAs were of the order of 105 c.p.m./pmol.
Enzymatic assays
In addition to the Rc, Hpa and Ec mini RNAs, two variants of the well-studied phage T7 R1.1 processing signal for RNase III, N26 and N44, were used as substrates (Fig.
Figure 1. Proposed secondary structures of the RNA substrates for RNase III used in this study. The processing sites for RNase III are indicated by arrows: bold arrows, primary site; small arrow, secondary site. Shaded boxes highlight the R.capsulatus extra stem-loop element in the Rc mini and Hpa mini RNAs. The table summarizes the fragment sizes resulting from Rhodobacter RNase III cleavage at primary and secondary sites, respectively.
Mapping of the RNase III cleavage site by primer extension
To determine the position of the RNase III processing site in the Rc mini RNA we used primer extension analysis. The primer for the extension reaction (Rcmini ext) had the sequence 5[prime]-CGCTTCTGATCACTCCAC-3[prime] and annealed to nt 96-113 of the Rc mini RNA (see Fig.
Figure 2. Processing of 139 nt Rc mini and 79 nt Hpa mini substrate (2000 c.p.m./lane) by R.capsulatus (Rc) and E.coli (Ec) RNase III (30 nM dimer) in standard cleavage buffer (Materials and Methods). St, RNA standard (500-100 nt); C, control.
Immunological methods
Anti-RNase III sera directed against E.coli and R.capsulatus RNase III, respectively, were raised using E.coli RNase III, purified via poly(I)·poly(C) affinity chromatography (24), and R. capsulatus (His)6-RNase III, purified using Ni-NTA chromatography, as antigens. The purified proteins were lyophilized and used for production of antibodies in rabbits (Eurogentech, Belgium). Sera were purified using protein A-Sepharose chromatography. For western blot analysis, proteins were separated by SDS-PAGE on 15% polyacrylamide gels and transferred to nitrocellulose by semi-dry electroblotting (Pharmacia). Membranes were incubated with anti-RNase III antibodies (1:200) or corresponding pre-immune sera as a control. Immune complexes were detected with anti-rabbit IgG alkaline phosphatase conjugate (diluted 1:7000; Sigma) and nitroblue tetrazolium (NBT)/BCIP (X-phosphate) as substrate for the colour reaction.
Gel electrophoretic mobility shift assay
To detect formation of RNA-RNase III complexes, [[alpha]-32P]UTP-labelled Rc mini substrate (10 000 c.p.m.) was dissolved in 2× shift buffer (320 mM KCl, 60 mM Tris-HCl, pH 7.5, 10 mM EDTA, 20% v/v glycerol, 0.2 mM DTT) and incubated with various amounts of R.capsulatus or E.coli RNase III for 1 h at room temperature. The samples were then placed on ice. Aliquots were run on 7% polyacrylamide gels containing 0.5× TBE buffer for ~4 h at 10 V/cm in a cold room. The gels were dried and radioactive bands were detected by autoradiography.
Figure 3. Cleavage of internally and 5[prime]-labelled Rc mini RNA (~3000 c.p.m./lane) by R.capsulatus RNase III (30 nM dimer) in standard cleavage buffer. 1[prime] and 1.5[prime], incubation of Rc mini RNA with R.capsulatus RNase III for 1 and 1.5 min, respectively.
RESULTS
Purification of R.capsulatus RNase III
(His)6-RNase III from R.capsulatus was purified to apparent homogeneity using Ni-NTA affinity chromatography. We were able to isolate ~15-20 mg recombinant RNase III from 1.4 g E.coli M15 cells. During 2 h bacterial growth after IPTG induction and increased production of recombinant RNase III a toxic effect on the cells was not observed. A mock purification of IPTG-induced M15 cells carrying the pQE vector without the rnc insert showed no RNase III-like activity in the enzymatic assay (data not shown). This indicates that endogenous RNase III of E.coli M15 did not bind to the Ni-NTA column. The enzymatic activity observed is therefore due to (His)6-RNase III of R.capsulatus only.
Biochemical properties of (His)6-RNase III
To study the biochemical properties of R.capsulatus RNase III, we tested the enzyme's dependence on divalent cations and the influence of monovalent cations on cleavage of additional sites in the employed RNA substrates (Rc mini, Hpa mini, Ec mini, N26 and N44; Fig.
Figure 4. Incubation of Ec mini RNA (3000 c.p.m./assay) with R.capsulatus (Rc) and E.coli (Ec) RNase III (30 nM dimer) at different salt concentrations.
Substrate specificity
To address the special situation of fragmented 23S rRNA in Rhodobacter we used in vitro substrates derived from the extended helix 46 processing site of RNase III in R.capsulatus rRNA. The corresponding canonical stem-loop 46 of E.coli, the recipient site for the extra stem-loop, served as an additional in vitro substrate which, though also structured, is not cleaved by RNase III (Ec mini RNA). The two Rhodobacter mini 23S rRNA substrates we designed (Fig.
Figure 5. Three different RNA substrates (N26, Rc mini, N44; 2000 c.p.m./lane each) incubated for 3 min at 37°C with R.capsulatus (Rc) or E.coli (Ec) RNase III (30 nM dimer) in standard assay buffer. C, control. N26 RNA (47 nt) derived from the R1.1 processing signal is processed by both enzymes in a similar manner (Fig. Figure 6. Processing of 139 nt Rc mini RNA (2000 c.p.m./lane) by R.capsulatus (Rc) and E.coli (Ec) RNase III (30 nM dimer) at different concentrations of monovalent cations. Standard cleavage buffer without salt was supplemented with NH4Cl and KCl, respectively. C, uncleaved substrate; St, RNA standard (500-100 nt).
Binding of RNase III to Rc mini RNA
To examine whether the extremely reduced processing activity of E.coli RNase III with the 139 nt Rc mini RNA (see above) is due to lack of substrate binding or due to impaired enzymatic catalysis we employed gel shift experiments. Gel electrophoretic mobility shift assays under identical binding conditions show a higher affinity of R.capsulatus RNase III for Rc mini RNA compared with RNase III from E.coli (Fig.
A
![]() B ![]() |
Figure 7. (A) Gel mobility shift assay with E.coli RNase III and Rc mini RNA (10 000 c.p.m./lane). (B) Gel mobility shift assay with R.capsulatus RNase III and Rc mini substrate (10 000 c.p.m./lane). A shifted complex becomes visible at ~250 nM RNase III.
Position of the cleavage site for RNase III in the Rc mini RNA
Previous experiments (8) using low resolution primer extension and oligonucleotide probing indicated the presence of an in vivo processing site for RNase III in Rhodobacter rRNA at position 1364 of the large ribosomal subunit RNA (numbering according to the rRNA database entry). In addition to this major 5[prime]-end of the RNA fragment (indicated in Fig.
Immunological behaviour of RNase III
Despite strong sequence similarity of R.capsulatus and E.coli RNases III polyclonal antibodies raised against the E.coli enzyme do not crossreact with the (His)6-tagged enzyme from Rhodobacter. A polyclonal antiserum against the His-tagged enzyme of R.capsulatus does not show crossreaction with purified RNase III of E.coli during western blot analysis (Fig.
DISCUSSION
As a starting point for an analysis of the interaction of Rhodobacter RNase III with the 23S rRNA fragmentation site we first chose cleavage reactions with two well-established substrates used during analysis of E.coli RNase III, N26 and N44 (see Fig.
Figure 8. Primer extension analysis of Rc mini RNA cleaved by R.capsulatus RNase III. Ø (lane1), 5[prime]-end of the uncleaved Rc mini RNA; cut (lanes 2 and 5), observed 5[prime]-ends after cleavage of the RNA substrate by R.capsulatus RNase III (5 min, 37°C). The upper band corresponds to the 5[prime]-end of the full-length substrate (compare lane 1). The lower band indicates the additional 5[prime]-end after RNase III cleavage of the Rc mini RNA. The 5[prime]-end of this band corresponds to C54 (compare lanes 5 and 6 and Fig. 1). T, G, C, A (lanes 3, 4, 6 and 7), each letter refers to the corresponding nucleotide of the Rc mini DNA template as determined by dideoxy sequencing. Parts of the Rc mini RNA sequence are indicated on the right side of the figure and are numbered according to Figure 1. The RNase III cleavage site has been marked by an arrow. N44 is derived from N26 with a shorter helix by just 3 bp. Structural analysis of N44 by NMR spectroscopy, optical melting and chemical and enzymatic modification showed that it retains all the structural features of the parent molecule N26 (25). It also resembles N26 with respect to primary and secondary site cleavage and is readily processed by E.coli RNase III with only slightly reduced reactivity (25,27). Under standard salt concentrations we could not detect cleavage of N44 RNA by Rhodobacter RNase III (Fig. Figure 9. Immunocrossreactivity of R.capsulatus (Rc) and E.coli (Ec) RNases III (2 µg). The left panel shows a silver stained SDS-PAGE gel with both enzymes. The two right hand panels show western blots of this gel incubated with antibodies (ab) against E.coli RNase III (Ec ab) and R.capsulatus (Rc ab) RNase III, respectively. M, protein standard (BioRad), molecular weight indicated in kDa. We then analysed substrates derived from the fragmentation site in Rhodobacter 23S rRNA. The 139 nt Rc mini RNA (Fig. Surprisingly, E.coli RNase III does not cleave the 139 nt Rc mini RNA. This indicates that the Rhodobacter mini substrate must have clear structural deviations from the standard E.coli substrate type. The dsRBD of Rhodobacter RNase III must be structurally adapted to these changes. To provide more evidence for the `plug-in' character of the extra stem-loop conferring cleavage at the insertion site, we constructed the 79 nt Hpa mini RNA (Fig. The complex between the Rhodobacter 23S-derived substrate and RNase III appears to be particularly strong. The complex between N26 substrate and E.coli RNase III is unstable in non-denaturing gels. Only a fully base paired substrate variant provides stable complexes. This stability is then accompanied, though, by increased second site cleavage of the base paired substrate (27). The internal loop secures single site cleavage at the expense of higher instability of the enzyme-substrate complex. In our shift experiments under comparable conditions E.coli RNase III does not bind the Rhodobacter mini substrate (Fig. What structural features mark the differences between Rhodobacter and E.coli dsRBDs? The assumption that structural differences exist is supported by the observation that Rhodobacter RNase III does not bind to poly(I)·poly(C) resins under standard affinity chromatography conditions described for E.coli RNase III (24; data not shown). Furthermore, the mutual lack of antibody recognition between RNases III from E.coli and R.capsulatus points in that direction. The Rhodobacter dsRBD fits the general [alpha]-[beta]-[beta]-[beta]-[alpha] structure of a dsRBD as described for the dsRBDs of Drosophila Staufen protein and RNase III from E.coli (33,34). Two [alpha]-helices are positioned against the backdrop of a three-stranded antiparallel [beta]-sheet. The amino acid sequences of the Rhodobacter and E.coli dsRBD, though not identical, show strong homology with the consensus sequence for dsRBDs (20). We have identified a new RNA element which confers fragmentation on Rhodobacter 23S rRNA. It remains to be seen whether substrate recognition is dependent exclusively on recognition by a rigid dsRBD or whether it relies on a more subtle adaptive binding to the dsRBD and presentation of the substrate to the catalytic centre in the N-terminal half of the enzyme.
ACKNOWLEDGEMENTS
The templates for the N26 and N44 substrates and the E.colistrain HMS174(DE3)/pET-11a(rnc) were a generous gift of A.W.Nicholson (Detroit). The authors would like to thank Stephanie Schmalz and Christoph Scherfer for their assistance. This work was supported by Fonds der Chemischen Industrie.
REFERENCES
This article has been cited by other articles:
This page is run by Oxford University Press, Great Clarendon Street, Oxford OX2 6DP, as part of the OUP Journals
Comments and feedback: www-admin{at}oup.co.uk
Last modification: 19 Sep 1998
Copyright©Oxford University Press, 1998.
![]()
CiteULike
Connotea
Del.icio.us What's this?
![]()
![]()

![]()
![]()
![]()
M. Amblar, A. Barbas, P. Gomez-Puertas, and C. M. Arraiano
The role of the S1 domain in exoribonucleolytic activity: Substrate specificity and multimerization
RNA,
March 1, 2007;
13(3):
317 - 327.
[Abstract]
[Full Text]
[PDF]
![]()
![]()
![]()

![]()
![]()
![]()
R. I. Purusharth, F. Klein, S. Sulthana, S. Jager, M. V. Jagannadham, E. Evguenieva-Hackenberg, M. K. Ray, and G. Klug
Exoribonuclease R Interacts with Endoribonuclease E and an RNA Helicase in the Psychrotrophic Bacterium Pseudomonas syringae Lz4W
J. Biol. Chem.,
April 15, 2005;
280(15):
14572 - 14578.
[Abstract]
[Full Text]
[PDF]
![]()
![]()
![]()

![]()
![]()
![]()
D. Zaporojets, S. French, and C. L. Squires
Products Transcribed from Rearranged rrn Genes of Escherichia coli Can Assemble To Form Functional Ribosomes
J. Bacteriol.,
December 1, 2003;
185(23):
6921 - 6927.
[Abstract]
[Full Text]
[PDF]
![]()
![]()
![]()

![]()
![]()
![]()
E. Evguenieva-Hackenberg, E. Schiltz, and G. Klug
Dehydrogenases from All Three Domains of Life Cleave RNA
J. Biol. Chem.,
November 22, 2002;
277(48):
46145 - 46150.
[Abstract]
[Full Text]
[PDF]
![]()
![]()
![]()

![]()
![]()
![]()
F. Klein, R. Samorski, G. Klug, and E. Evguenieva-Hackenberg
Atypical Processing in Domain III of 23S rRNA of Rhizobium leguminosarum ATCC 10004T at a Position Homologous to an rRNA Fragmentation Site in Protozoa
J. Bacteriol.,
June 15, 2002;
184(12):
3176 - 3185.
[Abstract]
[Full Text]
[PDF]
![]()
![]()
![]()

![]()
![]()
![]()
B. Fournier, Q. C. Truong-Bolduc, X. Zhang, and D. C. Hooper
A Mutation in the 5' Untranslated Region Increases Stability of norA mRNA, Encoding a Multidrug Resistance Transporter of Staphylococcus aureus
J. Bacteriol.,
April 1, 2001;
183(7):
2367 - 2371.
[Abstract]
[Full Text]
![]()
![]()
![]()

![]()
![]()
![]()
E. Evguenieva-Hackenberg and G. Klug
RNase III Processing of Intervening Sequences Found in Helix 9 of 23S rRNA in the Alpha Subclass of Proteobacteria
J. Bacteriol.,
September 1, 2000;
182(17):
4719 - 4729.
[Abstract]
[Full Text]
![]()
This Article ![]()
![]()
Abstract
![]()
Print PDF (449K)
![]()
Alert me when this article is cited
![]()
Alert me if a correction is posted
![]()
Services ![]()
![]()
Email this article to a friend
![]()
Similar articles in this journal
![]()
Similar articles in ISI Web of Science
![]()
Similar articles in PubMed
![]()
Alert me to new issues of the journal
![]()
Add to My Personal Archive
![]()
Download to citation manager
![]()
Search for citing articles in:
ISI Web of Science (25)
![]()
Request Permissions ![]()
Commercial Re-use Guidelines
for Open Access NAR Content
![]()
Google Scholar ![]()
![]()
Articles by Conrad, C.
![]()
Articles by Klug, G.
![]()
Search for Related Content
![]()
PubMed ![]()
![]()
PubMed Citation
![]()
Articles by Conrad, C.
![]()
Articles by Klug, G.
![]()
Social Bookmarking ![]()
![]()
What's this?

