| Nucleic Acids Research | Pages |
Reconstitution of DNA topoisomerase VI of the thermophilic archaeon Sulfolobus shibatae from subunits separately overexpressed in Escherichia coli
Introduction
Materials And Methods
Construction of the expression vectors
Expression and purification of the Topo VI B subunit
Expression and purification of the Topo VI A subunit
Assays for DNA topoisomerase activities
Results And Discussion
Expression and purification of the Topo VI B subunit
Expression of the Topo VI A subunit
Purification and renaturation of the S.shibatae Topo VI A subunit
Reconstitution of an active Topo VI from the recombinant A and B subunits
Trapping of the covalent DNA-Topo VI complex by SDS treatment
DNA passage by Topo VI does not require ATP hydrolysis
The Topo VI A subunit had no intrinsic DNA cleavage activity
Acknowledgements
References
Reconstitution of DNA topoisomerase VI ofthe thermophilic archaeon Sulfolobus shibatae from subunits separately overexpressed in Escherichia coli
ABSTRACT
INTRODUCTION
Type II DNA topoisomerases are ubiquitous enzymes that catalyze the ATP-dependent crossing of two DNA duplexes through each other via transient double-strand breaks (1). For a long time, all known type II DNA topoisomerases were thought to form a homologous family with many regions of sequence similarities. Recently, we have discovered a very different form of type II DNA topoisomerases in archaea, which has been termed DNA topoisomerase VI (TopoVI). The amino acid sequences of DNA topoisomerases VI from several archaea are similar to each other but are distinct from the other type II DNA topoisomerases. These results led to the classification of the type II DNA topoisomerases into two evolutionary distinct protein families, the type IIA and the type IIB DNA topoisomerases (2). The type IIA enzymes correspond to the classical type II DNA topoisomerases and are present in all three domains of life. These enzymes carry out functions such as segregation of chromosomes (bacterial Topo IV or eukaryal DNA topoisomerase II) and DNA negative supercoiling (bacterial DNA gyrase) or the removal of positive supercoils. In contrast, the type IIB enzymes have so far been found only in the archaeal kingdom. The prototype of this family, Topo VI, was first isolated from the archaeon Sulfolobus shibatae (3). This enzyme relaxes both positive and negative supercoils in the presence of ATP. It is a heterotetramer composed of two subunits A and B, with apparent molecular masses of 47 and 60 kDa, respectively.
Analysis of the genes encoding the two S.shibatae Topo VI subunits revealed no apparent similarities with the type IIA DNA topoisomerases other than three motifs that are present in the N-terminal region of the Topo VI B subunit as well as in the ATPase domains of the type IIA enzymes. Interestingly, the same three motifs have also been found in the stress-induced proteins of the Hsp90 family and in mismatch repair proteins of the MutL family (2). Crystal structures of complexes between the N-terminal domain of the yeast Hsp90 protein and ATP suggest that the amino acids conserved in these motifs are involved in the binding of ATP (4-6). These data suggest that the Topo VI B subunit carries the ATPase domain and that the three conserved motifs are involved in ATP binding and hydrolysis.
The Topo VIA subunit exhibits no similarity with the type IIA DNA topoisomerases but is a homologue of the proteins Spo11 from Saccharomyces cerevisiae and Rec12 from Schizosaccharomyces pombe (2). The discovery that Spo11 is homologous to the A subunit of a type IIB DNA topoisomerase provided important clues in the elucidation of its cellular role in yeast (2). It turned out that Spo11 is essential in the formation of double-strand breaks that induce meiotic recombination, and that the protein becomes covalently linked at the 5[prime]-ends of the cleaved DNA strands via a phosphotyrosine bond (7). The tyrosine which is essential in Spo11 to catalyze the DNA double-stranded breaks has been identified (2). This tyrosine is the only conserved tyrosine between the sequences of all archaeal TopoVI A subunits and their eukaryal homologues Spo11 and Rec12. These data suggest that the A subunit carries the active-site tyrosyl group that is involved in the DNA breakage and reunion.
A comparison of the type IIA and the type IIB DNA topoisomerases should provide further mechanistic and structural insights on these enzymes. While the type IIA enzymes have been studied extensively in the last 20 years, our knowledge of the type IIB enzymes is minimal. Prerequisite to detailed studies of this new enzyme is to obtain large amounts of purified proteins. The difficulty of large-scale culturing of archaeal cells led us to focus our efforts on the expression of the S.shibatae DNA Topo VI in heterologous hosts. Here we report the purification of the two recombinant subunits of S.shibatae Topo VI from Escherichia coli and the reconstitution of an active, stable enzyme from these purified subunits. Preliminary experiments suggest that the catalytic cycle of the Topo VI shows common features with that of the type IIA topoisomerases. The availability of substantial amounts of the purified proteins opens the way to characterize the two subunits and to carry out further structural and mechanistic studies of the holoenzyme.
MATERIALS AND METHODS
Construction of the expression vectors
The Topo VI A and B subunits were produced separately in E.coli using the pET expression system of Studier et al. (8) purchased from Novagen. The Topo VI A and B subunits coding sequences were amplified by PCR from the recombinant plasmids pUA18 and pUD2 respectively, which carry these genes (2). The Topo VI A subunit was amplified using the primers A1 d(NN[prime]N[prime][prime]TAGGGTGGATAGCATATGAGTTCTGAATTTATATCA) and A2 d(NN[prime]-N[prime][prime]GCGCGCGCGGATCCTTAAGCTATATAATCCTTAT) and cloned in between the NdeI-BamHI sites of pET-25b (these sites in the primers are underlined). In this construction, a stop codon was introduced at the end of the gene before the BamH1 site. The Topo VI B subunit was amplified using the primers B1 d(NN[prime]N[prime][prime]TATAGGGTGTAACACATATGTCTGCTAAAGAAAAG) and B2 d(NN[prime]N[prime][prime]CTTTTGATATAAATTGGATCCTCATTCACTACC-AC). As the Topo VI B subunit coding sequence contains an internal NdeI site, the PCR product was partially digested with NdeI before digestion by BamHI and purification of the NdeI-BamHI fragment containing the entire coding region of the gene. The gel-purified fragment was cloned in between the NdeI-BamHI site of pET3b. The Topo VI A subunit was also cloned in an S.cerevisiae expression vector YEpTOP2-PGAL1, originally constructed for the expression of Yeast DNA topoisomerase II from the inductible GAL1 promoter (9). The region encoding the Topo VI A subunit was first amplified using the primers AN-1 d(NN[prime]N[prime][prime]CGCGCGCggatccCGTAACCATGAGTTCTGAATTTATA) and AC-1 d(NN[prime]N[prime][prime]GCGCGCGCCTCGAGTTAAGCTATATAATCCTTAT), following digestion with BamHI and XhoI (sites underlined in the primer sequences), the fragment was cloned in between the BamH1 and XhoI sites of the vector (a linker had been inserted at the SmaI site of YEpTOP2-PGAL1 to introduce a XhoI site).
Expression and purification of the Topo VI B subunit
LB medium (2 l) containing 100 µg/ml ampicillin and 50 µg/ml chloramphenicol, was inoculated with a saturated overnight culture of BL21::DE3 pLysS (Novagen) carrying the Topo VI B subunit expression plasmid. Cells were grown at 37°C to an apparent A600nm of 0.45, and IPTG was added to a final concentration of 50 µM to induce protein expression. The cells were harvested after 2 h, and 3 g of cell paste were resuspended in 60 ml of extraction buffer (50 mM Tris, pH 7.5, 500 mM NaCl, 1 mM EDTA, 1 mM EGTA and leupeptin and pepstatin at 2 µg/ml of each) and lysed by sonication. Cellular debris and aggregated proteins were removed by centrifugation at 10 000 g for 10 min at 4°C. The supernatant was then heated for 7 min at 80°C in a water bath to denature host proteins that are not thermostable. Denatured proteins were removed by centrifugation at 10 000 g for 10 min. Polyethyleneimine chloride (polymine P), pH 8, was slowly added to a final concentration of 0.3%, and the lysate was stirred for 30 min before centrifugation at 10 000 g for 10 min. The supernatant was precipitated by addition of solid ammonium sulfate to 70% saturation. After centrifugation for 40 min at 14 000 g, the protein pellet was resuspended in buffer A (50 mM Tris, pH 7.5, 1 mM EDTA, 20% ammonium sulfate) and loaded on a 15 ml phenyl-Sepharose column (1.5 cm × 10 cm) pre-equilibrated with buffer A. The column was washed successively with four column volumes of buffer A, 2 vol of buffer B (50 mM Tris, pH 7.5, 1 mM EDTA, 250 mM NaCl), 2 vol of buffer D (50 mM Tris pH 7.5, 1 mM EDTA, 50% ethylene glycol) and then eluted with buffer E (50 mM Tris pH 7.5, 1 mM EDTA, 70% ethylene glycol). Fractions (1 ml) were collected.
Expression and purification of the Topo VI A subunit
LB medium (1 l) containing 100 µg/ml ampicillin, 50 µg/ml kanamycin and 50 µg/ml chloramphenicol was inoculated with a saturated overnight culture of BL21::DE3 pLysS carrying pET25-SSUA, the Topo VI A subunit expression plasmid, and pUB520, the plasmid that contains the dnaY gene encoding for the minor arginyl tRNA that reads AGG and AGA codons. The plasmid pUBS520 was kindly provided by Dr Brinkham (10). Cells were grown at 37°C to an apparent A600nm of 0.9, and IPTG was added to 1 mM to induce protein expression. After 2 h the cells were harvested and resuspended in 25 ml of extraction buffer (50 mM Tris-HCl pH 7.5, 1 mM EDTA, 300 mM NaCl, 1% Triton X-100 and 0.5 mg/ml lysosyme) and incubated for 30 min at 4°C. The cell paste was blended in a rotary homogenizer (Janke and Kunkel, Ultra-Turrax T25) to reduce viscosity. To isolate the inclusion bodies, 75 ml of TE (10 mM Tris-HCl pH 8, 0.1 mM EDTA) and 50 ml of SciI buffer (1% NP-40, 0.5% desoxycholate, 0.5% Triton X-100, 100 mM NaCl, 10 mM Tris-HCl pH 7.5) were added to the blended cell extract before centrifugation(15 min at 15 000 g). The pellet was washed three times with 50 ml of SciII buffer (1 M NaCl, 0.5% Triton X-100) and twice with 20 ml of TE. Between each wash the pellet was centrifuged (10 min at 27 000 g). The pellet was resuspended in 2 ml of 6 M guanidinium chloride and incubated for 2 h at 40°C to resuspend the inclusion bodies and denatured completely the Topo VI A subunit. As the Topo VI A subunit concentration in guanidinium chloride was high (0.5 mg/ml), renaturation was done by a rapid 60-fold dilution into buffer A. The diluted solution was incubated for 2 h at 40°C before centrifugation (30 min at 40 000 g) to pellet aggregated proteins. The supernatant was loaded on a (0.5 cm × 1 cm) phenyl-Sepharose column pre-equilibrated with buffer A. The column was washed as described above for the purification of the Topo VI B subunit, except that the buffer D contained 35 instead of 50% ethylene glycol. The Topo VI A subunit was eluted with buffer E and collected in 0.5 ml fractions.
Assays for DNA topoisomerase activities
Reconstitution of Topo VI. To reconstitute Topo VI activities, 52 µl of the A subunit and 60 µl of the B subunits were mixed in their storage buffer (50 mM Tris-HCl, pH 8, 1 mM EDTA, 70% ethylene glycol). The protein concentrations of the fractions were initially 270 µg/ml (6 µM) for the A subunit and 310 µg/ml (5.2 µM) for the B subunit. These concentrations were estimated from intensities of bands following SDS-PAGE staining with Coomassie Brilliant Blue, using varying amounts of bovine serum albumin as standards. Decatenation of kinetoplast DNA. The ATP-dependent decatenase activity was measured in a standard reaction (20 µl) that contained 35 mM Tris-HCl, pH 7.4 (at 25°C), 0.1 mM Na2EDTA, 10 mM MgCl2, 2 mM DTT, 5 mM spermidine, 1 mM ATP, 0.2 µg kinetoplast DNA and 2 µl of the enzyme sample (diluted in purification buffer E). Reactions were incubated for 5 min at 75°C, then stopped with 50 mM EDTA and analyzed by agarose gel electrophoresis as previously described (3).One unit of S.shibatae Topo VI was defined as the amount of enzyme required to decatenate 0.2 µg of kinetoplast DNA into monomeric rings under standard reaction conditions.
Superhelical DNA relaxation. ATP-dependent DNA relaxation activity was assayed as described above except that the kinetoplast DNA was replaced by 0.3 µg of a 6.7 kb supercoiled plasmid DNA.DNA cleavage assay. Unless stated otherwise, reaction employed 110 nM of TopoVI (220 nM of A subunit and of B subunit) and 6 nM of negatively supercoiled pUC18 DNA in a total of 20 µl of decatenation buffer described above except that 10 mM of calcium was present instead of magnesium. After a 5 min incubation at 75°C, 2 µl of 10% (w/v) SDS were added. The assay was incubated for an additional 5 min at 75°C before adding 5 µl of 10 mg/ml proteinase K. The samples were further incubated for 15 min at 60°C and analyzed by agarose gel electrophoresis.RESULTS AND DISCUSSION
Expression and purification of the Topo VI B subunit
As shown in Figure
Figure 1. Expression and purification of the Topo VI B subunit. Protein fractions were analyzed by 10% SDS-PAGE and stained with Coomassie Brilliant Blue. (A) Expression of the Topo VI B subunit. NI and I were cell extracts before and after 2 h induction by IPTG, respectively. The pellet and the supernatant fractions refer to the insoluble and the soluble fractions from the induced cell extract, respectively. (B) Purification of the Topo VI B subunit. Five µl of each fraction described in Materials and Methods were loaded on the gel. MW, molecular weight standards. Table 1.
Steps
Volume (ml)
A subunita (mg)
Recovery (%)
Overall recovery (%)
Pelletb
4
Inclusion bodies
3.2
1.6
40
40
After renaturation
194
1
66
26.6
phenyl-Sepharose pool
3
0.46
45
12.6
phenyl-Sepharose (fraction 2)c
0.5
0.13
Expression of the Topo VI A subunit
Figure 2. Expression of the Topo VI A subunit in E.coli. The plasmid pET25-SSUA carrying for the Topo VI A subunit gene was induced in the absence or in the presence of the plasmid pUBS520 carrying the gene coding for the minor arginyl tRNA. NI and I were cell extracts without and with induction, respectively. P and S were the insoluble (pellet) and the soluble (supernatant) fractions from the induced cell extract. MW, molecular weight standards. The fractions were analyzed by 10% SDS-PAGE and stained with Coomassie Brilliant Blue. The expression of the Topo VI A subunit turned out to be less straightforward than that of the B subunit. As shown in Figure
Purification and renaturation of the S.shibatae Topo VI A subunit
The inclusion bodies were isolated by centrifugation of the cell extract and washing with a mixture of non-ionic detergents to remove membrane proteins co-precipitated with the insoluble A subunit (Fig. Figure 3. Purification of the Topo VI A subunit from E.coli carrying the pET25-SSUA and the pUBS520 plasmids. The pellet was the insoluble fraction from the cell extract. Inclusion bodies were washed by detergents and resuspended in 6 M guanidinium chloride. The A subunit was renatured by quick dilution. Fraction 2 of the phenyl-Sepharose step was the most concentrated fraction eluted from this column. NI, non induced; I, induced by 1 mM IPTG. MW, molecular weight markers. The fractions were analyzed by 10% SDS-PAGE and stained with Coomassie Brilliant Blue. The Topo VI purified from S.shibatae relaxes supercoiled DNA in the presence of ATP. As shown in Figure Figure 4. ATP-dependent relaxation of negatively supercoiled DNA by the recombinant Topo VI. Reactions were performed as described in Materials and Methods. The amounts of A and B subunits in these assays were 10 and 13.5 ng, respectively. The recombinant Topo VI catalyzed this relaxation reaction only at high temperatures (Fig. The estimated specific activity for the reconstituted DNA topoisomerase VI was 200 U/µg, which is comparable to that of DNA topoisomerase VI purified from S.shibatae, which gave an estimated activity of 300 U/µg (3). A total of three Topo VI A subunit preparations were made. The percentage of renatured A subunit varied from one preparation to the other but the specific activities of the three preparations after complementation by the B subunit were very similar. This suggests that the A subunit recovered by renaturation is fully active. The Topo VI A subunit was expressed at a reasonable level in E.coli only in the presence of the arginyl tRNA capable of reading AGG and AGA codons. However, a very low amount of the A subunit was detectable in the absence of arginyl tRNA, and this protein was partially purified from the E.coli cell extract (result not shown). A decatenation activity was detectable when this preparation was mixed with the Topo VI B subunit, but this activity was observed only after heating the two subunits together for 10 min at 55°C (data not shown). On the contrary, the renatured A subunit prepared in the presence of the arginyl tRNA was complemented by the purified B subunit without heat treatment. It is thus likely that the renatured Topo VI A subunit is better folded than the low amount of soluble A subunit prepared from E.coli in the absence of the arginyl tRNA. As described in Calderone et al. (13) and Forman et al. (14), some arginines might have been substituted by lysines in the A subunit produced in the absence of arginyl tRNA which might lead to improper folding of this protein at 37°C. To transport one DNA duplex through another, the type IIA DNA topoisomerases introduce a transient double-strand break in one of the DNAs. During this double strand cleavage the enzyme involved becomes covalently attached to the cleaved 5[prime]-ends of the DNA via phosphotyrosine bonds (15-19). In vitro, this covalent enzyme-DNA complex can be trapped by rapid addition of a denaturing agent. Similar experiments were carried out with the Topo VI. The DNA-Topo VI complex was formed by incubating 6 nM of negatively supercoiled plasmid DNA with an 18-fold molar excess of recombinant Topo VI at 75°C. The reaction buffer contained 10 mM divalent cations (magnesium or calcium). When DNA and Topo VI were incubated in the absence of ATP or of AMPPNP (Fig. Figure 5. Temperature dependence of the recombinant Topo VI relaxation activity. Reactions were prepared as described in Materials and Methods and incubated for 5 min at different temperatures. The amounts of A and B subunit in these assays were 10 and 13.5 ng, respectively. The assay without Topo VI was incubated at 70°C. In the presence of magnesium ion and ATP or AMPPNP, the formation of the cleavable complex between the DNA and the Topo VI was also revealed by the addition of SDS (Fig. Figure 6. DNA cleavage catalyzed by recombinant Topo VI. DNA cleavage assay is described in Materials and Methods: lane 1, Topo VI was omitted; lanes 2-4, calcium was substituted by magnesium; lanes 3 and 6, 1 mM of ATP was added to the reaction medium; lanes 4, 7 and 8-10, 1 mM of AMPPNP was added to the reaction medium; lanes 8 and 9, the B subunit concentrations were decreased to 110 and 55 nM, respectively; lane 10, the B subunit was omitted; lane 11, linear DNA standard. In the type II A topoisomerase family, the A subunit (or A fragment) that carries the active-site tyrosine needs to interact with the C-terminal half of the B subunit (or the B fragment) to catalyze DNA cleavage. Because the yeast Spo11 protein has been shown to catalyze double-stranded breakage of DNA to initiate meiotic recombination and no homologues of the Topo VI B subunit have been found in the genome of S.cerevisiae, it appeared plausible that Spo11 protein as well as the Topo VI A subunit might have a DNA cleavage activity. We thus checked if S.shibatae Topo VI A subunit alone was able to cleave DNA. The addition of SDS to the complex formed between the A subunit and the plasmid DNA generated no detectable linear DNA (Fig. In summary, catalytically active S.shibatae Topo VI has been reconstituted in vitro from its two subunits separately overexpressed in E.coli. In spite of the sequence divergence of the type IIB DNA topoisomerases from the type IIA DNA topoisomerases, the biochemical properties of the reconstituted enzyme appear to be similar to those of some of the type IIA enzymes. Further structural and mechanistic studies of Topo VI are needed to determine how the type IIB and IIA DNA enzymes are related. The protocols described in this paper should allow the preparation of reasonable amounts of highly purified TopoVI subunits for such studies. Figure 7. Trapping of a tight enzyme-DNA complex. DNA cleavage was performed as described in Materials and Methods but in the presence of 1 mM of AMPPNP: lane 1, Topo VI was omitted; lane 2, the proteinase K treatment was omitted; lane 11, linear DNA standard. Electrophoresis was performed in TBE buffer with 0.1% SDS. We thank Dr U. Brinkham and W. Li for their respective gifts. We thank R. Bennett, C. Declais, C. Elie, S. Knapp, S. Marsin and S. Olland for helpful discussions. We are very grateful to Dr J. Kane for advice on gene expression and M. Swiss for technical assistance. This work was supported by a grant from the Association de la Recherche sur le Cancer (ARC) and an NIH grant GM 24544.
Reconstitution of an active Topo VI from the recombinant A and B subunits
Trapping of the covalent DNA-Topo VI complex by SDS treatment
DNA passage by Topo VI does not require ATP hydrolysis
The Topo VI A subunit had no intrinsic DNA cleavage activity
ACKNOWLEDGEMENTS
REFERENCES
This article has been cited by other articles:
This page is run by Oxford University Press, Great Clarendon Street, Oxford OX2 6DP, as part of the OUP Journals
Comments and feedback: www-admin{at}oup.co.uk
Last modification: 3 Nov 1998
Copyright©Oxford University Press, 1998.
![]()
CiteULike
Connotea
Del.icio.us What's this?
![]()
![]()

![]()
![]()
![]()
G. Fu, J. Wu, W. Liu, D. Zhu, Y. Hu, J. Deng, X.-E. Zhang, L. Bi, and D.-C. Wang
Crystal structure of DNA gyrase B' domain sheds lights on the mechanism for T-segment navigation
Nucleic Acids Res.,
September 1, 2009;
37(17):
5908 - 5916.
[Abstract]
[Full Text]
[PDF]
![]()
![]()
![]()

![]()
![]()
![]()
J. Roca
Topoisomerase II: a fitted mechanism for the chromatin landscape
Nucleic Acids Res.,
February 1, 2009;
37(3):
721 - 730.
[Abstract]
[Full Text]
[PDF]
![]()
![]()
![]()

![]()
![]()
![]()
V. M. Kramlinger and H. Hiasa
The "GyrA-box" Is Required for the Ability of DNA Gyrase to Wrap DNA and Catalyze the Supercoiling Reaction
J. Biol. Chem.,
February 10, 2006;
281(6):
3738 - 3742.
[Abstract]
[Full Text]
[PDF]
![]()
![]()
![]()

![]()
![]()
![]()
K. Sugimoto-Shirasu, G. R. Roberts, N. J. Stacey, M. C. McCann, A. Maxwell, and K. Roberts
RHL1 is an essential component of the plant DNA topoisomerase VI complex and is required for ploidy-dependent cell growth
PNAS,
December 20, 2005;
102(51):
18736 - 18741.
[Abstract]
[Full Text]
[PDF]
![]()
![]()
![]()

![]()
![]()
![]()
A. Napoli, Y. Zivanovic, C. Bocs, C. Buhler, M. Rossi, P. Forterre, and M. Ciaramella
DNA bending, compaction and negative supercoiling by the architectural protein Sso7d of Sulfolobus solfataricus
Nucleic Acids Res.,
June 15, 2002;
30(12):
2656 - 2662.
[Abstract]
[Full Text]
[PDF]
![]()
![]()
![]()

![]()
![]()
![]()
R. L. Diaz, A. D. Alcid, J. M. Berger, and S. Keeney
Identification of Residues in Yeast Spo11p Critical for Meiotic DNA Double-Strand Break Formation
Mol. Cell. Biol.,
February 15, 2002;
22(4):
1106 - 1115.
[Abstract]
[Full Text]
[PDF]
![]()
![]()
![]()

![]()
![]()
![]()
M. Musfeldt, M. Selig, and P. Schönheit
Acetyl Coenzyme A Synthetase (ADP Forming) from the Hyperthermophilic Archaeon Pyrococcus furiosus: Identification, Cloning, Separate Expression of the Encoding Genes, acdAI and acdBI, in Escherichia coli, and In Vitro Reconstitution of the Active Heterotetrameric Enzyme from Its Recombinant Subunits
J. Bacteriol.,
September 15, 1999;
181(18):
5885 - 5888.
[Abstract]
[Full Text]
![]()
![]()
![]()

![]()
![]()
![]()
C. Buhler, J. H. G. Lebbink, C. Bocs, R. Ladenstein, and P. Forterre
DNA Topoisomerase VI Generates ATP-dependent Double-strand Breaks with Two-nucleotide Overhangs
J. Biol. Chem.,
September 28, 2001;
276(40):
37215 - 37222.
[Abstract]
[Full Text]
[PDF]
![]()
![]()
![]()

![]()
![]()
![]()
A.-C. Declais, J. Marsault, F. Confalonieri, C. B. de La Tour, and M. Duguet
Reverse Gyrase, the Two Domains Intimately Cooperate to Promote Positive Supercoiling
J. Biol. Chem.,
June 23, 2000;
275(26):
19498 - 19504.
[Abstract]
[Full Text]
[PDF]
![]()
This Article ![]()
![]()
Abstract
![]()
Print PDF (113K)
![]()
Alert me when this article is cited
![]()
Alert me if a correction is posted
![]()
Services ![]()
![]()
Email this article to a friend
![]()
Similar articles in this journal
![]()
Similar articles in ISI Web of Science
![]()
Similar articles in PubMed
![]()
Alert me to new issues of the journal
![]()
Add to My Personal Archive
![]()
Download to citation manager
![]()
Search for citing articles in:
ISI Web of Science (33)
![]()
Request Permissions ![]()
Commercial Re-use Guidelines
for Open Access NAR Content
![]()
Google Scholar ![]()
![]()
Articles by Buhler, C.
![]()
Articles by Bergerat, A.
![]()
Search for Related Content
![]()
PubMed ![]()
![]()
PubMed Citation
![]()
Articles by Buhler, C.
![]()
Articles by Bergerat, A.
![]()
Social Bookmarking ![]()
![]()
What's this?