ABSTRACT
The incisions in the DNA at the 3'- and 5'-side of a DNA damage during nucleotide excision repair in Escherichia coli occur in a complex consisting of damaged DNA, UvrB and UvrC. The exact requirements for the two incision events, however, are different. It has previously been shown that the 3'-incision requires the interaction between the C-terminal domain of UvrB and a homologous region in UvrC. This interaction, however, is dispensable for the 5'-incision. Here we show that the C-terminal domain of the UvrC protein is essential for the 5'-incision, whereas this domain can be deleted without affecting the 3'-incision. The C-terminal domain of UvrC is homologous with the C-terminal part of the ERCC1 protein which, in a complex with XPF, is responsible for the 5'-incision reaction in human nucleotide excision repair. Both in the UvrC and the ERCC1 domain a Helix-hairpin-Helix (HhH) motif can be indicated, albeit at different positions. Such a motif also has been found in a large variety of DNA binding proteins and it has been suggested to form a structure involved in non-sequence-specific DNA binding. In contrast to the full length UvrC protein, a truncated UvrC protein (UvrC554) lacking the entire ERCC1 homology including the HhH motif no longer binds to ssDNA. Analysis of protein-DNA complexes using bandshift experiments showed that this putative DNA binding domain of UvrC is required for stabilisation of the UvrBC-DNA complex after the 3'-incision has taken place. We propose that after the initial 3'-incision the HhH motif recognises a specific DNA structure, thereby positioning the catalytic site for the subsequent 5'-incision reaction.
Nucleotide excision repair (NER) is a general repair system that removes damaged nucleotides from DNA by incision on either side of the lesion. The human and highly homologous Saccharomyces cerevisiae NER systems have been reconstituted in vitro, demonstrating that at least 17 proteins are needed for these incisions (1-5). In the bacterium Escherichia coli only three proteins, UvrA, UvrB and UvrC are required to complete the incision reaction. Despite the difference in the number of proteins needed, the overall mechanism leading to the dual incision seems rather conserved in prokaryotes and eukaryotes. In principle a damage-recognition protein complex recruits other proteins to the DNA lesion to form a preincision complex in which the DNA conformation is changed. In both the prokaryotic and eukaryotic systems the incisions are in the same order, the 3'-incision always preceding the 5'-incision (6,7). The two incisions are made in an asymmetrical fashion, on the fourth or fifth phosphodiester bond 3' from the lesion and on the eighth phosphodiester bond 5' from the lesion in the E.coli system (8,9) and on the ninth phosphodiester bond 3' and sixteenth to nineteenth phosphodiester bond 5' in the eukaryotic systems (5).
The Uvr proteins do not show extensive homology with the human or yeast repair proteins although they have some structural elements in common. Both UvrA and XPA (S.c. RAD14) are zinc-binding proteins (11-13). The UvrA dimer is responsible for initial damage recognition in the trimeric UvrA2B complex and is needed to load UvrB at the site of the lesion (14,15). In the eukaryotic system XPA (S.c. RAD14) binds preferentially to damaged DNA (13,16) and has interactions with several other proteins, among which the general transcription factor TFIIH, a multiprotein complex of nine or more proteins (17-19).
XPB (S.c. RAD25) and XPD (S.c. RAD3) which are subunits of TFIIH, like UvrB contain the so called helicase motifs (18,20-22). In E.coli the formation of the UvrB-DNA preincision complex is dependent on ATP hydrolysis and functional helicase domains in UvrB (23,24). The loading of UvrB alters the conformation of the DNA in the UvrB-DNA complex and the complex is subsequently bound by UvrC (25). In analogy, the eukaryotic DNA repair proteins XPB (S.c. RAD25) and XPD (S.c. RAD3) are likely to be responsible for local unwinding of the DNA around the lesion. This conformational change in the DNA is thought to be necessary for the dual incision to occur, of which the 3' one is made by XPG (S.c. RAD2) and the 5' one is made by the ERCC1-XPF (S.c. RAD1-RAD10) complex (10,26-29). In UvrC four residues have been indicated to be involved in catalytic activity for the 5'-incision (7). The catalytic site for the 3'-incision has not yet been identified and could be located in UvrB and/or UvrC (25).
The C-terminal part of UvrC shows homology with the C-terminal part of ERCC1 (30). To study the function of this conserved domain in excision repair we constructed a truncated UvrC protein lacking this domain. We show that this protein induces normal 3'-incision but the 5'-incision is severely reduced. The defect in 5'-incision could be related to a defect in binding to single stranded DNA (ss-DNA). Implications for the role of the homologous domains in prokaryotic and eukaryotic nucleotide excision repair will be discussed.
pBL12 expresses the uvrC gene from the tac-promotor (31). Plasmid pSVL5E carries a cDNA clone of ERCC1 (32). Strain CS4927 [F'(lacIq, pro,) [Delta]lac-pro, [Delta]uvrC] has been described (33).
Bio-421 (G ACC GCG CTT GCC AGC GTG TTG AAA TTG CCG G) encodes UvrC residues 381-391.
Bio-NdeI (CTTCAAGTCTTGACATATGTCA ATT TTT GAC CTT CGC CCG) contains an NdeI restriction site at nt 12-17, a stopcodon at nt 18-20 and encodes UvrC residues 549-554 at nt 21-38.
Bio-646 (GCG AAG GTC AAA AAT-ACT GAA TGT CTG ACC ACC G) encodes UvrC residues 550-554 (nt 1-15) and ERCC1 residues 200-205 (nt 16-34).
Bio-647 (GGT CAG ACA TTC AGT- ATT TTT GAC CTT CGC CCG) contains nt 1-15 corresponding to ERCC1 residues 204-200 and nt 16-33 corresponding to UvrC residues 554-549.
Oligo-T (GGATCC-CTT GGC AGC TGG GGT CAT) containing a BamHI restriction site (nt 1-6) and nt 1036-1053 located 3' of the ERCC1 gene (nt 7-24) was kindly provided by J.H.J.Hoeijmakers.
The UvrC554 truncated protein was constructed by introducing a stopcodon at position 555 using PCR. The PCR product obtained with primer Bio-421 (which hybridises 5' of the NcoI site of the uvrC gene) and primer Bio-NdeI (which contains the stop codon and an NdeI restriction site) was digested with NcoI and NdeI and inserted into pBL12, which has the uvrC gene expressed from the tac-promotor (31). The NdeI site is located in the pBR322 vector sequences of pBL12.
The UvrC-ERCC1 chimaera was constructed by three PCR reactions. First a PCR product was obtained with Bio-421 and Bio-647 with pBL12 as a template. In a second reaction Bio-646 and Oligo-T were used with pSVL5E as a template. The two overlapping PCR products were hybridised and used in the third PCR reaction with primers Bio-421 and Oligo-T (which contains a BamHI site). The PCR product was digested with NcoI and BamHI and inserted in pBL12 digested with NcoI and BglII (which is located at the 3'-end of the uvrC gene). All constructs were checked by DNA sequencing.
One litre of CS4927 ([Delta]uvrC) containing pBL12 was grown overnight in the presence of 0.5 mM IPTG. After sonication in lysis buffer (10 mM Tris-HCl pH 9.0, 140 mM NaCl, 0.5 mM MgCl2, 1 mM CaCl2, 10 mM [beta]-Mercaptoethanol, 0.5% Nonidet P-40) the NaCl concentration was increased to 1 M and the extract was subjected to centrifugation at 100 000 g. The supernatant was diluted five times using Buffer C (100 mM KHPO4 pH 7.5, 10 mM [beta]-Mercaptoethanol, 1 mM EDTA, 25% Glycerol), loaded on a 30 ml Cellex-P column (Biorad) in Buffer C plus 100 mM KCl and the protein was eluted with Buffer C containing 1 M KCl. UvrC containing fractions were diluted to a final concentration of 0.1 M KCl with Buffer C and loaded on a 20 ml ss-DNA cellulose column equilibrated in Buffer C with 0.1 M KCl and the proteins were eluted with a 0.1-1 M KCl gradient in Buffer C.
The truncated UvrC protein was purified using an adaptation of the method described above. After the Cellex-P column the UvrC containing fractions were loaded on a 1 ml HiTrap-Blue column (Pharmacia Biotech) equilibrated in Buffer C with 0.3 M KCl. The proteins were eluted using Buffer C with 1 M KCl. The fractions containing the mutant protein were concentrated by ultrafiltration [Millipore Ultrafree-MC filter units (UFC3 TTK 00)].
The incision- (34) and bandshift assays (35) for the UvrABC proteins have been described. In these assays a 96 bp DNA fragment containing a single cis-Pt.GG adduct (34) or the same fragment with a nick at the 3'-side of the adduct were used (25). In addition a 96 fragment was used containing a cholesterol adduct instead of the cis-Pt lesion. This fragment was constructed by ligation of six oligonucleotides, in a similar way as for the cis-Pt.GG fragment (34), replacing the central oligo with the cis-Pt.GG lesion (AATTCCCACTGGAACCCA) with the same sequence containing a cholesterol attached to a propanediol backbone instead of the T residue at position 10 (provided by Eurogentec).
Wild-type UvrC and mutant UvrC554 proteins (20 pmol of each protein in 45 µl Buffer C plus 150 mM KCl) were incubated with 50 µl of ss-DNA cellulose suspension in an Eppendorf tube on ice for 10 min. After centrifugation the non-binding fraction was removed and the pellet was washed three times with 50 µl of Buffer C with 150 mM KCl. The proteins were eluted by addition of 45 µl Buffer C with 1.5 M KCl followed by centrifugation. Samples of 15 µl were run on a 7.5% SDS-polyacrylamide gel and the proteins were visualised by western blotting.
Oligo GCCGGCGCTCGG(T)22CCGAGCGC, which was kindly provided by J.H.J.Hoeijmakers is a partially self-complementary oligonucleotide giving rise to a stem-loop structure which is a substrate for the structure specific endonucleases ERCC1-XPF, XPG and RAD1-Rad10 (27). For the 5' labeling 4 pmol oligo was treated with T4 polynucleotide kinase (20 U) in 70 mM Tris-HCl pH 7.5, 10 mM MgCl2, 5 mM DTT, 0.1 mM spermidine and 10 pmol [[gamma]-32P]ATP (7000 Ci/mmol) for 45 min and after hybridisation (3 min 95°C, 10 min 65°C, 10 min 37°C, 10 min 20°C, 10 min ice) the substrate was incubated with 1 U Klenow fragment of DNA polymerase I and 0.2 mM dNTPs for 20 min at 20°C. For the labeling at the 3'-end the oligo was treated with Klenow fragment (1 U) in 70 mM Tris-HCl pH 7.5, 10 mM MgCl2, 5 mM DTT, 0.2 mM dGTP, 0.2 mM dTTP and 6 pmol [[alpha]-32P]dCTP (3000 Ci/mmol) for 20 min at 20°C followed by hybridisation. Both substrates were purified on a G15 gelfiltration spin column and loaded on a 3.5% native polyacrylamide gel. The DNA substrates were eluted from the gel slices by incubating overnight at 37°C in 0.1 M Na Acetate and the DNA was purified by ethanol precipitation. The formation of the stem-loop was confirmed by digestion with HaeII, which has a recognition site in the stem (results not shown).
The C-terminal part of UvrC (residues 555-610) is homologous to the C-terminal part of ERCC1 (residues 236-297) (Fig. 1). To study the function of this UvrC domain in E.coli nucleotide excision repair we constructed a truncated UvrC protein that lacks the C-terminal region. For this purpose a stopcodon was introduced in the uvrC gene at the triplet encoding residue 555. The truncated uvrC gene did not complement a [Delta]uvrC strain for survival after UV irradiation (results not shown), indicating that the C-terminal domain is essential for the function of UvrC in excision repair.
The UvrC554 protein was tested in the UvrABC incision assay using two different cis-Pt.GG DNA substrates, a 96 bp double stranded DNA (ds-DNA) fragment and the same substrate containing a 3'-nick (Fig. 3) The two substrates were labeled at the 5'-end of the damaged strand. For both the ds- (Fig. 3, lanes 3 and 4) and the nicked substrate (lanes 7 and 8) the incision reaction with the wild-type UvrABC proteins gave rise to a 42 nt 5'-incision product and also a 35 nt product which is the result of a second 5'-incision event (35). The 3'-incision product (54 nt) could not be detected since this 3'-incision is normally efficiently followed by the 5'-incision. When the UvrC554 mutant was used in the incision assay with the ds-DNA fragment, only an incision product of 54 nt was obtained (lanes 1 and 2), indicating that with the truncated UvrC the 3'-incision does occur normally but the 5'-incision is disturbed. When the 3'-nicked DNA substrate was used and the gel was overexposed, a small amount of the 5'-incision product could be detected (lanes 9 and 10), demonstrating that the catalytic site needed for the 5'-incision is still present in the truncated protein, but the efficiency of incision is very low.
During the purification procedure of the UvrC554 protein we observed that, in contrast to wild-type UvrC, the mutant did not bind to the ss-DNA cellulose column. To demonstrate this different behavior of the two proteins more directly, we mixed the wild-type and mutant UvrC proteins and assayed the binding to ss-DNA cellulose using the batch procedure as described in Materials and Methods. The proteins were bound to the column material in low salt buffer, the unbound proteins were removed by centrifugation and after washing of the column material the bound proteins were eluted in high salt buffer. Figure 4 clearly shows that the wild-type protein bound the ss-DNA cellulose (lane 5), whereas the mutant protein could only be detected in the non-bound fraction (lane 2). The observed binding of wild-type UvrC to the column material was indeed the result of binding to the ss-DNA, since no binding to cellulose itself could be detected (results not shown). Taken together these results show that the mutant protein has no detectable ss-DNA binding under the conditions tested in which the wild-type protein binds quite efficiently, indicating that the C-terminal domain of UvrC contains determinants for binding to ss-DNA.
When UvrA is incubated in the presence of UvrB a UvrA2B complex is formed which specifically recognises DNA damages. The UvrB protein is loaded onto the DNA and the UvrB-DNA preincision complex can subsequently be bound by UvrC. In vitro, incubation of UvrABC with the cis-Pt.GG DNA substrate results in two major protein-DNA complexes when analysed on a native polyacrylamide gel, the UvrA2B-DNA and the UvrBC-DNA complex, (Fig. 5, lane 1). When UvrC554 was tested for complex formation in the bandshift assay no stable UvrBC-DNA complex was formed but a weak smear could be observed, indicating that the complex dissociated during electrophoresis (Fig. 5, lane 3). In the presence of antibodies directed against UvrC the wild-type UvrBC-DNA complex was shifted to the slot (Fig. 5, lane 2). Also a reduced amount of the mutant UvrBC-DNA complex could be detected in the slot due to the stabilising effect of the binding of the antibodies (Fig. 5, lane 4). Apparently the mutant UvrC can still bind to the UvrB-DNA preincision complex, but the stability of the resulting complex is reduced compared with that of the wild-type protein. The formation of the UvrBC-DNA complex has previously been shown to be dependent on a region in the C-terminal part of UvrB and a homologous region in the N-terminal half of UvrC (25,36). It was also shown that the interaction between these two homologous domains in the UvrBC-DNA complex is essential for normal 3'-incision. Since the 3'-incision induced by the UvrC554 protein is comparable with that of the wild-type protein, this specific UvrB-UvrC interaction is expected to be like wild-type as well. Apparently, however, this interaction is not sufficient to give rise to a stable UvrBC-DNA complex in a bandshift assay when UvrC554, lacking a determinant for DNA binding is used. This strongly suggests that the UvrBC-DNA complex as observed in a bandshift is not only stabilised by protein-protein contacts between UvrB and UvrC, but also by a contact of the C-terminal domain of UvrC with the DNA.
To test whether the C-terminal domain of ERCC1 can functionally replace the homologous domain of UvrC we made a construct encoding a chimeric protein in which the N-terminal region of the UvrC protein is fused to the C-terminal part of ERCC1. The fusion construct did not complement uvrC mutant cells for survival after UV treatment (not shown). Western blotting did detect small amounts of the fusion protein in the cell (not shown). When we tried to purify this protein, the fractions that reacted with the UvrC antibodies did not show DNA-binding activity or specific incision of UV-irradiated supercoiled DNA (results not shown). The truncated UvrC554 protein did incise this DNA substrate, indicating that the fusion protein is probably not properly folded.
The human ERCC1 protein forms a complex with XPF and this complex catalyses the 5'-incision during eukaryotic nucleotide excision repair. In the absence of the DNA repair recognition factors this complex shows a structure-specific endonuclease activity on DNA substrates (without a lesion) containing ds/ss junctions. A DNA substrate, which forms a stem-loop structure with a 12 bp ds-DNA stem and a 22 nt ss-DNA loop, was found to be a good substrate for cleavage by ERCC1-XPF (27). To test whether the homology between ERCC1 and UvrC is related to this activity the same DNA substrate was tested for endonucleic cleavage by UvrC and/or UvrB in the presence (not shown) or absence (Fig. 6) of UvrA. None of the combined Uvr subunits gave rise to an incision product, indicating that the requirements for 5'-incision by Uvr(AB)C and the ERCC1-XPF complex are different.
In this paper we describe the properties of a truncated UvrC protein (UvrC554) lacking its C-terminal 56 residues, a domain that is homologous with part of the human NER protein ERCC1. In vitro the truncated UvrC554 protein appears to be severely disturbed in 5'-incision but the 3'-incision is normal. This defect in 5'-incision cannot be attributed to deletion of the catalytic site since the truncated protein does show a residual level of 5'-incision. Four residues have been identified (D399, D438, D466 and H538) to make part of the active site for the 5'-incision (7) and these residues are still present in the UvrC554 protein (Fig. 1A).
Unlike the wild-type UvrC protein, the UvrC554 mutant no longer binds to a ss-DNA cellulose column. In the C-terminal part of UvrC of a HhH motif has been predicted (Fig. 1B), a motif that has been implicated in non-sequence specific DNA binding (38). A similar motif also was predicted in ERCC1 (32), but in a different part of the homologous region (Fig. 1B) and in FEN1, a structure-specific endonuclease (38,39). ERCC1 in complex with XPF is responsible for the 5'-incision during eukaryotic nucleotide excision repair. In the absence of other repair proteins, this complex specifically incises DNA structures (without a lesion) containing a ss/ds junction (27). Also the FEN1 nuclease, which removes unannealed 5'-tails from a primer-template structure (39) cleaves the DNA at a ss/ds junction. Therefore it is possible that the predicted HhH motifs are involved in the recognition of such a structure. The 5'-incision during excision repair in E.coli is dependent on the presence of a nick at or near the 3'-incision site. A KMnO4 footprint on a ds-DNA substrate with a cisplatin lesion revealed that after the addition of UvrC to the preincision complex some thymines in the non-damaged strand near the 3'-incision position show a considerable increase in sensitivity, indicating that this region becomes single stranded after incision (40). A disruption of base-pairing would imply that after 3'-incision a DNA structure is formed with a ss/ds junction. Subsequent recognition of this structure by the putative HhH motif in the C-terminal region of UvrC might be a prerequisite for the 5'-incision event. Attempts to demonstrate binding of the UvrC protein alone to specific DNA structures (including ss-DNA) using the bandshift assay have been unsuccessful (results not shown). This, however, is most likely due to the fact that the UvrC protein has a net positive charge, which probably causes potential UvrC-DNA complexes to be disrupted during electrophoresis. A direct involvement of the C-terminal region of UvrC in recognition of a ss/ds junction could, therefore, not be demonstrated. A stem-loop DNA structure, consisting of a 12 bp ds-region and a 22 nt ss-loop has been shown to be a substrate for specific incision by the ERCC1-XPF complex (27). In our hands the same DNA substrate could not be incised by UvrC, neither in the absence nor in the presence of the other Uvr proteins. Recently, however, Zou et al. (41) have demonstrated that a DNA molecule without damage containing a junction of a 20 bp ds-region and a 11 nt unpaired region containing a free 3'-end can be incised by the combined action of UvrB and UvrC, albeit with a low efficiency. The reason why our stem-loop structure could not be incised by UvrB and UvrC is not clear. On one hand it might be that the 12 bp ds-region in our stem-loop structure is too short. On the other hand the action of UvrB and UvrC might require a free 3'-end which is not present in the stem-loop structure. In any case the experiments by Zou et al. show that UvrB-UvrC are capable of recognising a DNA structure with a ss/ds junction and the C-terminal region of UvrC might well play a role in this process.
The predicted HhH motifs in the homologous regions of UvrC and ERCC1 do not coincide (Fig. 1). The relation between these motifs and the homology, therefore, is not clear. It is possible that each protein domain contains in fact two functional HhH motifs. Another possibility is, that the two protein domains derive from a common ancestor with two HhH motifs and that each protein has evolved in using only one of these for its repair function. The fact that the ERCC1 domain cannot functionally replace the homologous domain of UvrC would argue for the latter hypothesis. Vice versa it also has been demonstrated that the UvrC domain cannot substitute for the ERCC1 domain in the function of ERCC1 in vivo (32). The actual presence of HhH motifs in UvrC and ERCC1, however, awaits structural studies of both protein domains.
Both the 3'- and the 5'-incision occur in the UvrBC-DNA complex. The organisation of the subunits within the UvrBC-DNA complex, however, seems fundamentally different for either incision. For the 3'-incision, UvrC binds to the preincision complex via an interaction between the C-terminal domain of UvrB and a homologous internal domain of UvrC (25,36). Although the interaction between these domains is very important for the formation of the 3'-incision complex, it cannot be the only contact of UvrC with the UvrB-DNA complex, since in the absence of the UvrC-binding domain of UvrB a low level of 3'-incision can still occur. It is not clear, however, whether this additional contact of UvrC occurs via the DNA or via another domain of UvrB. In any case the DNA-binding domain of UvrC described in this paper is not required for a proficient 3'-incision complex. The bandshift experiments described in this paper indicate that the 3'-incision event induces a conformational change in the UvrBC-DNA complex, which destabilises the initial UvrB-UvrC-DNA interactions. As a result a stable 5'-incision complex becomes dependent on the C-terminal DNA-binding domain of UvrC. Again the postulated interaction of this domain of UvrC with the DNA is not the only contact of UvrC in the 5'-incision complex, since in its absence some 5'-incision can still take place.
Although the presence of a 3'-nick is essential for formation of the 5'-incision complex, the 3'-incision event itself is not required. Apparently a proficient 5'-incision complex can be formed directly on a pre-nicked DNA substrate without passing through a conformational change in the UvrBC-DNA complex via the 3'-incision event. We propose that recognition of a specific, partially single stranded DNA structure by the C-terminal domain of UvrC is an important determinant for the generation of this 5'-incision complex.
We thank Dr Rob Visse for critical reading of the manuscript. This work was supported by the J.A.Cohen Institute for Radiopathology and Radiation Protection (IRS).
Sijbers,A.M., de Laat,W.L., Ariza,R.R., Biggerstaff,M., Wei,Y.F., Moggs,J.G., Carter,K.C., Shell,B.K., Evans,E., de Jong,M.C., et al. (1996) Cell, 86, 811-822.
Nucleic Acids Research
Pages
Introduction
Materials And Methods
Plasmids and strains
PCR primers
Construction of UvrC554 and the UvrC-ERCC1 chimeric protein
Protein overproduction and purification
UvrABC incision assay and bandshift assay
ss-DNA binding assay
Construction of a stem-loop DNA substrate
Results
Isolation of a truncated UvrC protein
The UvrC554 protein is specifically disturbed in 5'-incision
UvrC554 does not bind ss-DNA
Analysis of protein-DNA complexes
Properties of the UvrC-ERCC1 chimeric protein
Incision on a stem-loop DNA substrate
Discussion
Acknowledgements
References
REFERENCES
This page is run by Oxford University Press, Great Clarendon Street, Oxford OX2 6DP, as part of the OUP Journals
Comments and feedback: www-admin{at}oup.co.uk
Last modification: 6 Jan 1998
Copyright© Oxford University Press, 1998.
CiteULike 
Connotea 
Del.icio.us What's this?
This article has been cited by other articles:
|
|
 |
|
  I. Gomez-Pinto, E. Cubero, S. G. Kalko, V. Monaco, G. van der Marel, J. H. van Boom, M. Orozco, and C. Gonzalez Effect of Bulky Lesions on DNA: SOLUTION STRUCTURE OF A DNA DUPLEX CONTAINING A CHOLESTEROL ADDUCT J. Biol. Chem., June 4, 2004; 279(23): 24552 - 24560. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. A. Vetcher and R. D. Wells Sticky DNA Formation in Vivo Alters the Plasmid Dimer/Monomer Ratio J. Biol. Chem., February 20, 2004; 279(8): 6434 - 6443. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 E. E. A. Verhoeven, M. van Kesteren, J. J. Turner, G. A. van der Marel, J. H. van Boom, G. F. Moolenaar, and N. Goosen The C-terminal region of Escherichia coli UvrC contributes to the flexibility of the UvrABC nucleotide excision repair system Nucleic Acids Res., June 1, 2002; 30(11): 2492 - 2500. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 G. F. Moolenaar, S. van Rossum-Fikkert, M. van Kesteren, and N. Goosen Cho, a second endonuclease involved in Escherichia coli nucleotide excision repair PNAS, January 24, 2002; (2002) 32584099. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
G. F. Moolenaar, V. Monaco, G. A. van der Marel, J. H. van Boom, R. Visse, and N. Goosen The Effect of the DNA Flanking the Lesion on Formation of the UvrB-DNA Preincision Complex. MECHANISM FOR THE UvrA-MEDIATED LOADING OF UvrB ONTO A DNA DAMAGED SITE J. Biol. Chem., March 10, 2000; 275(11): 8038 - 8043. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
E. E. A. Verhoeven, M. van Kesteren, G. F. Moolenaar, R. Visse, and N. Goosen Catalytic Sites for 3' and 5' Incision of Escherichia coli Nucleotide Excision Repair Are Both Located in UvrC J. Biol. Chem., February 18, 2000; 275(7): 5120 - 5123. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 W. L. de Laat, N. G.J. Jaspers, and J. H.J. Hoeijmakers Molecular mechanism of nucleotide excision repair Genes & Dev., April 1, 1999; 13(7): 768 - 785. [Full Text]
|
|
|
|
|
|
G. F. Moolenaar, M. Bazuine, I. C. van Knippenberg, R. Visse, and N. Goosen Characterization of the Escherichia coli Damage-independent UvrBC Endonuclease Activity J. Biol. Chem., December 25, 1998; 273(52): 34896 - 34903. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M.-s. Tang, M. Nazimiec, X. Ye, G. H. Iyer, J. Eveleigh, Y. Zheng, W. Zhou, and Y.-Y. Tang Two Forms of UvrC Protein with Different Double-stranded DNA Binding Affinities J. Biol. Chem., February 2, 2001; 276(6): 3904 - 3910. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
G. F. Moolenaar, S. van Rossum-Fikkert, M. van Kesteren, and N. Goosen Cho, a second endonuclease involved in Escherichia coli nucleotide excision repair PNAS, February 5, 2002; 99(3): 1467 - 1472. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||