| Nucleic Acids Research | Pages |
Rapid determination and quantitation of the accessibility to native RNAs by antisense oligodeoxynucleotides in murine cell extracts
Introduction
Materials and Methods
Oligodeoxynucleotides
In vitro transcriptions
Preparation of cellular extracts
RNase H digestion of DNA/RNA hybrids with enodogenous RNase H
ODN-RNA mapping with endogenous RNase H and endogenous methyltransferase mRNA
Cell line and culture conditions
ODN transfections
Probe for the RNase protection analysis
RNA isolation and RNase protection analysis
Results
Selection of potential ODN cleavage sites in the MTase mRNA
RNase H cleavage experiments utilizing in vitro transcribed MTase RNA
Determination of accessible sites using endogenous substrate
Intracellular activity of ODN targeted to endogenous MTase mRNA
Discussion
Acknowledgements
References
Rapid determination and quantitation of the accessibility to native RNAs by antisense oligodeoxynucleotides in murine cell extracts
ABSTRACT
INTRODUCTION
Antisense oligodeoxyribonucleotides (ODNs) have been successfully utilized to inhibit expression of a variety of genes (1-3). They show potential promise as therapeutic agents for several diseases, including acute chronic leukemias and restenosis (4). Progress in the design, applications and a summarization of the potential problems of ODNs have been presented in several reviews devoted to antisense ODNs (5-8).
For all ODN therapeutic applications, a principle problem is the identification of accessible regions in the target molecule for base pairing and RNase H activity in cells. Secondary and tertiary structures and association with proteins are the major unknown variables for ODN-mRNA interactions (9,10).
Several approaches have been described to determine the accessibility of a target RNA molecule to antisense or ribozyme inhibitors. One approach uses an in vitro screening assay applying as many antisense ODNs as possible (3). Another utilizes random libraries of antisense ODNs (11-14). The accessible sites can be monitored by RNase H cleavage (13,15), which hydrolyzes the RNA sequences in an RNA/DNA hybrid.
A pool of semi-random, chimeric chemically synthesized ODNs have been used to identify accessible sites cleaved by RNase H on an in vitro synthesized target. Primer extension analyses were used to identify these sites in the target molecule (14). Other approaches for designing antisense targets in RNA are based upon computer assisted folding models for RNA (16,17). Several reports have been published on the use of random ribozyme libraries to screen effective cleavage (18-20).
In this study we have established a straightforward and simplified approach for mapping ODN binding and RNase H cleavage sites. As our target, we have chosen the mRNA encoding murine DNA methyltransferase (MTase). DNA methylation plays a major role in regulating many biological functions, including gene regulation, cellular differentiation, genomic imprinting and long-term silencing of genes during mammalian development, and is implicated in the multistep processes of carcinogenesis (21,22). This makes the MTase an attractive target for antisense inhibition (23).
The majority (60-80%) of CpG dinucleotides in a vertebrate genome are methylated at the N5 position of cytidine, generating a pattern of methylation that is gene- and cell-specific (24). Methylation-silenced genes can be reactivated by demethylation with 5-aza-2[prime]-deoxycytidine, an inhibitor of MTase (25). Reactivation results in changes of cellular phenotypes and provides a rationale for an antisense-based strategy. We chose MTase as a target since we have a long-term interest in regulating MTase expression with ribozymes in transgenic animals. Because MTase mRNA is GC-rich (60-70%), it presents a difficult target for any antisense technology due to many potential secondary structures. As a means of evaluating whether or not antisense oligo molecules can compete with potential structures, we have utilized ODNs in cell extracts to evaluate efficacy in an environment which mimics that of the intact cell.
Using cellular extracts we show that the accessibility of the native RNA transcript to base pairing with antisense oligos and subsequent RNase H cleavage in cell extracts can be used to predict ODN accessibility on the mRNA encoding MTase in vivo.
MATERIALS AND METHODS
Oligodeoxynucleotides
Antisense ODNs and phosphorothioate antisense ODNs were synthesized in the DNA synthesis facility (City of Hope, Duarte, CA). Antisense ODNs used in these studies were as follows: sense control, d(GCAAACAGAAATAAAAAGCCA); scrambled control, d(TCGTGCCCACGGGTCATGTTGT); AS351, d(CCGTTCTCCAAGGACAAATCCTTATT); AS398, d(TCCCGTTGGCGGGACAACCGTTG); AS498, d(GGGTGTCACTGTCCGACTTGCT). The sequences in murine MTase targeted by these sites are depicted in Figure
Figure 1. Secondary structure of a 600 nt long segment of the murine MTase mRNA. Locations of the ODNs are indicated in red. Two ODNs [Rh-ODNM, d(CTCCTTTGATTTCCGCCTCAATG); ODNM, d(GCAAACAGAAATAAAAAGCCA)] were utilized for RT-PCR amplification of a part of the murine MTase gene. Furthermore, two ODNs [Fl-ODN[beta], d(GAAGCAATGCTGTCACCTTCCC); ODN[beta], d(GCGGACTGTTACTGAGCTGCGT)] were used for RT-PCR amplification of the murine [beta]-actin gene. The ODN Rh-ODNM was 5[prime]-end-labeled with rhodamine and the ODN Fl-ODN[beta] was 5[prime]-end-labeled with 6-carboxyfluorescein.
In vitro transcriptions
The plasmid pBluescript-MTase containing the murine MTase cDNA was kindly provided by Michael Reed (Beckman Research Institute, City of Hope, Duarte, CA). For run-off transcriptions, pBluescript-MTase was linearized with SalI, phenol extracted and ethanol precipitated. Run-off transcription was performed in 100 µl of a mixture containing 50 ng/µl linearized plasmid DNA, 40 mM Tris-HCl, pH 7.9, 10 mM dithiotreitol (DTT), 6 mM MgCl2, 2 mM spermidine, 2 U/µl RNase inhibitor (Promega, Madison, WI), 100 µM rNTPs (Boehringer Mannheim, Mannheim, Germany), 2 µCi/µl [[alpha]-32P]UTP (ICN Pharmaceuticals Inc., Irvine, CA) and 2 U/µl T3 RNA polymerase (Promega). After 1 h incubation at 37°C, 25 U RNase-free DNase I (Boehringer Mannheim) was added and the mixture incubated further for 15 min at 37°C. The transcript was purified on a 6% polyacrylamide gel containing 8 M urea, localized by autoradiography and eluted by crushing the gel slices in 0.5 mM ammonium acetate, 1 mM EDTA, 0.2% SDS. After subsequent phenol extraction, the transcript was concentrated by ethanol precipitation. The RNA was dissolved in sterile water, quantified and stored at -20°C.
Preparation of cellular extracts
The cell extracts used in these studies were originally designed for use as a source of endogenous RNA polymerase III as described originally by Weil et al. (26) and Wu (27). Preparation of polymerase III extracts from NIH 3T3 cells growing in log phase was carried out as follows. Approximately 8 × 107 cells were pelleted and washed twice in phosphate-buffered saline. The pellets were resuspended in twice the volume of the cell pellet of hypotonic swelling buffer (7 mM Tris-HCl, pH 7.5, 7 mM KCl, 1 mM MgCl2, 1 mM [beta]-mercaptoethanol) and after 10 min incubation on ice, transferred to a Dounce homogenizer (VWR, San Diego, CA) followed by 20 strokes with a tight pestle B and addition of 1/10th of the final volume of neutralizing buffer (21 mM Tris-HCl, pH 7.5, 116 mM KCl, 3.6 mM MgCl2, 6 mM [beta]-mercaptoethanol). The homogenate was centrifuged at 20 000 g for 10 min at 4°C. The supernatants, which are rich in RNA-binding proteins and RNase H activity and contain endogenous mRNAs, were transferred to an Eppendorf tube on ice and used immediately or stored at -70°C in hypotonic buffer containing 45% glycerol.
RNase H digestion of DNA/RNA hybrids with endogenous RNase H
32P-labeled in vitro transcribed substrate RNA (1 nM) was incubated with different concentrations of antisense ODN (1, 5, 10 and 50 nM; molar ratios 1:1, 1:5, 1:10, 1:50 substrate:ODN). The reactions were carried out in a volume of 10 µl in 40 mM Tris-HCl, pH 7.5, 4 mM MgCl2, 1 mM DTT and 1 µl polymerase III extract containing RNase H activity at 37°C for 1 min. Reactions were stopped with loading buffer and loaded onto a 6% polyacrylamide gel containing 8 M urea. Radioactive bands were analyzed and quantified using a PhosphorImager (Molecular Dynamics, Sunnyvale, CA).
ODN-RNA mapping with endogenous RNase H and endogenous methyltransferase mRNA
The RNase H-mediated cleavage experiments were carried out in a total volume of 30 µl, containing 20 µl polymerase III extract, 1 mM DTT, 20-40 U RNase inhibitor (Promega) and 50 nM each of the various antisense ODNs. The ODNs and RNA were incubated for 5-10 min at 37°C and the mixture was then digested with DNase I for 45 min at 37°C followed by phenol extraction and ethanol precipitation. Reverse transcription was performed according to the manufacturer's protocol (Life Technologies, Grand Island, NY) using 50 ng random hexamer primer and 10 U Moloney murine leukemia virus reverse transcriptase. An aliquot (18 µl) of the RT reaction was amplified using the methyltransferase primersRh-ODNM and ODNM and the remaining aliquot (2 µl) was amplified using the [beta]-actin primers Fl-ODN[beta] and ODN[beta] for 1 min at 94°C, 1 min at 50°C and 2 min at 72°C, for 25-28 cycles in a volume of 50 µl. The [beta]-actin product served as an internal standard as well as loading control. Reaction products were analyzed and quantified on an Applied Biosciences Prism[trade] 377 DNA Sequencer using Genescan analysis software v.2.1 (ABI, Weiterstadt, Germany). For a size marker, the Genescan-2500 TAMARA standard (ABI) with molecular lengths (bp) 827, 536, 490, 470, 361, 286, 269, 238, 233, 222, 186, 172, 116, 109, 94 and 37 was utilized.
Cell line and culture conditions
The NIH 3T3 cell line was maintained in Dulbecco's modified Eagle's medium (DMEM; Irvine Scientific, Santa Ana, CA) supplemented with 10% fetal calf serum (FCS; Irvine Scientific), 1 mM l-glutamine and 100 U/ml penicillin/streptomycin. Cells were grown in a 37°C incubator in an atmosphere containing 5% CO2.
ODN transfections
NIH 3T3 cell were grown to a density of 106 cells/ml in 100 mm dishes in DMEM containing 10% FCS for 24 h. Thereafter, the different fluorescein-labeled antisense phosphorothioate ODNs (0.1 or 1 µM) were transfected using the cationic liposome Lipofectamine[trade] (2 µg/µl; Life Technologies) in Opti-MEM (Life Technologies). After 16 h incubation, the liposome/DNA complexes were removed, DMEM containing 10% FCS was added to the cells and after 8 h cells were transfected again as mentioned above and incubated for another 16 h. Transfected cells were washed with phosphate-buffered saline prior to extracting the RNA. The cellular uptake of the fluorescently labeled ODNs was detected and monitored using a Zeiss Axiovert 135 fluorescence microscope and a DEI-750 video camera from Optronics.
Probe for the RNase protection analysis
To establish a 32P-labeled probe for the RNase protection analysis the plasmid pBluescript-MTase was digested with ApaI and EcoRI (New England Biolabs, Beverly, MA) and a 385 bp DNA fragment containing the region targeted by the antisense ODNs was cloned in the plasmid pBluescript SK II (Stratagene, Heidelberg, Germany). The plasmid was named pBlue-MTaseCOM and was linearized with EcoRI. Run-off transcription was carried out as described above using T7 RNA polymerase (New England Biolabs) and [[alpha]-32P]UTP. The mixture was digested with 25 U DNase I and gel purified as described above. The homogeneity of the 380 nt long 32P-labeled probe was checked by gel electrophoresis.
Murine GAPDH was utilized as internal standard and loading control. The linearized plasmid pTRI-GAPDH template DNA was provided in the Direct Protect[trade] kit (Ambion, Austin, TX). Run-off T7 RNA transcription of this plasmid resulted in a 403 nt long 32P-labeled probe. The homogeneity of this product was also checked by gel electrophoresis. The radioactivity of the probes was measured by scintillation counting (Beckman, Fullerton, CA).
RNA isolation and RNase protection analysis
Total RNAs from NIH 3T3 cells treated with 0.1 or 1.0 µM of the various ODNs were isolated using RNA-STAT-60 solution (Tel-Test B Inc., Friendswood, TX). The RNase protection assay was performed according to the manufacturer's instructions (Direct Protect[trade]; Ambion). Aliquots of 10-15 µg total RNA were combined with 5 × 105 c.p.m. methyltransferase probe and a 1:5 dilution of GAPDH probe (105 c.p.m.). Protected fragments were separated on a 6% polyacrylamide gel containing 8 M urea and quantified using a PhosphorImager.
RESULTS
Selection of potential ODN cleavage sites in the MTase mRNA
Three potential sites for testing ODN accessibility were chosen based upon the criteria that each ODN spanned a potential hammerhead ribozyme cleavage site (NUX, where N = A, C, G or U and X = A, C or U) and each of these sites had a different predicted secondary structure based upon the mFOLD program of Michael Zuker. The three ODNs were all directed to binding sites downstream of the AUG translational initiation codon and are depicted in Figure
RNase H cleavage experiments utilizing in vitro transcribed MTase RNA
As a first test for the accessibility of the three potential ODN sites, a 32P-labeled in vitro transcript comprising the first 1200 nt of murine MTase was probed with each of the antisense ODNs and sense control ODN followed by treatment with either Escherichia coli derived RNase H or a 1:20 dilution of the cell extracts harboring mammalian RNase H activity.
The reactions of the in vitro transcribed substrate with the various ODNs and RNase H preparations were specific and produced the expected cleavage products (Fig.
Figure 2. In vitro cleavage of the MTase transcript with endogenous RNase H. Lane 1, DNA marker; lanes 2-4, 1:10, 1:5 and 1:1 ratios of substrate to ODN AS398 were used; lanes 5-7, 1:10, 1:5 and 1:1 ratios of substrate to ODN AS498 were used; lane 8, 32P-labeled substrate (1200 nt) in the presence of sense control ODN. The cleavage products are of the expected size: ~960 and 230 nt for the ODN AS398 and ~860 and 330 nt for the ODN AS498.
Determination of accessible sites using endogenous substrate
An important question is how realistic are in vitro approaches for predicting the efficiencies of ODNs in vivo? To address this question ODN-directed RNase H cleavage was also studied with a native, endogenous message contained within the cell extracts. Utilization of the endogenous message allows evaluation of RNA accessibility in a protein environment which should mimic that of the intracellular milleux, thereby providing a more rigorous assay for detecting accessible sites on the full-length target for ODNs.
To evaluate the reduction of unlabeled endogenous MTase a quantitative RT-PCR reaction was established using fluorescein/rhodamine-labeled primers. To carry out this assay, the extracts were treated with the various antisense ODNs or a sense control ODN for 5 min at 37°C. This treatment was followed by a DNase I digestion to destroy the antisense and sense ODNs and any residual DNAs in the extract. The remaining RNA was isolated and used as a substrate for reverse transcription and subsequent DNA PCR. The reverse primer used to amplify the MTase mRNA was 5[prime] tagged with rhodamine. The product from RT-PCR amplification of the MTase mRNA is 610 bp in length. [beta]-Actin mRNA, which is abundant in these extracts, served as internal standard and loading control. The primer set used to amplify the murine [beta]-actin mRNA was described previously by McCarrey et al. (28) with the exception that the second strand primer was 5[prime] tagged with fluorescein. PCR amplification of this message generates a product of 445 bp. Aliquots (0.5 µl) from the PCR reactions were electrophoresed in a denaturing polyacrylamide gel. The fluorescein and rhodamine tagged products were quantitated via a Genescan analyses (Fig.
Figure 3. Genescan analysis of RNase H-mediated cleavage of endogenous MTase in cell extract by oligodeoxynucleotides. (A) Isolated NIH 3T3 cell extract was treated with the sense control ODN. An RT-PCR reaction was performed followed by DNA PCR and Genescan analysis. The PCR fragments are of the expected size of ~610 bp (indicated at the top) for the MTase (green peak) and 445 bp for [beta]-actin (blue peak). [beta]-Actin served as internal standard. The red peaks represent the Genescan-2500 TAMARA standard with following molecular lengths (bp): 827, 536, 490, 470, 361, 286, 269, 238, 233, 222, 186, 172, 116, 109, 94 and 37. (B) Isolated NIH 3T3 cell extract treated with the ODN AS498. An RT-PCR reaction was performed followed by DNA PCR and Genescan analysis. The blue peak (445 nt) corresponding to the [beta]-actin PCR product was used to normalize this experiment with the control experiment shown in (A). No green peak corresponding to the 610 nt MTase PCR product was observed. The red peaks are the TAMARA standards described above.
Table 1. 
Oligodeoxynucleotide
Location (nt)
Reduction (%)
Sense (control)
233-254
0
AS351
338-363
20 ± 5
AS398
388-409
50 ± 6
AS498
491-512
85 ± 10
Intracellular activity of ODN targeted to endogenous MTase mRNA
In order to evaluate the relevance of the native message reduction assay with the in vivo application of the antisense ODNs, each of the antisense as well as the control ODNs were transfected into cultured NIH 3T3 cells using a cationic lipid. For these studies, three terminal phosphorothioate groups were added to the 3[prime]-end of the ODNs to increase their intracellular stability. Furthermore, these ODNs were labeled with fluorescein at their 5[prime]-ends to facilitate monitoring of cellular uptake into NIH 3T3 cells. The fluorescein end-labeled phosphorothioate antisense ODNs (0.1 µM) were transiently transfected at two different times into NIH 3T3 cells using the cationic liposome Lipofectamine[trade] as described in Materials and Methods. Visualization of the fluorescently labeled ODN AS498 indicated efficient transfection in NIH 3T3 cells (Fig. Figure 4. Photomicrographs of NIH 3T3 cells transfected with a fluorescently labeled ODN AS498 (0.1 µM). Cells were transfected using Lipofectamine[trade]. (A) Phase contrast photomicrograph of NIH 3T3 cells transfected with ODN 498. (B) NIH 3T3 cells transfected with the ODN AS498 monitored with a fluorescein filter (right) and a combination of both fluorescein and light filters (left). Seventy-two hours after the oligos were transferred into the cells, total RNA was isolated and RNase protection assays were carried out to monitor the effect of the ODNs. A 380 nt long in vitro transcribed RNA probe, complementary to 360 nt of the MTase message and covering the sites targeted by the antisense ODNs, was used in the MTase RNase protection. Murine GAPDH was utilized as an internal standard. For this, the antisense RNA probe was a 403 nt transcript and the RNase-protected fragment is 316 nt long. Figure Figure 5. RNase protection analysis. Samples of 15 µg of total cellular RNA obtained from NIH 3T3 cells treated with 0.1 µM of the various ODNs were mixed with 1 × 105 c.p.m. of the methyltransferase probe and a 1:10 dilution of the GAPDH probe to perform RNase protection assays. (A) Lane 1, DNA marker; lane 2, unprotected internal control GAPDH probe (403 nt); lane 3, unprotected MTase probe (380 nt); lanes 4 and 5, total RNA isolated from NIH 3T3 cells transfected with ODN sense control resulted in a 316 nt long protected GAPDH fragment and in a 360 nt long protected methyltransferase fragment; lanes 6 and 8, RNA isolated from NIH 3T3 cells transfected with the ODN 498 resulted in a 316 nt long protected GAPDH fragment and a 360 nt long protected methyltransferase fragment; lane 7, total RNA isolated from NIH 3T3 cells transfected with ODN AS351. (B) The sense and scrambled ODNs served as negative controls. The percent reductions were derived form the ratios of MTase to GAPDH c.p.m.
DISCUSSION
A major need in the antisense and ribozyme fields is that of a quick and reliable assay for detecting optimal hybridization sites in a target RNA molecule. A number of strategies for increasing the effectiveness of antisense ODNs and ribozymes based upon improved targeting strategies have been published (3,29). In vitro approaches which utilize random or semi-random libraries of antisense ODNs and RNase H seem to be more useful than computer simulations (14,19). Recent observations suggest that annealing interactions of polynucleotides are clearly influenced by RNA binding proteins (30-32). It is therefore important to utilize cellular proteins in assays for elucidating target accessibility and nucleic acid hybrid stability.
Our studies take advantage of easily prepared S20-Pol III cell extracts which provide a relevant protein environment for polymerase III transcription (26,27) and, as we have shown, for studying ODN-target RNA interactions. These extracts are derived from intact cells in which the cellular homogenate is centrifuged at 20 000 g generating a pellet containing mitochondria and large cytoplasmic vesicles and a supernatant with intact polysomal mRNA. In our case, the native MTase message is present in amounts easily detectable by RT-PCR analysis. We find that these cell extracts contain a very potent RNase H activity which greatly facilitates the testing of antisense ODNs. Moreover, preparation of such extracts can be accomplished in a variety of cell types.
The secondary structure predictions for the MTase mRNA (Fig.
The in vivo efficiencies for the antisense ODNs were monitored by RNase protection assays. With antisense ODN AS498 we achieved a significant reduction via this assay, whereas the antisense ODN AS398 resulted in a minor reduction and the ODN AS351 was completely inactive. The observed antisense effects were sequence-specific. Control ODNs with sense or scrambled hybridization arms did not generate a reduction in MTase mRNA.
Our results demonstrate that it is possible to identify accessible hybridization sites in a native mRNA (in this case the MTase mRNA) using the ODN/Pol III extract mapping approach. This same approach has been used for mapping accessible hammerhead ribozyme cleavage sites. The results with the ribozyme mapping show identical cleavage site accessibility with those obtained by oligo mapping (M.Scherr and J.Rossi, unpublished results). Importantly, this ex vivo approach represents a rapid and facile technique for determining effective antisense ODNs.
ACKNOWLEDGEMENTS
The authors thank Hector Riviera for performing the Genescan analysis. We thank Daniela Castanotto and Ingrid Bahner for helpful discussions and Wanda Fitzgerald for expert technical assistance. M.S. was supported by the Fonds der Chemischen Industrie. This work was supported by National Institutes of Health grants AI29329, AI42552 and AI38592 to J.J.R.
REFERENCES
This article has been cited by other articles:
This page is run by Oxford University Press, Great Clarendon Street, Oxford OX2 6DP, as part of the OUP Journals
Comments and feedback: www-admin{at}oup.co.uk
Last modification: 3 Nov 1998
Copyright©Oxford University Press, 1998.
CiteULike 
Connotea 
Del.icio.us What's this?
M. Shiota, M. Sano, M. Miyagishi, and K. Taira
Ribozymes: Applications to Functional Analysis and Gene Discovery
J. Biochem.,
August 1, 2004;
136(2):
133 - 147.
[Abstract]
[Full Text]
[PDF]
A. Zippo, A. De Robertis, M. Bardelli, F. Galvagni, and S. Oliviero
Identification of Flk-1 target genes in vasculogenesis: Pim-1 is required for endothelial and mural cell differentiation in vitro
Blood,
June 15, 2004;
103(12):
4536 - 4544.
[Abstract]
[Full Text]
[PDF]
D. Husken, F. Asselbergs, B. Kinzel, F. Natt, J. Weiler, P. Martin, R. Haner, and J. Hall
mRNA fusion constructs serve in a general cell-based assay to profile oligonucleotide activity
Nucleic Acids Res.,
September 1, 2003;
31(17):
e102 - e102.
[Abstract]
[Full Text]
[PDF]
J. J. Gao, V. Diesl, T. Wittmann, D. C. Morrison, J. L. Ryan, S. N. Vogel, and M. T. Follettie
Regulation of gene expression in mouse macrophages stimulated with bacterial CpG-DNA and lipopolysaccharide
J. Leukoc. Biol.,
December 1, 2002;
72(6):
1234 - 1245.
[Abstract]
[Full Text]
[PDF]
R. M. Smith, C. M. Walton, C. H. Wu, and G. Y. Wu
Secondary Structure and Hybridization Accessibility of Hepatitis C Virus 3'-Terminal Sequences
J. Virol.,
August 28, 2002;
76(19):
9563 - 9574.
[Abstract]
[Full Text]
[PDF]
S. M. Luger, S. G. O'Brien, J. Ratajczak, M. Z. Ratajczak, R. Mick, E. A. Stadtmauer, P. C. Nowell, J. M. Goldman, and A. M. Gewirtz
Oligodeoxynucleotide-mediated inhibition of c-myb gene expression in autografted bone marrow: a pilot study
Blood,
February 15, 2002;
99(4):
1150 - 1158.
[Abstract]
[Full Text]
[PDF]
N. S. LEE, B. SUN, R. WILLIAMSON, N. GUNKEL, P. M. SALVATERRA, and J. J. ROSSI
Functional colocalization of ribozymes and target mRNAs in Drosophila oocytes
FASEB J,
November 1, 2001;
15(13):
2390 - 2400.
[Abstract]
[Full Text]
[PDF]
A. A. Mir, T. J. Lockett, and P. Hendry
Identifying ribozyme-accessible sites using NUH triplet-targeting gapmers
Nucleic Acids Res.,
May 1, 2001;
29(9):
1906 - 1914.
[Abstract]
[Full Text]
[PDF]
M. Amarzguioui, G. Brede, E. Babaie, M. Grotli, B. Sproat, and H. Prydz
Secondary structure prediction and in vitro accessibility of mRNA as tools in the selection of target sites for ribozymes
Nucleic Acids Res.,
November 1, 2000;
28(21):
4113 - 4124.
[Abstract]
[Full Text]
[PDF]
K.-Y. Jen and A. M. Gewirtz
Suppression of Gene Expression by Targeted Disruption of Messenger RNA: Available Options and Current Strategies
Stem Cells,
September 1, 2000;
18(5):
307 - 319.
[Abstract]
[Full Text]
M. Scherr, J. J. Rossi, G. Sczakiel, and V. Patzel
RNA accessibility prediction: a theoretical approach is consistent with experimental studies in cell extracts
Nucleic Acids Res.,
July 1, 2000;
28(13):
2455 - 2461.
[Abstract]
[Full Text]
[PDF]
J. Wrzesinski, M. Legiewicz, and J. Ciesiolka
Mapping of accessible sites for oligonucleotide hybridization on hepatitis delta virus ribozymes
Nucleic Acids Res.,
April 15, 2000;
28(8):
1785 - 1793.
[Abstract]
[Full Text]
[PDF]
This Article 
Abstract
Print PDF (338K)
Alert me when this article is cited
Alert me if a correction is posted
Services
Email this article to a friend
Similar articles in this journal
Similar articles in ISI Web of Science
Similar articles in PubMed
Alert me to new issues of the journal
Add to My Personal Archive
Download to citation manager
Search for citing articles in:
ISI Web of Science (61)
Request Permissions
Commercial Re-use Guidelines
for Open Access NAR Content
Google Scholar
Articles by Scherr, M.
Articles by Rossi, J. J.
Search for Related Content
PubMed
PubMed Citation
Articles by Scherr, M.
Articles by Rossi, J. J.
Social Bookmarking
What's this?