ABSTRACT
Telomerase is a ribonucleoprotein enzyme with an essential RNA component. Embedded within the telomerase RNA is a template sequence for telomere synthesis. We have characterized the structure of the 5' regions of the human and mouse telomerase-RNA genes, and have found a striking difference in the location of the template sequence: Whereas the 5'-end of the human telomerase RNA lies 45 nt from the telomerase-RNA template sequence, the 5'-end of the mouse telomerase RNA lies just 2 nt from the telomerase-RNA template sequence. Analysis of genomic sequences flanking the 5'-end of the human and mouse telomerase RNA-coding sequences reveals similar promoter-element arrangements typical of mRNA-type promoters: a TATA box-like element and an upstream region containing a consensus CCAAT box. This putative promoter structure contrasts with that of the ciliate telomerase-RNA genes whose structure resembles RNA polymerase III U6 small nuclear RNA (snRNA) promoters. These and other comparisons suggest that, during evolution, both the RNA-polymerase specificity of telomerase RNA-gene promoters and, more recently, the position of the template sequence in the telomerase RNA changed.
Due to the mechanism by which DNA is replicated, the ends of chromosomes would become progressively shorter during successive rounds of replication if they were not actively maintained. One way chromosomal ends are maintained is by de novo addition of short G-rich repeats to their 3'-ends by the specialized DNA polymerase telomerase. Telomerase is a ribonucleoprotein complex, in which a single RNA molecule and protein components are essential for activity. In organisms as diverse as ciliates, yeast and vertebrates, the telomerase RNA sequence contains a `template' region complementary to the sequence of the telomeric repeats. In all organisms analyzed to date this template region is embedded in the telomerase RNA sequence and is responsible for both substrate alignment and for templating addition of the telomeric repeats (for review, see 1).
In ciliates, the telomerase-RNA gene is transcribed by RNA polymerase III and contains a promoter reminiscent of U6 small nuclear RNA (snRNA) genes (2,3). To characterize vertebrate telomerase RNA-gene transcription, we have mapped the mouse telomerase-RNA 5' terminus and the human (4) and mouse (5) telomerase-RNA gene sequences flanking the telomerase-RNA transcriptional start site. The human and mouse telomerase-RNA gene sequences are related but, in contrast to the ciliate genes, reveal sequence elements typical of RNA polymerase II mRNA-type promoters. Further to our surprise, although these are two closely related species, the position of the transcriptional start site relative to the template-encoding sequence is very different. Whereas the human transcriptional start site lies 45 bp upstream of template-encoding sequence (4), the mouse transcriptional start site lies only 2 bp upstream of the template-encoding sequence.
The molecular cloning of the mouse telomerase-RNA gene has been described (5). Molecular cloning of the human telomerase-RNA gene will be described in detail elsewhere (J.Feng, W.D.Funk, W.H.Andrews and B.Villeponteau, unpublished results). DNA sequence analysis was performed by the dideoxy method (6). Human (HoTel series) and mouse (MoTel series) telomerase-RNA gene-specific primers were synthesized. The HoTel-3 and MoTel-3 primers contain a T7 RNA polymerase promoter at the 5'-end (ATTAATACGACTCACTATAGGGAGA) followed by the gene-specific sequences listed below. The 5'- and 3'-ends for each primer are relative to the transcriptional start site for each gene; the 3'-ends of the resulting human and mouse probes are equidistant from the template sequence. HoTel series, HoTel-3: +197 CGAACGGGCCAGCAGCTGA +179; HoTel-5: -224 GTTTCACCTTTAAAGAA -208; HoTel-11: -8 AGCGCACCGGGTTGCGG +9; HoTel-12: +15 GGGCCTGGGAGGGGTGG +31; HoTel-13: +37 ATTTTTTGTCTAACCCTAACTG +58; HoTel-14: +59 AGAAGGGCGTAGGCGCC +75; HoTel-15: +81 TTTGCTCCCCGCGCGCT +97; MoTel series, MoTel-3: +161 GAACCTGGAGCTCCTGCGC +143; MoTel-5: -267 CCTACTTTCAACTCTAG -251; MoTel-11: -51 AATCAGCGCGCGCCATG -35; MoTel-12: -29 TTTAAGGTCGAGGGCGG -13; MoTel-13: -7 CCTCGGCACCTAACCCT +10; MoTel-14: +16 TCATTAGCTGTGGGTTC +32; MoTel-15: +38 TTTTGTTCTCCGCCCGC +54; MoTel-24: +141 GACGTTTGTTTTTGAGGCTCGGGAACGCCG +112
Telomerase RNA was isolated from human HeLa and mouse NIH3T3 cells and probed with RNase A and T1 as described (7). RNase-protection analysis was performed with radiolabeled antisense RNA probes and the protected fragments identified by electrophoresis through 6% denaturing polyacrylamide gels. [alpha]-32P-Labeled RNA probes were synthesized by in vitro transcription with T7 RNA polymerase. Templates for in vitro transcription were generated by PCR with the 3' gene-specific T7 RNA polymerase promoter-containing HoTel-3 or MoTel-3 primer and one of the 5' HoTel or MoTel primers (primers 5 and 11-15).
Primer-extension reactions were modified from (8). Total NIH3T3 RNA (30 µg) was hybridized overnight at 60°C in 30 µl 1× hybridization buffer (40 mM PIPES, pH 6.7, 400 mM NaCl, 1 mM EDTA, 80% formamide) containing 1 × 106 c.p.m. of 5'-end-labeled mouse-specific MoTel-24 primer. After hybridization, the sample was precipitated with ethanol and resuspended for reverse transcription in 30 µl 50 mM Tris, pH 7.6, 60 mM KCl, 10 mM MgCl2, 1 mM DTT, 5 mM dNTPs, 40 U RNAsin and 100 U Mu-MLV reverse transcriptase. The reaction was incubated 2 hr at 37°C after which the cDNA was precipitated with ethanol, resuspended in 4 µl 9 M urea/1% SDS and 16 µl 100% formamide/10 mM EDTA, and incubated 10 min at 85°C prior to loading onto a 6% denaturing polyacrylamide gel. To map the cDNA extension product, a dideoxy-sequencing ladder was generated using the same 5'-end-labeled MoTel-24 primer and was loaded beside the primer extension products.
In preliminary experiments using an RNase-protection assay to measure mouse telomerase RNA expression in NIH3T3 cells, we observed a protected product which migrated faster during polyacrylamide gel electrophoresis than predicted from the previously mapped human (4) and mouse (5) telomerase-RNA 5'-ends. The faster migration of the mouse telomerase RNA-protected probe could have resulted from (i) an unusually stable secondary structure causing anomalous migration during electrophoresis, or (ii) an alternate transcriptional start site lying downstream of the previously characterized site (5). To discriminate between these two hypotheses, we used an RNase-protection strategy that can distinguish between anomalous migration and an alternate start site.
Figure 1A illustrates the RNase-protection strategy, showing the predicted results for two telomerase-RNA transcripts starting at different positions, either distal or proximal to the telomerase template-encoding sequence. In this procedure, human or mouse telomerase RNA is hybridized to a nested set of six species-specific antisense probes (Probes 1-6) all sharing the same 5'-end but progressively shorter at the 3'-end. After RNase digestion, all of the probes extending past the 5'-end of the telomerase RNA will yield a protected fragment of equal size corresponding to the 5'-end of the telomerase RNA (arrows), whereas probes that do not extend to the 5'-end of the telomerase RNA will yield protected fragments corresponding to the size of the individual probes. Thus, for the distal start site in Figure 1A, Probes 1 and 2 will be digested to the same size, whereas Probes 3-6 will be progressively shorter. In contrast, for the proximal start site, Probes 1-4 will be digested to the same size, and only Probes 5 and 6 will be progressively shorter. Because these results depend on the position of the 3'-end of the antisense probes and not the intrinsic mobility of the protected fragments during electrophoresis, this strategy is not sensitive to an unusual secondary structure.
To map the 5'-end of the mouse telomerase RNA more precisely and to ensure that the RNase protection products were the result of the 5'-end of the telomerase RNA, and not, for example, the result of a splicing event, we performed a primer-extension analysis as shown in Figure 2. We used RNA isolated from NIH3T3 cells and a 5'-end labeled mouse-specific oligonucleotide primer (MoTel 24). The primer extension reaction resulted in a major extension product in the region corresponding to the 5'-end indicated by the RNase-protection analysis (Fig. 2, lane 1). Comparison with a parallel DNA-sequencing ladder (Fig. 2, lanes 2-5) reveals that the 3'-end of this extension product corresponds to just 2 nt upstream of the telomerase-RNA template sequence. This extension product was probably missed before (5) because the labeled primer used for extension analysis was directed to the template sequence, and thus was too close to the telomerase RNA 5'-end to allow detection of the extension product over the background of unextended primer. Together, the RNase-protection (Fig. 1) and primer-extension (Fig. 2; 4) indicate that the transcriptional start site for the human telomerase-RNA gene lies 45 bp upstream of the template-encoding sequence and for the mouse telomerase-RNA gene lies 2 bp upstream of the template-encoding sequence.
Identification of the likely transcriptional start sites for the human and mouse telomerase-RNA genes suggests that the regions upstream of these sites represent promoter sequences. To compare the human and mouse telomerase RNA-gene promoters, we determined the DNA sequence of these regions as shown in Figure 3. In Figure 3A, the human and mouse telomerase RNA-gene sequences have been aligned according to the transcriptional start sites (wavy arrow). Even though the position of the transcriptional start sites relative to the template-encoding sequence varies greatly between these species (from 45 to 2 bp upstream), the upstream promoter sequences exhibit considerable similarity (see bold and underlined residues). Significantly, this sequence similarity is clustered in two regions, which we refer to as Regions I and II (Fig. 3A).
Region I lies 19-30 bp and 19-31 bp upstream of the transcriptional start site of the human and mouse telomerase-RNA genes, respectively. The position and sequence of the 5' region of this similarity, TA/TTT/ATAAG, suggests that it represents a TATA box, a key basal cis-regulatory element shared by many RNA polymerase II promoters and some RNA polymerase III promoters (e.g., the U6 snRNA promoter). Region II lies upstream of the putative TATA box, 47-64 bp upstream of the transcriptional start site in the human gene and 42-59 bp upstream in the mouse gene. This region of sequence similarity contains a consensus CCAAT box in both promoters. The CCAAT box is a promoter-specific cis-regulatory element found in a variety of RNA polymerase II mRNA promoters and recognized by numerous different transcription factors (reviewed in 9). Significantly, although the telomerase RNA is a `small nuclear RNA' there is no evident PSE promoter element as is found in small nuclear RNA (snRNA) promoters (10). Figure 3B summarizes our findings, highlighting the arrangement of conserved elements in the human and mouse telomerase-RNA gene sequences. Further studies will be required to determine the sequences important for transcription of the human and mouse telomerase-RNA genes.
By a combination of RNase-protection and primer-extension analyses, we have mapped the 5'-end of the mouse telomerase RNA and determined the DNA sequence of the 5' flanking sequences of the human and mouse telomerase-RNA genes. For both the human (4; this study) and mouse (this study) telomerase RNAs, the RNase-protection and primer-extension analyses identified congruent 5'-ends suggesting that these 5'-ends correspond to the transcriptional start sites for these genes. These analyses reveal three important findings: (i) unlike all other known telomerase RNAs, the mouse telomerase RNA 5'-end lies just upstream of the telomerase template sequence; (ii) although the position of the human and mouse telomerase-RNA transcriptional start sites varies greatly with respect to the template-encoding sequence, the human and mouse telomerase-RNA genes contain related upstream flanking sequences and (iii) the human and mouse telomerase-RNA gene upstream flanking sequences contain TATA box and CCAAT box sequence elements typical of RNA polymerase II mRNA promoters (Fig. 3).
The finding that the mouse telomerase RNA 5'-end lies very close to the template sequence shows that, in at least one organism, extended sequences upstream of the template sequence are probably not essential for telomerase function. This finding was unexpected because in all other organisms examined the telomerase RNA template sequence is located 35 or more nucleotides from the 5'-end (4,11-15). What effect might the position of the template have on telomerase activity?
Our analysis of sequences 5' of two mammalian telomerase-RNA genes, the human and mouse genes, reveals interesting similarities and differences with the 5' flanking sequences of the distantly related ciliate telomerase-RNA genes. Analysis of the polymerase specificity of ciliate telomerase RNA-gene transcription indicates that these genes are transcribed by RNA polymerase III (2). Consistent with this specificity, comparison of the sequences 5' of many ciliate telomerase-RNA genes (11-14) reveals basal promoter elements similar to those found in the ciliate RNA-polymerase III U6 snRNA-gene promoter: a TATA-like box and a USE, a sequence motif related to the snRNA-specific human PSE basal element (3). The RNA polymerase III specificity of U6 gene transcription is governed by the combination and arrangement of the PSE and TATA-box elements in these promoters (reviewed in 10). The sequence element arrangement and RNA polymerase III specificity of the ciliate telomerase-RNA promoters suggest that transcription of the ciliate telomerase-RNA genes is similar to that of the U6 snRNA gene.
The sequence of the mammalian telomerase-RNA gene 5' regions shows that they share with the ciliate telomerase-RNA genes a TATA box-like element about 25 bp upstream of the putative transcriptional start site. In contrast to the ciliate genes, however, there is no evident snRNA gene-like PSE element further upstream. In its place is an extended region of sequence similarity specific to mouse and human: the 18 bp sequence from -47 to -64 in humans and -42 to -59 in mice is 78% identical (14 out of 18 bp). This region contains a perfectly conserved CCAAT-box sequence, a promoter element not found in either RNA polymerase II or III snRNA-gene promoters but typical of RNA polymerase II mRNA-type promoters. These results suggest that, in contrast to the ciliate telomerase-RNA genes, the mammalian genes are transcribed by RNA polymerase II.
Consistent with the hypothesis that the mammalian telomerase-RNA genes are transcribed by RNA polymerase II, the mammalian telomerase-RNA genes contain multiple runs of four and more T residues (4,5). Such T-residue runs, which are not found in the ciliate telomerase-RNA genes (11-14), terminate transcription by RNA polymerase III and, therefore, indicate that the mammalian telomerase-RNA genes are unlikely to be transcribed by RNA polymerase III.
Together, the sequence analyses of the ciliate and mammalian telomerase-RNA genes suggest that, by an exchange of PSE- and CCAAT box-containing sequences upstream of a conserved TATA box, the polymerase specificity of ciliate and mammalian telomerase-RNA gene transcription was changed. A change in polymerase specificity would not be unprecedented: the U3 snRNA gene is transcribed by RNA polymerase III in plants, but by RNA polymerase II in vertebrates and lower eukaryotes (18).
Why might the ciliate and mammalian telomerase-RNA genes be transcribed by different RNA polymerases? We suggest two mutually compatible explanations: differences in the levels of promoter activity and differences in the requirements for cell-specific transcription in the different organisms.
First, during ciliate development thousands of subchromosomal fragments lacking telomeric repeats are generated by site-directed cleavage and amplification of micronuclear DNA (reviewed in 19). Telomerase is responsible for addition of repeats to these subchromosomal fragments thereby stabilizing them (20). Because of the large number of chromosomal ends generated during development, ciliates are expected to have more telomerase than other organisms. Consistent with this idea, both telomerase RNA and telomerase activity are much higher in Tetrahymena than in human cells (21,22; C.Greider, unpublished results). The promoters of snRNA genes are among the most active producing ~2-3 × 106 snRNA transcripts per cell per generation (23) and, therefore, ciliates may carry snRNA-like telomerase-RNA promoters because they are capable of producing large numbers of transcripts. In contrast, having many fewer telomeres, mammalian cells may not require a promoter with such high activity.
Instead, in mammals telomerase RNA-gene transcription may need to be regulated more stringently than in ciliates. Because snRNAs are required for mRNA splicing, most snRNA genes are ubiquitously expressed. In contrast, the expression of most mRNA-encoding genes is restricted temporally and spatially in the organism: an mRNA-type promoter could afford the mammalian telomerase-RNA gene greater flexibility to produce more complex and restricted expression patterns than are required in the ciliates.
We thank W.Tansey for a critical reading of the manuscript and J.Duffy and P.Renna for artwork. This study was supported by PHS grant CA13106 from the National Cancer Institute to W.H. and C.G. and the Geron Corporation.
Nucleic Acids Research
Pages
Introduction
Materials And Methods
Plasmids and oligonucleotides
RNase-protection analysis
Primer-extension analysis
Results
RNase-protection analysis of the 5"-end of human and mouse telomerase RNA
Primer-extension analysis of the mouse telomerase RNA 5"-end
DNA-sequence analysis of human and mouse telomerase RNA promoter regions
Discussion
The telomerase RNA 5'-end can lie just upstream of the template sequence
The sequences 5' of the human and mouse telomerase-RNA genes share conserved elements found in RNA polymerase II mRNA-type promoters
Acknowledgements
References
The mouse telomerase RNA 5'-end lies just upstream of the telomerase template sequence
REFERENCES
This page is run by Oxford University Press, Great Clarendon Street, Oxford OX2 6DP, as part of the OUP Journals
Comments and feedback: www-admin{at}oup.co.uk
Last modification: 6 Jan 1998
Copyright© Oxford University Press, 1998.
CiteULike 
Connotea 
Del.icio.us What's this?
This article has been cited by other articles:
|
|
 |
|
  X. Li, H. Nishizuka, K. Tsutsumi, Y. Imai, Y. Kurihara, and S. Uesugi Structure, Interactions and Effects on Activity of the 5'-terminal Region of Human telomerase RNA J. Biochem., May 1, 2007; 141(5): 755 - 765. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. Lin, H. Ly, A. Hussain, M. Abraham, S. Pearl, Y. Tzfati, T. G. Parslow, and E. H. Blackburn From the Cover: A universal telomerase RNA core structure includes structured motifs required for binding the telomerase reverse transcriptase protein PNAS, October 12, 2004; 101(41): 14713 - 14718. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J.-L. Chen and C. W. Greider Template boundary definition in mammalian telomerase Genes & Dev., November 15, 2003; 17(22): 2747 - 2752. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 H. Ly, E. H. Blackburn, and T. G. Parslow Comprehensive Structure-Function Analysis of the Core Domain of Human Telomerase RNA Mol. Cell. Biol., October 1, 2003; 23(19): 6849 - 6856. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 D. Bosoy, Y. Peng, I. S. Mian, and N. F. Lue Conserved N-terminal Motifs of Telomerase Reverse Transcriptase Required for Ribonucleoprotein Assembly in Vivo J. Biol. Chem., January 31, 2003; 278(6): 3882 - 3890. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 F. Bachand, F.-M. Boisvert, J. Cote, S. Richard, and C. Autexier The Product of the Survival of Motor Neuron (SMN) Gene is a Human Telomerase-associated Protein Mol. Biol. Cell, September 1, 2002; 13(9): 3192 - 3202. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 F. Bachand, I. Triki, and C. Autexier Human telomerase RNA-protein interactions Nucleic Acids Res., August 15, 2001; 29(16): 3385 - 3393. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
F. Bachand and C. Autexier Functional Regions of Human Telomerase Reverse Transcriptase and Human Telomerase RNA Required for Telomerase Activity and RNA-Protein Interactions Mol. Cell. Biol., March 1, 2001; 21(5): 1888 - 1897. [Abstract] [Full Text]
|
|
|
|
 |
|
 V. A. Kickhoefer, Y. Liu, L. B. Kong, B. E. Snow, P. L. Stewart, L. Harrington, and L. H. Rome The Telomerase/Vault-Associated Protein Tep1 Is Required for Vault RNA Stability and Its Association with the Vault Particle J. Cell Biol., January 8, 2001; 152(1): 157 - 164. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. P. Ford, J. M. Suh, W. E. Wright, and J. W. Shay Heterogeneous Nuclear Ribonucleoproteins C1 and C2 Associate with the RNA Component of Human Telomerase Mol. Cell. Biol., December 1, 2000; 20(23): 9084 - 9091. [Abstract] [Full Text]
|
|
|
|
|
|
V. M. Tesmer, L. P. Ford, S. E. Holt, B. C. Frank, X. Yi, D. L. Aisner, M. Ouellette, J. W. Shay, and W. E. Wright Two Inactive Fragments of the Integral RNA Cooperate To Assemble Active Telomerase with the Human Protein Catalytic Subunit (hTERT) In Vitro Mol. Cell. Biol., September 1, 1999; 19(9): 6207 - 6216. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. R. Mitchell, J. Cheng, and K. Collins A Box H/ACA Small Nucleolar RNA-Like Domain at the Human Telomerase RNA 3' End Mol. Cell. Biol., January 1, 1999; 19(1): 567 - 576. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. I. Nugent and V. Lundblad The telomerase reverse transcriptase: components and regulation Genes & Dev., April 15, 1998; 12(8): 1073 - 1085. [Full Text]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||