Skip Navigation

This Article
Right arrow Abstract Freely available
Right arrow Print PDF (52K) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (3)
Right arrowRequest Permissions
Right arrow Commercial Re-use Guidelines
for Open Access NAR Content
Google Scholar
Right arrow Articles by Ulmasov, B.
Right arrow Articles by Folk, W. R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ulmasov, B.
Right arrow Articles by Folk, W. R.
Social Bookmarking
Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Nucleic Acids Research Pages 5139-5141  

Identity elements and aminoacylation of plant tRNATrp
Introduction
Materials and Methods
   Preparation of template DNAs and in vitro transcripts
   Aminoacylation of tRNA transcripts
   Translational suppression of firefly luciferase
Results and Discussion
   Identity elements of plant tRNATrp
   tRNATrpCUA is charged with lysine in vitro and encodes lysine in vivo
Acknowledgements
References

Identity elements and aminoacylation of plant tRNA<sup>Trp</sup>

Identity elements and aminoacylation of plant tRNATrp

Barbara Ulmasov, Andrey Topin, Zhihong Chen, S. H. He and William R. Folk*

Department of Biochemistry, University of Missouri-Columbia, 117 Schweitzer Hall, Columbia, MO 65211, USA

Received July 30, 1998; Revised and Accepted September 25, 1998

ABSTRACT

Mutation of the Arabidopsis thaliana tRNATrpCCA anticodon or of the A73 discriminator base greatly diminishes in vitro aminoacylation with tryptophan, indicating the importance of these nucleotides for recognition by the plant tryptophanyl-tRNA synthetase. Mutation of the tRNATrpCCA anticodon to CUA so as to translate amber nonsense codons permits tRNATrpCUA to be aminoacylated by A.thaliana lysyl-tRNA synthetase. Thus, translational suppression by tRNATrpCUA observed in plant cells includes significant incorporation of lysine into protein.

INTRODUCTION

Highly specific interactions between tRNAs and their cognate aminoacyl-tRNA synthetases help ensure the fidelity of translation. tRNAs contain discrete sets of nucleotides (identity elements) required for tRNA recognition by cognate and to prevent recognition by non-cognate aminoacyl-tRNA synthetases (reviewed in 1-3). Considerable progress has been made in determining these identity elements for different tRNAs from Escherichia coli and yeast. Most frequently, they are concentrated within the anticodon loop and/or the acceptor stem, rendering tRNAs into palimpsests of the earliest genetic code (4). However, there are differences in tRNA recognition between species. For example, nonsense amber suppressors derived from tRNATyr are charged with tyrosine in E.coli but with leucine in yeast (5) and suppressors derived from tRNATrpCCA are charged with glutamine in E.coli, but in Saccharomyces cerevisiae there is no change in aminoacylation specificity (6-8). Only sparse evidence is available about identity elements in plant tRNAs (9). Here we document several identity elements of plant tRNATrp and determine that mutation of C35 in the tRNATrpCCA anticodon to form an amber suppressor tRNA promotes misacylation by plant lysyl-tRNA synthetase. Translational suppression by this tRNATrpCUA in plant cells causes the introduction of lysine at amber nonsense codons.

MATERIALS AND METHODS

Preparation of template DNAs and in vitro transcripts

The anticodon of tRNA TrpCCA (10) was changed to CUA (amber), UCA (opal), CCC (Gly) and CCG (Arg) and the discriminator base A73 was changed to G73 by oligonucleotide-directed mutagenesis (Chameleon Mutagenesis Kit, Stratagene). The DNAs were amplified by PCR with a 5[prime] primer including the T7 RNA polymerase promoter sequence d(CAGTAATACGACTCACTATAGGATTCGTCCCGCA) and 3[prime] primer including a BstNI restriction site d(CCCTGGTGAACCCGACGTGAATCG). In vitro transcription of these DNAs after digestion with BstNI yields unmodified tRNA transcripts with a 3[prime]-CCA end (11). The T7 transcript of tRNA LysCUA (12) was produced using the same procedure.

Aminoacylation of tRNA transcripts

In vitro transcripts of tRNAs were prepared using the RiboMax[trade] System (Promega). Aminoacylation of tRNA transcripts was performed at 37°C in an aminoacylation mixture containing 25 mM Tris-HCl, pH 8.0, 1 mM ATP, 2 mM MgCl2, 1 mM spermine, 0.1 mM DTT, amino acids (as specified) and tRNA transcript (as specified).

Translational suppression of firefly luciferase

The preparation and transfection of carrot (Daucus carota) protoplasts were performed as described previously (10). A [beta]-glucuronidase reporter construct was included as an internal standard to normalize transfection efficiency (10). Transfected protoplasts were incubated at room temperature for 24 h, pelleted at 200 g for 15 min, the supernatant was removed and protoplasts were resuspended in 100 µl of cell culture lysis reagent (Promega). An aliquot of 20 µl of cell extract was mixed with 100 µl of luciferase assay reagent (Promega). The reaction mix was placed in a luminometer (model 3010; Analytical Scientific Instruments, Alabama, CA) and counted for 10 s. [beta]-Glucuronidase assays were performed as described by Jefferson (13).

RESULTS AND DISCUSSION

Identity elements of plant tRNATrp

Previously we described the isolation of seven tRNATrp genes from the nuclear genome of Arabidopsis (10,14). All but one of these genes have identical coding regions, with the tRNATrp2CCA gene having a single C->T substitution in position +5 (where +1 is the position of the first nucleotide of the mature tRNA) (14). The anticodon of tRNATrp2CCA was changed by oligonucleotide-directed mutagenesis to CUA (amber), UCA (opal), CCC (Gly) and CCG (Arg) codons and the discriminator base A73 was changed to G73 (Fig. 1).

Using conditions where a tRNATrp2CCA transcript was efficiently aminoacylated with tryptophan, transcripts with single nucleotide substitutions in the anticodon were not detectably aminoacylated (Fig. 2). Thus, as with prokaryotic and yeast tRNATrp, the nucleotides of the plant tRNATrp anticodon are important identity elements (15-19). The tRNATrp1CCA transcript was aminoacylated at a rate only slightly above that observed with the tRNATrp2CCA transcript (data not shown) indicating that the fifth nucleotide of the acceptor stem, which differs between tRNATrp1CCA and tRNATrp2CCA, is only a minor identity element. This is also the case for Bacillus subtilis tRNA TrpCCA (18). The plant tRNA TrpCCA discriminator base is also extremely important for aminoacylation, for mutation of A73 to G73 greatly reduces aminoacylation of the tRNATrp2CCA transcript (Fig. 2). In contrast, G73 is required for aminoacylation by the prokaryotic tryptophanyl-tRNA synthetase (15-17).


Figure 1. Predicted transcripts of tRNATrp1 and tRNATrp2 genes from A.thalianaThe anticodon mutations and the acceptor stem differences are indicated.

Genes encoding tRNATrp2CUA (amber), tRNA TrpCUA(ochre) and tRNA TrpUCA (opal) were introduced into carrot protoplasts together with firefly luciferase reporter genes containing amber, ochre and opal codons, respectively, so as to measure translational suppression. The luciferase amber reporter gene was suppressed by tRNA TrpCUA between 0.5 and 5% in different assays; the level of suppression of the ochre reporter gene by tRNA TrpUUA was always several fold less, and suppression of the opal reporter gene by tRNA TrpUCA was not detected (Fig. 3; 10,21). In light of the undetectable in vitro aminoacylation of these tRNAs by tryptophanyl-tRNA synthetase, the significant capacity of tRNA TrpCUA to suppress amber nonsense mutations could be due to the aminoacylation of these tRNATrp species in vivo by other aminoacyl-tRNA synthetases.

tRNATrpCUA is charged with lysine in vitro and encodes lysine in vivo

Concomitant with these studies, we observed that a luciferase reporter gene (am-206), whose activity relies upon incorporation of Lys at a site important for function (12), was suppressed in vivo as efficiently by tRNA TrpCUA as was a luciferase reporter gene (am-4) with an amber mutation at a site which tolerates a variety of amino acids (10; Fig. 4). This suggests that tRNA TrpCUA might be charged with lysine in vivo. Furthermore, co-transfection of the gene for tRNA TrpCUA with the gene for A.thaliana lysyl-tRNA synthetase increased translational suppression of the reporter gene (Fig. 4), also consistent with the notion that tRNA TrpCUA is charged by the lysyl-tRNA synthetase. (Cloning and expression of the gene for A.thaliana lysyl-tRNA synthetase will be described elsewhere.). In E.coli, tRNA TrpCUA suppressors are charged efficiently with Trp or Gln in vitro and insert predominantly Gln during translation in vivo (6,7), but for S.cerevisiae tRNA TrpCUA, there is no change in aminoacylation specificity (8). To confirm that the plant tRNA TrpCUA is indeed aminoacylated by lysyl-tRNA synthetase, we measured its charging in vitro with purified A.thaliana lysyl-tRNA synthetase. Remarkably, the tRNA TrpCUA transcript was aminoacylated to a 3-fold greater extent than a tRNA LysCUA transcript (Fig. 5), indicating that tRNATrp and tRNALys share features important for recognition. A likely explanation for the observed preference for tRNA TrpCUA is that it contains A73, which we believe to be preferred over G73 by A.thaliana lysyl-tRNA synthetase (A.Topin and W.Folk, unpublished results).


Figure 2. Aminoacylation of tRNATrp2 transcripts with tryptophan. Assays were performed with aminoacylation mixtures containing 30 µM l-[3H]Trp (34 Ci/mmol), wheat germ extract (Promega) and 4 µM tRNA transcript.


Figure 3. Efficiency of nonsense suppression in carrot protoplasts. Protoplasts were transfected with firefly luciferase reporter plasmids together with the respective DNA encoding tRNATrpCUA (amber), tRNATrpUUA (ochre) and tRNATrpUCA (opal) or vector pBluescript KS(+), respectively. Values are the mean percentage of activity relative to the activity of cells transfected with wild-type luciferase reporter plasmids.


Figure 4. Firefly luciferase suppression mediated by tRNATrpCUA. pLUCam DNA was co-transfected into carrot protoplasts with DNAs encoding tRNATrpCUA and the A.thaliana lysyl-tRNA synthetase expressed from the CaMV35S promoter (S.H.He and W.Folk, unpublished results) or with vector DNA and luciferase expression was measured as described in Materials and Methods.


These data demonstrate that the anticodon and the discriminator base A73 are major identity elements of plant tRNATrp, consistent with observations of others that the anticodon of tRNA TrpCCA is phylogenetically conserved as an identity element (15-19) and with the suggestion that the replacement of G73 in prokaryotic tRNATrp by A73 in eukaryotic tRNATrp mirrors evolutionary changes in the specificity of the respective tryptophanyl-tRNA synthetases (18). As sequences in the anticodon-binding domain of the E.coli tryptophanyl-tRNA synthetase that distinguish between C35 and U35 also transmit information to the opposite end of the enzyme so as to modulate amino acid binding (19,20), it would be interesting to determine whether this interaction has been preserved in the plant tryptophanyl-tRNA synthetase, concomitant with the evolutionary change in specificity for the discriminator base. Additionally, we have shown that plant tRNA TrpCUA is charged with lysine in vitro and promotes translation of lysine at amber codons in vivo. This contrasts with observations made using analogous tRNA TrpCUA suppressors in E.coli and yeast, which are charged preferentially by glutamine or tryptophan, respectively (8,15), suggesting that the plant lysyl-tRNA synthetase differs in its specificity for the anticodon nucleotides. A consequence of this is that translational suppression by tRNA TrpCUA observed in plant cells (10,21) includes significant incorporation of lysine into protein


Figure 5. Aminoacylation of tRNATrpCUA or tRNALysCUA by A.thaliana lysyl-tRNA synthetase. Assays were performed in aminoacylation mixtures with 10 µM l-[3H]Lys (10.84 Ci/mmol), 1 µM transcript tRNA and 3800 U purified A.thaliana lysyl-tRNA synthetase. Ordinate indicates aminoacylation observed relative to that obtained with comparable quantities of tRNALysCUU transcripts.

ACKNOWLEDGEMENTS

Support was provided by the US Department of Agriculture and the University of Missouri Food for the 21st Century and Molecular Biology Programs. This is contribution no. 12838 from the Missouri Agricultural Experiment Station Journal Series.

REFERENCES

1. McClain,W.H. (1993) J. Mol. Biol., 234, 257-280. MEDLINE Abstract

2. Saks,M.E., Sampson,J.R. and Abelson,J. (1994) Science, 263, 191-197. MEDLINE Abstract

3. Schimmel,P., Gieget,R., Moras,D. and Yokoyama,S. (1993)Proc. Natl Acad. Sci. USA, 90, 8763-8768. MEDLINE Abstract

4. Rodin,S.N. and Ohno,S. (1997) Proc. Natl Acad. Sci. USA, 94, 5183-5188. MEDLINE Abstract

5. Edwards,H., Trezeguet,V. and Schimmel,P. (1991) Proc. Natl Acad. Sci. USA, 88, 1153-1156. MEDLINE Abstract

6. Knowlton,R.G., Soll,L. and Yarus,M. (1980) J. Mol. Biol., 139, 705-720. MEDLINE Abstract

7. Yaniv,M., Folk,W.R., Berg,P. and Soll,L. (1974) J. Mol. Biol., 86, 245-260. MEDLINE Abstract

8. Yesland,K.D., Nelson,A.W., Six Feathers,D.M. and Johnson,J.D. (1993) J. Biol. Chem., 286, 217-220. MEDLINE Abstract

9. Carneiro,V.T.C., Dietrich,A., Marechal-Drouard,L., Cosset,A., Pelletier,G. and Small,I. (1994) Plant Mol. Biol., 26, 1843-1853.

10. Ulmasov,B. and Folk,W. (1995) Plant Cell, 7, 1723-1734. MEDLINE Abstract

11. Sampson,J.R. and Uhlenbeck,O.C. (1998) Proc. Natl Acad. Sci. USA, 85, 1033-1037.

12. Chen,Z., Ulmasov,B. and Folk,W.R. (1998) Plant Mol. Biol., 36, 163-170. MEDLINE Abstract

13. Jefferson,R.A. (1987) Plant Mol. Biol. Rep., 5, 387-405.

14. Lin,T.Y., March,R., Scanlon,S.R. and Folk,W.R. (1992) Plant Mol. Biol., 10, 159-160. MEDLINE Abstract

15. Rogers,M.J., Adachi,T., Inokuchi,H. and Söll,D. (1992) Proc. Natl Acad. Sci. USA, 89, 3463-3467. MEDLINE Abstract

16. Himeno,H., Hasegawa,T., Asahara,H., Tamura,K. and Shimizu,M. (1991) Nucleic Acids Res., 19, 6379-6382. MEDLINE Abstract

17. Pak,M., Pallanck,L. and Schulman,L.H. (1992) Biochemistry, 31, 3303-3309. MEDLINE Abstract

18. Xue,H., Shen,W., Giege,R. and Wong,J.T.-F. (1993) J. Biol. Chem., 268, 9316-9322. MEDLINE Abstract

19. Yesland,K.D. and Johnson,J.D. (1993) Nucleic Acids Res., 21, 5079-5084. MEDLINE Abstract

20. Franklin,S., Lin,T.Y. and Folk,W. (1992) Plant J., 2, 583-588. MEDLINE Abstract

21. Ibba,M., Hong,K.-W., Sherman,J.M., Sever,S. and Söll,D. (1996)Proc. Natl Acad. Sci. USA, 93, 6953-6958. MEDLINE Abstract

*To whom correspondence should be addressed. Tel: +1 573 882 4845; Fax: +1 573 882 5635; Email: folkw@missouri.edu

This page is run by Oxford University Press, Great Clarendon Street, Oxford OX2 6DP, as part of the OUP Journals
Comments and feedback: www-admin{at}oup.co.uk
Last modification: 3 Nov 1998
Copyright©Oxford University Press, 1998.
Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
 Proc. Natl. Acad. Sci. USAHome page
F. Charriere, S. Helgadottir, E. K. Horn, D. Soll, and A. Schneider
Dual targeting of a single tRNATrp requires two different tryptophanyl-tRNA synthetases in Trypanosoma brucei
PNAS, May 2, 2006; 103(18): 6847 - 6852.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Print PDF (52K) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (3)
Right arrowRequest Permissions
Right arrow Commercial Re-use Guidelines
for Open Access NAR Content
Google Scholar
Right arrow Articles by Ulmasov, B.
Right arrow Articles by Folk, W. R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ulmasov, B.
Right arrow Articles by Folk, W. R.
Social Bookmarking
Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?