Skip Navigation

This Article
Right arrow Abstract Freely available
Right arrow Print PDF (449K) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (22)
Right arrowRequest Permissions
Right arrow Commercial Re-use Guidelines
for Open Access NAR Content
Google Scholar
Right arrow Articles by Conrad, C.
Right arrow Articles by Klug, G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Conrad, C.
Right arrow Articles by Klug, G.
Social Bookmarking
Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Nucleic Acids Research Pages 4446-4453  

Different cleavage specificities of RNases III from Rhodobacter capsulatus and Escherichia coli
Introduction
Materials And Methods
   Overexpression of R.capsulatus (His)6-RNase III in E.coli
   Purification of R.capsulatus (His)6-RNase III
   Purification of E.coli RNase III
   Construction of DNA templates for in vitro transcription of RNAs
   In vitro transcription of RNAs
   Enzymatic assays
   Mapping of the RNase III cleavage site by primer extension
   Immunological methods
   Gel electrophoretic mobility shift assay
Results
   Purification of R.capsulatus RNase III
   Biochemical properties of (His)6-RNase III
   Substrate specificity
   Binding of RNase III to Rc mini RNA
   Position of the cleavage site for RNase III in the Rc mini RNA
   Immunological behaviour of RNase III
Discussion
Acknowledgements
References

Different cleavage specificities of RNases III from Rhodobacter capsulatus and Escherichia coli

Different cleavage specificities of RNases III from Rhodobacter capsulatus and Escherichia coli

Christian Conrad, Reinhard Rauhut and Gabriele Klug*

Institut für Mikro- und Molekularbiologie der Justus-Liebig-Universität Giessen, Frankfurter Strasse 107,35392 Giessen, Germany

Received June 2, 1998; Revised and Accepted August 13, 1998

ABSTRACT

23S rRNA in Rhodobacter capsulatus shows endoribonuclease III (RNase III)-dependent fragmentation in vivo at a unique extra stem-loop extending from position 1271 to 1331. RNase III is a double strand (ds)-specific endoribonuclease. This substrate preference is mediated by a double-stranded RNA binding domain (dsRBD) within the protein. Although a certain degree of double strandedness is a prerequisite, the question arises what structural features exactly make this extra stem-loop an RNase III cleavage site, distinguishing it from the plethora of stem-loops in 23S rRNA? We used RNase III purified from R.capsulatus and Escherichia coli, respectively, together with well known substrates for E.coli RNase III and RNA substrates derived from the special cleavage site in R.capsulatus 23S rRNA to study the interaction between the Rhodobacter enzyme and the fragmentation site. Although both enzymes are very similar in their amino acid sequence, they exhibit significant differences in binding and cleavage of these in vitro substrates.

INTRODUCTION

Ribonucleases (RNases) are key components of the cell, converting mostly inactive RNA precursors into biologically active mature RNA molecules. One of these ribonucleases is endoribonuclease III (RNase III, EC 1.3.24). RNase III cleaves rRNA precursors in bacteria and yeast during maturation of rRNA (1,2). The Escherichia coli enzyme participates in precursor rRNA trimming, but is also involved in other pathways of RNA turnover (3,4). Acting on their respective mRNAs, RNase III directly influences the level of a broad variety of corresponding cellular proteins. In E.coli RNase III represents only 0.01% of total cell protein (5) and although the enzyme is not essential for viability (6), its presence and primary sequence are highly conserved in nearly all known bacterial genomes, even in the minimal genome of Mycoplasma genitalium (7). In the [alpha] purple bacterium Rhodobacter capsulatus the 23S rRNA is fragmented in vivo into 16S and 14S rRNA molecules. As shown previously, this fragmentation is RNase III-dependent (8). In contrast to E.coli, Rhodobacter 23S rRNA has an extra stem-loop inserted in helix 46 which serves as the RNase III cleavage site. The two resulting rRNA fragments are joined non-covalently in vivo to generate a functional 23S rRNA. Fragmentation of rRNA occurs in some other bacteria, for instance in Salmonella spp. (9,10), some cyanobacteria (11), Agrobacterium tumefaciens (12) and Rhodobacter sphaeroides (13), a close relative of R.capsulatus. The biological function of rRNA fragmentation still remains unclear (14), although there is some evidence that fragmented rRNA may provide a selective advantage for the bacterium under certain growth conditions (15,16). The amino acid sequence of R.capsulatus RNase III closely resembles other bacterial RNase III proteins (17). The processing specificity of RNase III is still poorly understood. This relates to both participants of this particular RNA-protein recognition system. RNase III substrates consist of structured nucleotide stretches with various patterns of intramolecular base pairing but lacking a consensus on the level of the primary sequence. The resulting double helical structure of ~20 bp (approximately two helical turns) contains one or two scissile internucleotide bonds. The deep and narrow major groove of A-form double-stranded (ds)RNA, inaccessible for potential protein contacts, could explain the lack of a consensus sequence. Cleavage is precise, but is not readily predictable from structure or sequence. Recently, the concept of anti-determinants, well known from tRNA recognition (18), has been applied to RNase III substrates. An RNase III cleavage site would thus be defined by the absence of `disfavoured' sequence motifs (19). On the side of the protein the contribution of the C-terminal dsRNA binding domain (dsRBD) module in creating substrate specificity appears critical. The dsRBD is a ubiquitous protein module present in a widely diverse class of regulatory proteins which bind folded RNAs (20). The module can be present in a protein in multiple copies (21,22). Biological activity in many cases relies only on specific binding without subsequent (nucleolytic) catalysis. In this work we analyse the structural basis for the interaction between R.capsulatus RNase III and the fragmentation signal in 23S rRNA.

MATERIALS AND METHODS

Overexpression of R.capsulatus (His)6-RNase III in E.coli

The rnc gene for RNase III of R.capsulatus was PCR amplified. A pGEM-3Zf(-) plasmid (Promega) harbouring a 1.7 kb PstI fragment containing the entire R.capsulatus rnc gene (23) was used as template. PCR primers were as follows: rncPstIup, 5[prime]-GAAAGTTGCTGCAGACCTCTCTGC-3[prime]; rncHindIIIdown, 5[prime]-CGAATCAAGCTTGCGTTTCTTCGG-3[prime] (PstI and HindIII sites, respectively, are underlined). The resulting product (~700 bp) was purified (Qiaex DNA gel extraction kit; Qiagen) and cloned into the PstI and HindIII sites of the polylinker of the hexahistidine tag vector pQE-30 (Qiagen). For further characterization the resulting plasmid (pQE-30[Rc rnc]) was transformed into E.coli JM109 (Stratagene). The correct sequence was confirmed by DNA sequencing. In addition to the N-terminal hexahistidine tag, the cloned RNase III of R.capsulatus contains 15 vector-encoded N-terminal amino acids not present in the wild-type RNase III. For protein expression the vector was propagated in E.coli M15[pREP4] cells (Qiagen) at 37°C using standard I medium containing ampicillin (200 µg/ml) and kanamycin (25 µg/ml). Overexpression of recombinant RNase III was induced by adding IPTG at a final concentration of 1.5 mM when cells reached an OD600 of 0.8. After continued incubation at 37°C for 2 h, the cells were harvested by centrifugation at 5000 g and stored at -70°C.

Purification of R.capsulatus (His)6-RNase III

All of the following steps were carried out on ice following the protocol for native purification of soluble proteins (Qiagen). An aliquot of 1.4 g induced E.coli cells was resuspended in sonication buffer (50 mM NaCl, 50 mM Tris-HCl, pH 7.5, 0.1 mM PMSF). Lysozyme was added at a final concentration of 1 mg/ml. The suspension was incubated for 30 min on ice and subsequently sonicated five times using a Sonopuls GM 70 sonicator (Bandelin). A sample of 7 ml Ni-NTA-agarose was prepared and equilibrated essentially following the manufacturer's protocol (Qiagen). The His-tagged protein was bound to the agarose in a batch procedure for 2 h with vigorous shaking on ice. The material was packed into a column (1.6 cm diameter) and washed with sonication buffer at a flow rate of 0.5 ml/min until the UV baseline was reached. To remove contaminating proteins the column was then washed extensively with sonication buffer containing 20 mM imidazole. The recombinant protein was eluted with a gradient of 0-500 mM imidazole in sonication buffer (90 min, 0.5 ml/min) using a GradiFrac® chromatography system (Pharmacia). Fractions of 1 ml were collected and kept at 4°C or at -70°C for long-term storage. Prior to use during enzymatic assays the RNase III fractions were dialysed in a cold room against dialysis buffer (50 mM Tris-HCl, pH 7.5, 50 mM NaCl, 0.01% sodium azide, 1 mM DTT). A mock purification under the same conditions was performed with E.coli M15 cells expressing the pQE30 vector alone.

Purification of E.coli RNase III

Escherichia coli RNase III was purified from the overexpressing E.coli strain HMS174(DE3)/pET-11a(mc) as previously described (24).

Construction of DNA templates for in vitro transcription of RNAs

The DNA template for in vitro transcription of the Rc mini RNA was constructed by PCR using genomic DNA of R.capsulatus as template and the following primers: Rcmini23S sense, 5[prime]-GGGGGGAATTCTAATACGACTCACTATAGGTTCTGTGATATAGCACCGCCCGACTTTAGC-3[prime] (60 nt, EcoRI site underlined); Rcmini23S antisense, 5[prime]-GGGGGAAGCTTGTTGACTCATGTCAACATTCTC-3[prime] (30 nt, HindIII site underlined). Primers for amplification of the E.coli mini substrate DNA using E.coli chromosomal DNA as template were: Ecmini23S sense, 5[prime]-GGGGGGAATTCTAATACGACTCACTATAGGTTCTGTAAGCCTGCGAAGGTG TGCTGT-3[prime] (57 nt, EcoRI site underlined); Ecmini23S antisense, 5[prime]-GGGGGAAGCTTGCTGACTTATGTCAGCATTCGC-3[prime] (33 nt, HindIII site underlined). The 5[prime] sense primers carry a T7 promoter region for transcription initiation. PCR was carried out at annealing temperatures of 45°C (45 s), followed by extension at 72°C (30 s). Cycles were repeated 31 times. The resulting PCR products were purified from low melting point agarose gels. Finally, the particular PCR products were cut with HindIII and EcoRI and cloned into pUC18 vectors. Integrity of the insert was confirmed by sequencing of the resulting plasmids.

In vitro transcription of RNAs

The pUC18 vector templates for in vitro transcription carrying the DNA sequence of the particular RNA substrate located behind a T7 promoter were linearized with HindIII (for Rc and Ec mini RNAs, respectively) or HpaII (Hpa mini RNA) to enable run-off transcription. As templates for N26 and N44 we used oligonucleotides with an annealed 18mer promoter oligonucleotide (24,25). In vitro transcription with T7 RNA polymerase (NEB) was performed as described elsewhere (23,26). To generate internally labelled RNAs, [[alpha]-32P]UTP (20 µCi) was included in each transcription reaction. Polynucleotide kinase (PNK) was used for 5[prime]-labelling of dephosphorylated RNAs, with 50 µCi [[alpha]-32P]ATP per reaction added. Radioactively labelled RNA transcripts were purified on a 10% polyacrylamide-7 M urea gel, the bands cut out and the substrates eluted from the crushed gel bands overnight at room temperature in RNA elution buffer (0.5 M NaOAc, pH 5.0, 1 mM EDTA, pH 8.0, 2.5% v/v phenol). Specific activities of the RNAs were of the order of 105 c.p.m./pmol.

Enzymatic assays

In addition to the Rc, Hpa and Ec mini RNAs, two variants of the well-studied phage T7 R1.1 processing signal for RNase III, N26 and N44, were used as substrates (Fig. 1). The latter have been described elsewhere (24,25). Cleavage assays were performed using in vitro transcribed RNA substrates, either internally labelled or 5[prime]-labelled as described above. The assays were carried out in cleavage buffer (30 mM Tris-HCl, pH 7.5, 10 mM MgCl2 or MgOAc, 130 mM KCl, 5% glycerol) at 37 or 32°C for the indicated time (usually 1-3 min). In some assays monovalent cations were omitted to determine their influence on cleavage specificity of RNase III. For each assay 5000 c.p.m. of the particular substrate were used. Assay volumes were 10 µl. The reactions were stopped by addition of 8 µl formamide-containing dye and placed on ice. Reaction products were incubated at 65°C for 3 min and analysed on a 10% polyacrylamide-7 M urea gel. Bands were detected by autoradiography.


Figure 1. Proposed secondary structures of the RNA substrates for RNase III used in this study. The processing sites for RNase III are indicated by arrows: bold arrows, primary site; small arrow, secondary site. Shaded boxes highlight the R.capsulatus extra stem-loop element in the Rc mini and Hpa mini RNAs. The table summarizes the fragment sizes resulting from Rhodobacter RNase III cleavage at primary and secondary sites, respectively.

Mapping of the RNase III cleavage site by primer extension

To determine the position of the RNase III processing site in the Rc mini RNA we used primer extension analysis. The primer for the extension reaction (Rcmini ext) had the sequence 5[prime]-CGCTTCTGATCACTCCAC-3[prime] and annealed to nt 96-113 of the Rc mini RNA (see Fig. 1). Aliquots of 100 pmol primer were labelled for 30 min at 37°C with 30 µCi [[gamma]-32P]ATP using polynucleotide kinase and subsequently purified with a NucTrap® push column (Stratagene). Unlabelled Rc mini substrate RNA was incubated with R.capsulatus (His)6-RNase III (30 nM dimer) in cleavage buffer at 37°C for 5, 10 or 15 min. After phenol extraction and ethanol precipitation of the RNA the substrate was dissolved in 5 µl 2× primer extension buffer (100 mM Tris-HCl, pH 8.3, 100 mM KCl, 20 mM MgCl2, 20 mM DTT, 0.2 mM spermidine, 2 mM each dNTPs). Approximately 200 000 c.p.m. primer and 5 µg E.coli tRNA were added and annealing took place in a final volume of 10 µl for 10 min at 70°C. The samples were cooled to room temperature and another 5 µl 2× primer extension buffer, 1.4 µl 40 mM sodium pyrophosphate, 2.6 µl water and 1 µl AMV reverse transcriptase (23 U/µl) were added. The reaction was incubated for 30 min at 42°C and precipitated with isopropanol at room temperature. The precipitate was dissolved in water, heated (10 min, 90°C) and analysed on a polyacrylamide-urea gel. Sequencing reactions of the DNA template for the Rc mini substrate using the same primer were loaded on the same gel to map the position of the cleavage site for RNase III.


Figure 2. Processing of 139 nt Rc mini and 79 nt Hpa mini substrate (2000 c.p.m./lane) by R.capsulatus (Rc) and E.coli (Ec) RNase III (30 nM dimer) in standard cleavage buffer (Materials and Methods). St, RNA standard (500-100 nt); C, control.

Immunological methods

Anti-RNase III sera directed against E.coli and R.capsulatus RNase III, respectively, were raised using E.coli RNase III, purified via poly(I)·poly(C) affinity chromatography (24), and R. capsulatus (His)6-RNase III, purified using Ni-NTA chromatography, as antigens. The purified proteins were lyophilized and used for production of antibodies in rabbits (Eurogentech, Belgium). Sera were purified using protein A-Sepharose chromatography. For western blot analysis, proteins were separated by SDS-PAGE on 15% polyacrylamide gels and transferred to nitrocellulose by semi-dry electroblotting (Pharmacia). Membranes were incubated with anti-RNase III antibodies (1:200) or corresponding pre-immune sera as a control. Immune complexes were detected with anti-rabbit IgG alkaline phosphatase conjugate (diluted 1:7000; Sigma) and nitroblue tetrazolium (NBT)/BCIP (X-phosphate) as substrate for the colour reaction.

Gel electrophoretic mobility shift assay

To detect formation of RNA-RNase III complexes, [[alpha]-32P]UTP-labelled Rc mini substrate (10 000 c.p.m.) was dissolved in 2× shift buffer (320 mM KCl, 60 mM Tris-HCl, pH 7.5, 10 mM EDTA, 20% v/v glycerol, 0.2 mM DTT) and incubated with various amounts of R.capsulatus or E.coli RNase III for 1 h at room temperature. The samples were then placed on ice. Aliquots were run on 7% polyacrylamide gels containing 0.5× TBE buffer for ~4 h at 10 V/cm in a cold room. The gels were dried and radioactive bands were detected by autoradiography.


Figure 3. Cleavage of internally and 5[prime]-labelled Rc mini RNA (~3000 c.p.m./lane) by R.capsulatus RNase III (30 nM dimer) in standard cleavage buffer. 1[prime] and 1.5[prime], incubation of Rc mini RNA with R.capsulatus RNase III for 1 and 1.5 min, respectively.

RESULTS

Purification of R.capsulatus RNase III

(His)6-RNase III from R.capsulatus was purified to apparent homogeneity using Ni-NTA affinity chromatography. We were able to isolate ~15-20 mg recombinant RNase III from 1.4 g E.coli M15 cells. During 2 h bacterial growth after IPTG induction and increased production of recombinant RNase III a toxic effect on the cells was not observed. A mock purification of IPTG-induced M15 cells carrying the pQE vector without the rnc insert showed no RNase III-like activity in the enzymatic assay (data not shown). This indicates that endogenous RNase III of E.coli M15 did not bind to the Ni-NTA column. The enzymatic activity observed is therefore due to (His)6-RNase III of R.capsulatus only.

Biochemical properties of (His)6-RNase III

To study the biochemical properties of R.capsulatus RNase III, we tested the enzyme's dependence on divalent cations and the influence of monovalent cations on cleavage of additional sites in the employed RNA substrates (Rc mini, Hpa mini, Ec mini, N26 and N44; Fig. 1). These substrates are either derived from 23S rRNA structures of R.capsulatus (Rc and Hpa mini substrates) or E.coli (Ec mini), respectively, or from the phage T7 R1.1 RNase III processing signal (N26 and N44). Maximum activity of the enzyme was observed at a pH of 7.5 (32°C) with 10-20 mM MgCl2 using N26 RNA as a substrate. Mn2+ and Co2+ can substitute for Mg2+ (optima at 1 and 5 mM, respectively), whereas Ca2+ and Zn2+ (0-50 mM) do not support enzymatic activity (data not shown). Thus Rhodobacter RNase III has the same divalent cation requirements as E.coli RNase III, with only slightly different optima. Recombinant RNase III from R.capsulatus and wild-type Rhodobacter RNase III, which had been partially purified using ion exchange chromatography, show the same substrate specificity with the N26 RNA (data not shown). Catalytic activity of RNase III is not inhibited by 40 U RNasin® RNase inhibitor (Promega). The ion requirements of R.capsulatus RNase III resemble those of E.coli RNase III, although with somewhat altered optima.


Figure 4. Incubation of Ec mini RNA (3000 c.p.m./assay) with R.capsulatus (Rc) and E.coli (Ec) RNase III (30 nM dimer) at different salt concentrations.

Substrate specificity

To address the special situation of fragmented 23S rRNA in Rhodobacter we used in vitro substrates derived from the extended helix 46 processing site of RNase III in R.capsulatus rRNA. The corresponding canonical stem-loop 46 of E.coli, the recipient site for the extra stem-loop, served as an additional in vitro substrate which, though also structured, is not cleaved by RNase III (Ec mini RNA). The two Rhodobacter mini 23S rRNA substrates we designed (Fig. 1) are processed in vitro by RNase III of R.capsulatus while purified E.coli RNase III shows no detectable enzymatic activity with the same substrates under identical conditions. With the Rc mini RNA (139 nt) the resulting fragments are 54 and 85 nt in size; the smaller Hpa mini substrate (79 nt) is cleaved into fragments of 54 and 25 nt (Fig. 2). In each case the 54 nt fragment carries the 5[prime]-end of the molecule, as demonstrated by cleavage of the 5[prime]-labelled substrates and comparison of the resulting fragment(s) with the products resulting from cleavage of the internally labelled substrates (Fig. 3). In contrast, the RNA substrate containing just E.coli rRNA helix 46 (Ec mini RNA, 81 nt; Fig. 1) is not processed by RNase III from R.capsulatus or E.coli even at low concentrations of monovalent cations (Fig. 4). It has been noted before that otherwise unreactive RNAs could serve as RNase III substrates at low salt concentrations (27-29).


Figure 5. Three different RNA substrates (N26, Rc mini, N44; 2000 c.p.m./lane each) incubated for 3 min at 37°C with R.capsulatus (Rc) or E.coli (Ec) RNase III (30 nM dimer) in standard assay buffer. C, control.

N26 RNA (47 nt) derived from the R1.1 processing signal is processed by both enzymes in a similar manner (Fig. 5). The cleavage specificity of R.capsulatus RNase III is influenced by the concentration of monovalent cations: a secondary site is cleaved (in addition to the primary processing site) at low salt concentrations (see Fig. 1). This was previously noted for E.coli RNase III (24). Rhodobacter RNase III exhibits a stronger preference for the secondary cleavage site of the N26 substrate than does the E.coli enzyme (Fig. 5, lanes 2 and 3). In cleavage of N26 RNA the 9/10 nt doublet band is due to non-template-directed addition of a nucleotide to the 3[prime]-terminus of the nascent transcript by T7 RNA polymerase (26,27). An additional 10 nt band (carrying the N26 5[prime]-end) resulting from cleavage at the secondary site contains only one 32P-labelled uridine residue and therefore does not significantly increase the signal of the 10 nt band resulting from the heterogeneous 3[prime]-end. The Rc mini RNA shows secondary site cleavage at low concentrations of monovalent cations (Fig. 6, lane 3), resembling R1.1-derived substrates (24,28,29). The slightly shorter N44 RNA (41 nt) cannot be cleaved by RNase III of R.capsulatus under conditions where cleavage by E.coli RNase III occurs (Fig. 5, lanes 8 and 9). In the absence of NH4Cl the enzymes of both organisms are able to process the R.capsulatus 139 nt mini substrate (Fig. 6, lanes 3 and 4). At concentrations of 100 mM KCl or NH4Cl, however, RNase III of R.capsulatus exhibits normal processing activity with the Rc mini RNA whereas the E.coli enzyme no longer cleaves the substrate. Processing activity of the R.capsulatus enzyme significantly decreases at salt concentrations higher than 150 mM KCl. At concentrations of >200 mM KCl or NH4Cl Rhodobacter RNase III no longer cleaves the mini substrate (Fig. 6).


Figure 6. Processing of 139 nt Rc mini RNA (2000 c.p.m./lane) by R.capsulatus (Rc) and E.coli (Ec) RNase III (30 nM dimer) at different concentrations of monovalent cations. Standard cleavage buffer without salt was supplemented with NH4Cl and KCl, respectively. C, uncleaved substrate; St, RNA standard (500-100 nt).

Binding of RNase III to Rc mini RNA

To examine whether the extremely reduced processing activity of E.coli RNase III with the 139 nt Rc mini RNA (see above) is due to lack of substrate binding or due to impaired enzymatic catalysis we employed gel shift experiments. Gel electrophoretic mobility shift assays under identical binding conditions show a higher affinity of R.capsulatus RNase III for Rc mini RNA compared with RNase III from E.coli (Fig. 7A and B). Escherichia coli RNase III is apparently unable to bind the Rc mini substrate with an affinity as high as the R.capsulatus enzyme. This corresponds to the lower processing activity of E.coli RNase III with the Rc mini substrate compared with the R.capsulatus enzyme (Figs 5 and 6).

   A

   B

Figure 7. (A) Gel mobility shift assay with E.coli RNase III and Rc mini RNA (10 000 c.p.m./lane). (B) Gel mobility shift assay with R.capsulatus RNase III and Rc mini substrate (10 000 c.p.m./lane). A shifted complex becomes visible at ~250 nM RNase III.

Position of the cleavage site for RNase III in the Rc mini RNA

Previous experiments (8) using low resolution primer extension and oligonucleotide probing indicated the presence of an in vivo processing site for RNase III in Rhodobacter rRNA at position 1364 of the large ribosomal subunit RNA (numbering according to the rRNA database entry). In addition to this major 5[prime]-end of the RNA fragment (indicated in Fig. 1), a minor 5[prime]-end at position 1321 was observed (nt 57 in Rc mini RNA; Fig. 1). Both 5[prime]-ends were thought to be generated by RNase III cleavage. Alternatively, the major 5[prime]-end could arise from subsequent exonucleolytic processing after cleavage at the observed minor 5[prime]-end. Our primer extension analysis of the cleaved Rc mini RNA shows that the in vitro processing site appears to be exclusively located between nucleotides U54 and C55 (Fig. 8; 1). In this region the RNA is predicted to be double-stranded. The double-stranded region with the cleavage site is flanked by bulge loops on both sides, resembling a `bulge-helix-bulge' motif. The position of this site is very close to the previously described in vivo minor 5[prime]-end. The observed major 5[prime]-end in vivo must originate from subsequent trimming of the 3[prime]-fragment after an initial cut at U54.

Immunological behaviour of RNase III

Despite strong sequence similarity of R.capsulatus and E.coli RNases III polyclonal antibodies raised against the E.coli enzyme do not crossreact with the (His)6-tagged enzyme from Rhodobacter. A polyclonal antiserum against the His-tagged enzyme of R.capsulatus does not show crossreaction with purified RNase III of E.coli during western blot analysis (Fig. 9).

DISCUSSION

As a starting point for an analysis of the interaction of Rhodobacter RNase III with the 23S rRNA fragmentation site we first chose cleavage reactions with two well-established substrates used during analysis of E.coli RNase III, N26 and N44 (see Fig. 1). Both substrates are related to the T7 phage early RNA R1.1 processing site (28). The N26 substrate has 47 nt comprising the stem-loop of the original R1.1 site. An upper and lower helical stem are connected through an asymmetrical internal loop. For substrate recognition E.coli RNase III does not require the internal loop and terminal tetraloop found in N26 (27). This substrate is readily processed by RNase III of E.coli and has since been the standard for RNase III activity assays. A single nucleotide bond located in the internal loop is cut under standard conditions. When assayed with Rhodobacter RNase III under identical conditions the enzyme shows optimal ion requirements comparable with those of E.coli RNase III (24). The preferred divalent cation is Mg2+ at a concentration of 10-20 mM, with Mn2+ and Co2+ able to substitute at optimal concentrations of 1 and 5 mM, respectively. Ca2+ and Zn2+ do not support catalytic activity. Me2+ ions are important for catalysis but their impact in substrate recognition appears to be rather limited. Protein contact appears to be established through direct sugar-phosphate backbone interaction (30). As with E.coli RNase III, substitution with Mn2+ and Co2+ significantly increases processing at an otherwise dormant secondary cleavage site in the loop (24). This is also the case when the concentration of monovalent cations is lowered. In summary, Rhodobacter RNase III performs very similarly to the E.coli enzyme when assayed with N26 RNA.


Figure 8. Primer extension analysis of Rc mini RNA cleaved by R.capsulatus RNase III. Ø (lane1), 5[prime]-end of the uncleaved Rc mini RNA; cut (lanes 2 and 5), observed 5[prime]-ends after cleavage of the RNA substrate by R.capsulatus RNase III (5 min, 37°C). The upper band corresponds to the 5[prime]-end of the full-length substrate (compare lane 1). The lower band indicates the additional 5[prime]-end after RNase III cleavage of the Rc mini RNA. The 5[prime]-end of this band corresponds to C54 (compare lanes 5 and 6 and Fig. 1). T, G, C, A (lanes 3, 4, 6 and 7), each letter refers to the corresponding nucleotide of the Rc mini DNA template as determined by dideoxy sequencing. Parts of the Rc mini RNA sequence are indicated on the right side of the figure and are numbered according to Figure 1. The RNase III cleavage site has been marked by an arrow.

N44 is derived from N26 with a shorter helix by just 3 bp. Structural analysis of N44 by NMR spectroscopy, optical melting and chemical and enzymatic modification showed that it retains all the structural features of the parent molecule N26 (25). It also resembles N26 with respect to primary and secondary site cleavage and is readily processed by E.coli RNase III with only slightly reduced reactivity (25,27). Under standard salt concentrations we could not detect cleavage of N44 RNA by Rhodobacter RNase III (Fig. 5, lane 8). With just 3 bp less a critical threshold value for helix length is obviously no longer met by this substrate. At low salt conditions, the N44 RNA is cleaved by RNases III of both organisms (not shown). We noticed that a single-stranded extension of the N44 3[prime]-end by just 4 nt (5[prime]-ACCA-3[prime]) (N44+4) restored cleavage in this substrate. To determine the contribution of the additional nucleotides we constructed three RNAs extended by 1, 2 or 3 nt at the 3[prime]-end. The nucleotides used for the extensions were A (N44+1), AC (N44+2) and ACC (N44+3). Instead of the G·U base pair at the termini of the N44 RNA lower stem (Fig. 1) all of the extended substrates possess an A instead of the terminal 3[prime] U, therefore lacking this G·U interaction. The 1 nt (A) extension does not restore substrate character to N44 RNA. Cleavage of N44 RNA seems to be restored by the addition of 2 nt (AC). N44+3 (ACC) RNA, however, is processed with a slightly reduced activity. Although increased processing is observed through the mere addition of 3[prime] nucleotides, further experiments are necessary for a detailed analysis of the contribution of the lower stem.


Figure 9. Immunocrossreactivity of R.capsulatus (Rc) and E.coli (Ec) RNases III (2 µg). The left panel shows a silver stained SDS-PAGE gel with both enzymes. The two right hand panels show western blots of this gel incubated with antibodies (ab) against E.coli RNase III (Ec ab) and R.capsulatus (Rc ab) RNase III, respectively. M, protein standard (BioRad), molecular weight indicated in kDa.

We then analysed substrates derived from the fragmentation site in Rhodobacter 23S rRNA. The 139 nt Rc mini RNA (Fig. 1) comprises the canonical helix 46 and the inserted extra stem-loop. Rhodobacter RNase III cleaves this substrate exclusively at the nucleotide bond between U54 and C55 (Figs 2 and 8). The position of the cleavage site was confirmed by primer extension of the 3[prime] cleavage product (Fig. 8) and by using 5[prime]-labelled Rc mini substrate (Fig. 3). The site thus corresponds well to the previously observed minor 5[prime]-end in vivo (8). An alternative way of processing this substrate would be cleavage of a dormant RNase III site in the canonical stem, possibly unmasked through structural changes after insertion of the extra stem-loop. We excluded cleavage in the canonical stem-loop by constructing a substrate which comprises the E.coli stem-loop alone (E.coli mini RNA; Fig. 1). This stem-loop is highly similar in E.coli and Rhodobacter. Neither Rhodobacter nor E.coli RNase III could process this substrate (Fig. 4). The observed major 5[prime]-end generated in vivo after fragmentation lies ~50 nt downstream of the minor 5[prime]-end, well within helix 46 (Fig. 1; 8). To explain this fact, either the action of a second endonuclease or the presence of a 5[prime]->3[prime] exonuclease would have to be postulated. This exonuclease type has not been described yet in bacteria.

Surprisingly, E.coli RNase III does not cleave the 139 nt Rc mini RNA. This indicates that the Rhodobacter mini substrate must have clear structural deviations from the standard E.coli substrate type. The dsRBD of Rhodobacter RNase III must be structurally adapted to these changes.

To provide more evidence for the `plug-in' character of the extra stem-loop conferring cleavage at the insertion site, we constructed the 79 nt Hpa mini RNA (Fig. 1) taking advantage of a naturally occurring HpaI site. This substrate comprises only the extra stem-loop with some additional terminal base pairs. This substrate is also precisely cleaved by Rhodobacter RNase III at position U54, but again is not cleaved by the E.coli enzyme (Fig. 2, lane 8). These results are in line with recent experiments where RNase III cleavage was conferred by introducing an RNase III-cleavable element into phage RNA genomes (31) or into a site in E.coli 23S rRNA. In the latter case a Salmonella spp. RNase III element from helix 45 of Salmonella 23S rRNA was introduced into helix 45 of unfragmented E.coli 23S rRNA, a site in close proximity to the Rhodobacter helix 46 (32). Interestingly, in this experiment the transferred Salmonella RNA element could be processed by RNase III from E.coli leading to a fragmented E.coli 23S rRNA, whereas the Rhodobacter element cannot be processed, at least not in vitro. The area around helix 46 makes only limited protein contacts in the ribosome and is exposed to the surface at the back of the central body of the large subunit (R.Brimacombe, personal communication). This is possibly important for processing of the 23S rRNA at a specific point in ribosome assembly.

The complex between the Rhodobacter 23S-derived substrate and RNase III appears to be particularly strong. The complex between N26 substrate and E.coli RNase III is unstable in non-denaturing gels. Only a fully base paired substrate variant provides stable complexes. This stability is then accompanied, though, by increased second site cleavage of the base paired substrate (27). The internal loop secures single site cleavage at the expense of higher instability of the enzyme-substrate complex. In our shift experiments under comparable conditions E.coli RNase III does not bind the Rhodobacter mini substrate (Fig. 7A). Rhodobacter RNase III instead forms a stable complex with this substrate (Fig. 7B), even in the absence of Mg2+, which is known to stabilize RNase III-substrate complexes (27). Formation of a stable complex and single site cleavage in this case do not exclude each other.

What structural features mark the differences between Rhodobacter and E.coli dsRBDs? The assumption that structural differences exist is supported by the observation that Rhodobacter RNase III does not bind to poly(I)·poly(C) resins under standard affinity chromatography conditions described for E.coli RNase III (24; data not shown). Furthermore, the mutual lack of antibody recognition between RNases III from E.coli and R.capsulatus points in that direction. The Rhodobacter dsRBD fits the general [alpha]-[beta]-[beta]-[beta]-[alpha] structure of a dsRBD as described for the dsRBDs of Drosophila Staufen protein and RNase III from E.coli (33,34). Two [alpha]-helices are positioned against the backdrop of a three-stranded antiparallel [beta]-sheet. The amino acid sequences of the Rhodobacter and E.coli dsRBD, though not identical, show strong homology with the consensus sequence for dsRBDs (20).

We have identified a new RNA element which confers fragmentation on Rhodobacter 23S rRNA. It remains to be seen whether substrate recognition is dependent exclusively on recognition by a rigid dsRBD or whether it relies on a more subtle adaptive binding to the dsRBD and presentation of the substrate to the catalytic centre in the N-terminal half of the enzyme.

ACKNOWLEDGEMENTS

The templates for the N26 and N44 substrates and the E.colistrain HMS174(DE3)/pET-11a(rnc) were a generous gift of A.W.Nicholson (Detroit). The authors would like to thank Stephanie Schmalz and Christoph Scherfer for their assistance. This work was supported by Fonds der Chemischen Industrie.

REFERENCES

1. Bram,R., Young,R. and Steitz,J. (1980) Cell, 19, 393-401. MEDLINE Abstract

2. Abou Elela,S., Igel,H. and Ares,M.,Jr (1996) Cell, 85, 115-124.

3. Nicholson,A.W. (1996) Prog. Nucleic Acid Res. Mol. Biol., 52, 1-65.

4. Dunn,J.J. (1982) In Boyer,P.D. (ed.), The Enzymes, Vol. XV,Nucleic Acids, Part B. Academic Press, New York, NY, pp. 485-499.

5. Chen,S.-M., Takiff,H.E., Barber,A.M., Dubois,G.C., Bardwell,J.C.A. and Court,D.L. (1990) J. Biol. Chem., 265, 2888-2895. MEDLINE Abstract

6. Babitzke,P., Granger,L., Olszewski,J. and Kushner,S.R. (1993) J. Bacteriol., 175, 229-239. MEDLINE Abstract

7. Fraser,C.M., Gocayne,J.D., White,O., Adams,M.D., Clayton,R.A., Fleishmann,R.D., Bult,C.J., Kerlavage,A.R., Sutton,G., Kelley,J.M. et al.) (1995) Science, 270, 397-403. MEDLINE Abstract

8. Kordes,E., Jock,S., Fritsch,J., Bosch,F. and Klug,G. (1994) J. Bacteriol., 176, 1121-1127. MEDLINE Abstract

9. Burgin,A.B. Parodos,K., Lane,D.J. and Pace,N.R. (1990) Cell, 60, 404-414.

10. Winkler,M.E. (1979) J. Bacteriol., 139, 842-849. MEDLINE Abstract

11. Doolittle,W.F. (1973) J. Bacteriol., 113, 1256-1263. MEDLINE Abstract

12. Schuch,W. and Loening,U.E. (1975) Biochem. J., 149, 17-22. MEDLINE Abstract

13. Marrs,B.L. and Kaplan,S. (1970) J. Mol. Biol., 49, 297-317. MEDLINE Abstract

14. Gray,M.W. and Schnare,M.N. (1996) In Zimmermann,R.A. and Dahlberg,A.E. (eds), Ribosomal RNA. CRC Press, Boca Raton, FL, pp. 49-69.

15. Hsu,D., Shih,L.-M. and Zee,Y.C. (1994) J. Bacteriol., 176, 4761-4765. MEDLINE Abstract

16. Dam,M., Douthwaite,S., Tenson,T. and Mankin,A.S. (1996) J. Mol. Biol., 256, 1-6. MEDLINE Abstract

17. Rotondo,G. and Frendewey,D. (1996) Nucleic Acids Res., 24, 2377-2386. MEDLINE Abstract

18. Saks,M.E., Sampson,J.R. and Abelson,J.N. (1994) Science, 263, 191-197. MEDLINE Abstract

19. Zhang,K. and Nicholson,A.W. (1997) Proc. Natl Acad. Sci. USA, 94, 13437-13441. MEDLINE Abstract

20. Burd,C.G. and Dreyfuss,G. (1994) Science, 265, 615-621. MEDLINE Abstract

21. St Johnston,D., Brown,N.H., Gall,J.G. and Jantsch,M. (1991)Proc. Natl Acad. Sci. USA, 89, 10979-10983.

22. Schmedt,C., Green,S.R., Manche,L., Taylor,D.R., Ma,Y. and Mathews,M.B. (1995) J. Mol. Biol., 249, 29-44. MEDLINE Abstract

23. Rauhut,R., Jäger,A., Conrad,C. and Klug,G. (1996) Nucleic Acids Res., 24, 1246-1251. MEDLINE Abstract

24. Li,H.-L., Chelladurai,B.S., Zhang,K. and Nicholson,A.W. (1993)Nucleic Acids Res., 21, 1919-1925. MEDLINE Abstract

25. Schweisguth,D.C., Chelladurai,B.S., Nicholson,A.W. and Moore,P.B. (1994) Nucleic Acids Res., 22, 604-612. MEDLINE Abstract

26. Milligan,J.F., Groebe,D.R., Witherell,G.W. and Uhlenbeck,O.C. (1987) Nucleic Acids Res., 14, 8783-8798. MEDLINE Abstract

27. Chelladurai,B.S., Li,H., Zhang,K. and Nicholson,A.W. (1993) Biochemistry, 32, 7549-7558. MEDLINE Abstract

28. Dunn,J.J. (1976) J. Biol. Chem., 251, 3807-3814. MEDLINE Abstract

29. Gross,G. and Dunn,J.J. (1987) Nucleic Acids Res., 15, 431-442. MEDLINE Abstract

30. Li,H. and Nicholson,A. W (1996) EMBO J., 15, 1421-1433. MEDLINE Abstract

31. Klovins,J., van Duin,J. and Olsthoorn,R.C.L. (1997) Nucleic Acids Res., 25, 4201-4208. MEDLINE Abstract

32. Gregory,S.T., O'Connor,M. and Dahlberg,A.E. (1996) Nucleic Acids Res., 24, 4918-4923. MEDLINE Abstract

33. Bycroft,M., Grünert,S., Murzin,A.G., Proctor,M. and St Johnston,D. (1995) EMBO J., 14, 3563-3571. MEDLINE Abstract

34. Kharrat,A., Macias,J., Gibson,T.J., Nilges,M. and Pastore,A. (1995) EMBO J., 14, 3572-3584. MEDLINE Abstract

*To whom correspondence should be addressed. Tel: +49 641 99 35542; Fax: +49 641 99 35549; Email: gabriele.klug@mikro.bio.uni-giessen.de

This page is run by Oxford University Press, Great Clarendon Street, Oxford OX2 6DP, as part of the OUP Journals
Comments and feedback: www-admin{at}oup.co.uk
Last modification: 19 Sep 1998
Copyright©Oxford University Press, 1998.
Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
 RNAHome page
M. Amblar, A. Barbas, P. Gomez-Puertas, and C. M. Arraiano
The role of the S1 domain in exoribonucleolytic activity: Substrate specificity and multimerization
RNA, March 1, 2007; 13(3): 317 - 327.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
R. I. Purusharth, F. Klein, S. Sulthana, S. Jager, M. V. Jagannadham, E. Evguenieva-Hackenberg, M. K. Ray, and G. Klug
Exoribonuclease R Interacts with Endoribonuclease E and an RNA Helicase in the Psychrotrophic Bacterium Pseudomonas syringae Lz4W
J. Biol. Chem., April 15, 2005; 280(15): 14572 - 14578.
[Abstract] [Full Text] [PDF]

Home page
 J. Bacteriol.Home page
D. Zaporojets, S. French, and C. L. Squires
Products Transcribed from Rearranged rrn Genes of Escherichia coli Can Assemble To Form Functional Ribosomes
J. Bacteriol., December 1, 2003; 185(23): 6921 - 6927.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
E. Evguenieva-Hackenberg, E. Schiltz, and G. Klug
Dehydrogenases from All Three Domains of Life Cleave RNA
J. Biol. Chem., November 22, 2002; 277(48): 46145 - 46150.
[Abstract] [Full Text] [PDF]

Home page
 J. Bacteriol.Home page
F. Klein, R. Samorski, G. Klug, and E. Evguenieva-Hackenberg
Atypical Processing in Domain III of 23S rRNA of Rhizobium leguminosarum ATCC 10004T at a Position Homologous to an rRNA Fragmentation Site in Protozoa
J. Bacteriol., June 15, 2002; 184(12): 3176 - 3185.
[Abstract] [Full Text] [PDF]

Home page
 J. Bacteriol.Home page
B. Fournier, Q. C. Truong-Bolduc, X. Zhang, and D. C. Hooper
A Mutation in the 5' Untranslated Region Increases Stability of norA mRNA, Encoding a Multidrug Resistance Transporter of Staphylococcus aureus
J. Bacteriol., April 1, 2001; 183(7): 2367 - 2371.
[Abstract] [Full Text]

Home page
 J. Bacteriol.Home page
E. Evguenieva-Hackenberg and G. Klug
RNase III Processing of Intervening Sequences Found in Helix 9 of 23S rRNA in the Alpha Subclass of Proteobacteria
J. Bacteriol., September 1, 2000; 182(17): 4719 - 4729.
[Abstract] [Full Text]

This Article
Right arrow Abstract Freely available
Right arrow Print PDF (449K) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (22)
Right arrowRequest Permissions
Right arrow Commercial Re-use Guidelines
for Open Access NAR Content
Google Scholar
Right arrow Articles by Conrad, C.
Right arrow Articles by Klug, G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Conrad, C.
Right arrow Articles by Klug, G.
Social Bookmarking
Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?