Skip Navigation

This Article
Right arrow Abstract Freely available
Right arrow Print PDF (224K) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (19)
Right arrowRequest Permissions
Right arrow Commercial Re-use Guidelines
for Open Access NAR Content
Google Scholar
Right arrow Articles by Eloranta, J. J.
Right arrow Articles by Weinzierl, R. O.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Eloranta, J. J.
Right arrow Articles by Weinzierl, R. O.
Social Bookmarking
Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Nucleic Acids Research Pages 5562-5567  

In vitro assembly of an archaeal D-L-N RNA polymerase subunit complex reveals a eukaryote-like structural arrangement
Introduction
Materials And Methods
   PCR cloning of the open reading frames encoding RNA polymerase subunits
   Production of recombinant archaeal RNA polymerase subunits
   Two-hybrid assays
Results
   Protein-protein interaction between M.jannaschii subunits D and L
   Cross-interactions between archaeal and yeast RNA polymerase subunits
   Formation of a triple complex with archaeal RNAP subunits D-L-N
Discussion
   Conservation of an RNAP subunit interaction across the evolutionary domain boundary
   Parallels to eukaryotic RNAP subunit interactions
Acknowledgements
References

In vitro assembly of an archaeal D-L-N RNA polymerase subunit complex reveals a eukaryote-like structural arrangement

In vitro assembly of an archaeal D-L-N RNA polymerase subunit complex reveals a eukaryote-like structural arrangement

Jyrki J. Eloranta, Aya Kato, Michelle S. Teng and Robert O. J. Weinzierl*

Department of Biochemistry, Imperial College of Science, Technology and Medicine, Exhibition Road, London SW7 2AY, UK

Received October 7, 1998; Revised and Accepted November 5, 1998

ABSTRACT

Archaeal RNA polymerases (RNAPs) resemble the eukaryotic nuclear RNAPs in complexity, and many of their subunits display a high degree of sequence similarity to their eukaryotic counterparts. Here we describe specific protein-protein contacts present between individual recombinant RNAP subunits from the archaeon Methanococcus jannaschii. Subunits D and L interact specifically with each other in two-hybrid assays. D also interacts under the same conditions with the RPB11 and AC19 subunits from the yeast Saccharomyces cerevisiae, suggesting that essential elements of the binding surface between these proteins have been conserved across the archaeal/eukaryotic evolutionary domain boundary. Interactions between L and RPB3 or AC40 were, however, not detectable. Recombinant D and L subunits associate under in vitro conditions and copurify with each other during size-exclusion chromatography. Addition of an another recombinant subunit (N) to the D-L complex results in the formation of a triple complex. This D-L-N complex resembles the RPB3-RPB11-RPB10 or AC40-AC19-RPB10 complexes in eukaryotic RNAPII and RNAPI/RNAPIII, respectively. Our data provide evidence for a close similarity in the quaternary arrangement of a subset of archaeal and eukaryotic RNA polymerase subunits and the conservation of the protein-protein contacts formed between them.

INTRODUCTION

All organisms are members of one of the three major evolutionary domains: archaea, bacteria and eukaryotes (1). While bacteria and eukaryotes have been extensively studied on the molecular level, relatively little is known about archaea due to the fact that their evolutionary positions, environmental lifestyles and biochemical make-ups have only been gradually revealed over the last couple of decades. Archaea are generally prokaryotic in their appearance, but display many molecular features suggesting that they are evolutionarily more closely related to eukaryotes than to bacteria (2). A striking example illustrating this point is the fundamental resemblance of the archaeal and eukaryotic transcriptional machineries. Archaea use bona fide histones to package their DNA into a nucleosomal arrays (3,4), contain proteins that are structural and functional homologs of the eukaryotic basal transcription factors TBP (5,6) and TFIIB (7), and feature a multisubunit RNA polymerase (RNAP) resembling the enzymes found in eukaryotic nuclei (8). Apart from the obvious importance of archaea in shaping our understanding of the evolution and diversity of life on earth, they could therefore potentially provide us also with simplified model systems for helping us to understand the complex eukaryotic transcriptional machineries (9-11).

The molecular investigation of the archaeal transcriptional machinery is greatly aided by the fact that the entire genomic sequence of the archaeon Methanococcus jannaschii is known (2). Archaeal homologs of most of the known eukaryotic RNAPII subunits can be easily identified by sequence similarity (2). In many cases these homologs are similar in length to their eukaryotic counterparts and share discrete blocks of sequence similarity throughout their entire primary sequence (Fig. 1). The archaeal homologs of the RPB5 and RPB6 RNAP subunits are, however, only a third of the size of the their eukaryotic counterparts, and archaeal counterparts of three other eukaryotic subunits (RPB4, RPB8 and RPB12) seem to be missing altogether (2). The absence of any recognizable homologs of RPB8 and RPB12 is particularly puzzling, because these subunits are known to be present in all three types of eukaryotic nuclear RNAPs and are thought to fulfill an important functional and architectural role in these enzymes (12). So, while the overall high degree of sequence similarity on the primary sequence level suggests that archaeal RNAPs could be `scaled-down' versions of eukaryotic RNAPs, it is also clear that there must be some substantial structural differences due to the absence of particular eukaryote-specific domains and subunits in the archaeal enzymes. A better understanding of the differences and similarities of RNAPs from these distinct evolutionary domains could have important implications for the relevance of archaeal transcription systems for gaining further insights into eukaryotic transcription processes.


Figure 1. Overview of primary sequence homologies between archaeal and eukaryotic RNAP subunits. The 12 RNAPII subunits from S.cerevisae are shown schematically in proportion to their size. Regions displaying >40% sequence identity to archaeal RNAP subunits (M.jannaschii; 2) are shown in black. Note that RPB4, RPB8 and RPB12 do not have any recognizable archaeal counterparts, and RPB5 and RPB6 have N-terminal domains that are eukaryote-specific.

In order to address the question of how far the quaternary arrangements of some of the subunits within archaeal and eukaryotic RNAPs are comparable with each other, we decided to start our investigations by testing the interactions between the archaeal RNAP subunits D, L and N from M.jannaschii. These subunits are the homologs of the yeast RPB3/AC40, RPB11/AC19 and RPB10 subunits, respectively (Fig. 1). RPB3 and RPB11 are specific for RNAPII (13,14), AC40 and AC19 are found exclusively in RNAPI and RNAPIII (15,16), whereas RPB10 is found in all three types of yeast RNAPs (17,18). The formation of specific binary complexes between RPB3/RPB11 and AC40/AC19 has been documented in several eukaryotic systems (19-22; J.J.Eloranta, A.Mata de Urquiza and R.O.J.Weinzierl, unpublished data). Furthermore, genetic and several biochemical studies suggest that RPB10 can specifically associate with the AC40/AC19 (18) and RPB3/RPB11 complexes (23-25). The existence of distinct archaeal homologs of all these proteins offers interesting experimental possibilities to test the specificity of their protein-protein interactions properties and compare their quaternary arrangement directly with their eukaryotic counterparts.

Our study shows that recombinant archaeal D, L and N subunits specifically interact with each other in a manner comparable to the one documented in eukaryotic RNAPs. In addition, the archaeal subunit D is also capable of specifically recognizing the yeast RPB11 and AC19 proteins in the two-hybrid system, hinting at a high degree of evolutionary conservation of some of these interaction surfaces.

MATERIALS AND METHODS

PCR cloning of the open reading frames encoding RNA polymerase subunits

The complete open reading frames of the RNAP subunits investigated in this study were retrieved by PCR from either M.jannaschii or Saccharomyces cerevisiae genomic DNA (Promega). The M.jannaschii template was prepared by extracting a whole-cell suspension of the archaea (obtained from the `Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH') with phenol-chloroform (1:1), followed by ethanol precipitation of the aqueous phase and finally dissolving the DNA in TE (10:1) pH 7.4, at a concentration of 1 mg/ml. An aliquot of 1 µl of DNA was used for PCR reactions. The PCR primers were designed to generate EcoRI or BamHI restriction sites flanking the coding sequence (the sequences of oligonucleotides used as PCR primers are shown in Table 11). The PCR products were subcloned into pGEM-T (Promega) and verified by sequencing to confirm the absence of PCR amplification artefacts.

Table 1. Oligonucleotide primers used for cloning full-length archaeal and yeast RNAP subunits
D N-terminus GAATTCATATGATTACAATCAAAGAAAAGAGAAAG
C-terminus GAATTCATTGTTCAATCATTTCTAACTGTTGTAAG
L N-terminus GAATTCATATGGAGATAAAGATATTGGAGAGGA
C-terminus GAATTCACTTCTTTTCCTTTAGTTCGTCCAGT
N N-terminus GAATTCATATGAGAAACATGATGTTCCCTATTAG
C-terminus GAATTCATAGATATCTCTCGTCATGAGCTAT
yRPB3 N-terminus GGAATTCATATGAGTGAAGAAGGTCCTCAA
C-terminus GGAATTCTACCAAGCATTATCATACCC
yRPB11 N-terminus GGAATTCATATGAATGCTCCAGACAGATTC
C-terminus GGAATTCTCAAAATGCGTCGTCGGCGGC
yAC40 N-terminus GGAATTCATATGTCAAATATTGTGGGTATT
C-terminus GGAATTCATTGGGTAATTGGACAGTT
yAC19 N-terminus GGATCCCATATGACTGAAGACATCGAAC
C-terminus GGATCCTACATGCTCTTGATTTTTTCAGT
The gene-specific sequence portion of each primer is shown in italics and the restriction sites used for most subcloning experiments (EcoRI or BamHI) are underlined. For M.jannaschii subunits D and N, the unusual initiation codons TTG and GTG, respectively, were changed to ATG. All sequences are listed in the conventional 5[prime]->3[prime] orientation.

Production of recombinant archaeal RNA polymerase subunits

The open reading frames of the full-length M.jannaschii RNAP subunits were excised from pGEM-T with EcoRI and ligated to the bacterial expression vectors pGEX2-T (Pharmacia). For production of recombinant proteins, cells hosting the expression constructs in the `sense' orientation were grown at 37°C to midlog phase (A600 [ap] 0.6-0.8), induced with 1 mM IPTG for 3-5 h, spun down and stored at -80°C. The frozen cell pellets containing the recombinant archaeal GST-fusion proteins were resuspended in P100 buffer [100 mM K-acetate, 20 mM Tris-acetate pH 7.9, 7 mM Mg-acetate, 1 mM EDTA, 10% glycerol, 1 mM DTT, 0.1 mM PMSF, 1 mg/ml lysozyme, and 2.5 U/ml benzonase (Merck)], left on ice for 2 h and then sonicated. Soluble fusion proteins present in the supernatant were then immobilized on beads by incubation with glutathione agarose beads at 4°C. Unbound proteins were removed by washes with P100 buffer (without lysozyme/benzonase). Afterwards the fusion proteins were either specifically eluted in the presence of 5 mM glutathione or cleaved from the GST-carrier with thrombin and purified by size exclusion chromatography on a Sephacryl S-100 column (Pharmacia).

Two-hybrid assays

For the two-hybrid assays (26), the open reading frames were subcloned into pGBT9mod and pGAD424mod vectors, the construction of which is described by J.J.Eloranta, A.Mata de Urquiza and R.O.J.Weinzierl (unpublished data). To create the GAL4-domain-fusion constructs, the RNAP coding regions were ligated into the EcoRI (or BamHI in the case of yAC19) sites of the vectors pGBT9mod and pGAD424mod. The plasmids were introduced into the yeast strain SFY526 (Clontech) by simultaneous transformation by the LiAc method. The transformation procedure, filter assays and liquid assays for measuring [beta]-galactosidase activity were performed according to the Clontech `Matchmaker' protocol book. All liquid [beta]-galactosidase assays were done at least in duplicate and the averages of the obtained values are shown (individual measurements differed <10% from each other). The signals obtained were consistently in close agreement with the intensity of X-Gal staining in yeast colony assays (J.J.Eloranta and R.O.J.Weinzierl, data not shown).

RESULTS

Protein-protein interaction between M.jannaschii subunits D and L

The interactions between the eukaryotic subunits RPB3 and RPB11 in RNAPII and their homologous subunits in RNAPI and RNAPIII (AC40 and AC19, respectively) have been documented in several eukaryotic systems (19-22; J.J.Eloranta, A.Mata de Urquiza and R.O.J.Weinzierl, unpublished data). We therefore started to investigate whether the archaeal homologs of these proteins, subunits D and L, display similar interaction properties. We cloned the open reading frames of RNAP subunits D and L from M.jannaschii into the appropriate vectors for the production of GAL4 DNA-binding domain (DBD) and acidic activation domain (AAD) fusion proteins and transfected them in various pairwise combinations into yeast host cells (26). Under these assay conditions a signal indicating a specific heterodimeric interaction between the D and L subunits can be seen in both possible combinations (Fig. 2). Having established the interaction using this in vivo assay, we next wanted to confirm the interaction under in vitro conditions using purified recombinant proteins. A schematic flowchart illustrating the chosen assembly sequence is shown in Figure 3A. Briefly, an immobilized GST-fusion protein containing subunit D was allowed to interact with purified subunit L. After incubation and removal of excess subunit L, subunit D was cleaved in situ from the GST-carrier protein. If D and L form a specific complex, the released D subunit should remain associated with L under these conditions and the two proteins would be expected to copurify with each other during subsequent biochemical fractionation procedures. The D and L subunits differ in size almost by a factor of two from each (D, 21.7 kDa; L, 11.4 kDa), and elute in distinct and separate fractions from a Sephacryl S-100 column (Fig. 3C; J.J.Eloranta and R.O.J.Weinzierl, unpublished observations). Analysis of the D-L complex assembled as described above shows that a substantial proportion of the L subunit does indeed copurify with D (Fig. 3B) during size-exclusion chromatography, suggesting a specific and stable association between these proteins. Addition of excess recombinant L subunit to the complex illustrates that any uncomplexed L elutes in a very distinct position behind the D peak and is thus clearly separable form the D-L complex (Fig. 3C). Separate experiments also prove that the D-L complex remains stably associated under elevated ionic strength conditions (300 mM potassium acetate), and size-exclusion chromatography of purified L subunit in the absence of D does not reveal any evidence for the presence of faster-eluting aggregates or other multimers (data not shown).


Figure 2. Yeast two-hybrid assay of the archaeal subunit D-L interaction. The [beta]-galactosidase activity resulting from various combinations of constructs is shown (relative to the p53/large T antigen interaction, which is considered to be 100%). Subunits D and L interact with each other in both possible vector combinations (DBD, GAL4 DNA-binding domain fusion; AAD, acidic activation domain fusion).


Figure 3. In vitro assembly of an archaeal D-L dimeric complex. (A) A GST-fusion protein containing recombinant subunit D is immobilized on glutathione agarose beads and incubated with purified subunit L. After thrombin cleavage the D-L complex is released from the solid support. (B) Size-exclusion chromatography of a D-L complex prepared with limiting amounts of subunit L. The released D-L complex assembled as described above is shown next to the molecular sizemarker (SM) lane. Despite its small size, all detectable L cofractionates with subunit D, indicating a specific association between the two proteins (fractions containing D-L complex are indicated with a black horizontal bar). (C) Size-exclusion chromatography of a D-L complex prepared with excess subunit L. The majority of L protein is not associated with D and runs closer to the void volume of the column. Both gels shown in (B) and (C) were stained with Coomassie Blue.

Cross-interactions between archaeal and yeast RNA polymerase subunits

Having succeeded in identifying a specific interaction between recombinant D and L subunits from M.jannaschii, we next examined whether the archaeal subunits could interact with their counterparts in yeast, RPB3/AC40 and RPB11/AC19. The high degree of primary sequence conservation between the archaeal and corresponding eukaryotic subunits suggests that the interaction surfaces could be sufficiently similar for such an experiment to succeed, even though the protein interaction partners are derived from organisms that are classified in different evolutionary domains. We thus performed two-hybrid experiments where one putative interaction partner was from M.jannaschii and the other one from yeast. Our results showed that in addition to its native partner L, the archaeal subunit D is indeed capable of interacting with either yRPB11 or yAC19 in various reciprocal combinations of interaction partners (Fig. 4). The conservation of protein-protein interactions across the evolutionary domain boundary between archaea and eukaryotes is, however, not complete. We could not detect any interaction between the archaeal subunit L and either yRPB3 or yAC40 in the two-hybrid assay (data not shown)


Figure 4. Specific protein-protein interactions between archaeal and eukaryotic RNAP subunits based on two-hybrid assays. Various results involving both eukaryotic and archaeal interactions, together with selected negative controls, are shown. As in Figure 2, the interaction between p53 and large T antigen was used as an internal standard and set at 100%. The results indicate a specific interaction between DBD-AC19 and AAD-D (line 3; 15%) as compared to DBD-AC19 against AAD only (line 2; 0.6%). The interaction between DBD-RPB11 and AAD-D is even more clearly pronounced (lane 5; 111%), as compared to the control experiment (line 4; 1.6%). The interactions are reciprocal, as shown by the signals obtained between DBD-D and either AAD-AC19 (line 6; 19%) or AAD-RPB11 (line 7; 96%; see line 2 in Fig. 2 for the DBD-D/AAD-only negative control). A range of similar experiments involving various combinations of eukaryotic RPB3/AC40 fusions with archaeal subunit L fusions did not reveal any signals about background level (J.J.Eloranta and R.O.J.Weinzierl, data not shown; see Discussion for possible explanation).

Formation of a triple complex with archaeal RNAP subunits D-L-N

The data presented above indicate that the protein interactions between the archaeal subunits D and L are in strict accordance with the data obtained with their eukaryotic homologs and that it is also possible, at least in some instances, to form heterodimeric complexes between archaeal and eukaryotic RNAP subunits. We therefore tried to determine whether another predicted subunit interaction, originally inferred from studying eukaryotic RNAPs, could be directly transferred to our archaeal RNAP model system. Genetic studies using extragenic mutants that suppress defects in the AC40 and AC19 genes in S.cerevisiae identified RPB10 as a possible interaction partner for the AC40/AC19 complex (18). RPB10 is one of the five subunits that is shared between all three nuclear yeast RNAPs (17) and a highly conserved homolog (`subunit N') is encoded by the M.jannaschii genomic sequence (2).

A bacterial GST-fusion protein expression system yielded sufficient amounts of the archaeal subunit N in soluble form to attempt the in vitro assembly of a triple complex consisting of recombinant D, L and N proteins. We started out by assembling the D-L complex as described earlier and purified an apparently near-stoichimetric D-L complex by size-exclusion chromatography. After mixing an ~10-fold molar excess of recombinant subunit N with the purified D-L complex and concentrating it by ultrafiltration, we analyzed the resulting products by size-exclusion chromatography. Gel electrophoretic analysis of the proteins present in the elution fractions suggests the formation of a triple D-L-N complex (Fig. 5A). Repeated size-exclusion chromatography of the fractions containing the D-L-N complex proves that this complex, once formed, remains stable for at least a month at +4°C and elutes consistently as a homogeneous and symmetrical peak containing all three subunits in a fixed ratio (Fig. 5B). Results from a densitometric analysis of a Coomassie Blue-stained gel of the purified D-L-N complex suggests an equimolar stoichiometry of the three subunits (data not shown), which is compatible with the stoichiometry data obtained from purified endogenous archaeal RNAPs (27).


Figure 5. In vitro assembly of an archaeal D-L-N triple complex. (A) A dimeric D-L complex was further incubated with purified recombinant subunit N and analyzed by size-exclusion chromatography. Note the presence of all three proteins in fractions 34-39, whereas fraction 43-45 contains predominantly a dimeric complex between D and N (Coomassie Blue-stained gel). The position where an internal marker [bovine serum albumin (BSA); 68 kDa] elutes from the column is indicated with a white box. (B) Size-exclusion chromatography of combined fractions 34-39 reveals a symmetrically-eluting peak consisting essentially of a cofractionating D-L-N subunit. The lower intensity of subunit N in this gel is due to the fact that protein N stains less efficiently with silver than L.

Close inspection of the later-eluting proteins in Figure 5A also reveals the presence of a complex containing subunits D and N, but not L, indicating that subunit N can directly interact with subunit D, even in the absence of subunit L. We have confirmed this observation in separate experiments which demonstrate a direct interaction between D and N that does not require the presence of L (Fig. 6).


Figure 6. A direct in vitro interaction between subunit D and N. Recombinant subunit D was cleaved with thrombin from a GST-D fusion protein immobilized on glutathione beads and incubated with excess purified subunit N. The resulting mixture was analyzed by size exclusion chromatography. Gel electrophoretic analysis and of the various fractions show the formation of a specific D-N complex. Note that the excess N protein elutes as a specific peak after the D-N containing fractions (Coomassie Blue-stained gel).

DISCUSSION

Conservation of an RNAP subunit interaction across the evolutionary domain boundary

Our study of protein-protein interactions between three archaeal RNAP subunits has provided insights into the structure of archaeal and eukaryotic RNAPs. By showing that an RPB3-RPB11-like interaction exists between recombinant archaeal D and L subunits, we have demonstrated that this particular protein-protein interaction is highly conserved and must already have existed before the divergence of the archaeal and eukaryotic evolutionary domains. Our results are in agreement with a report describing the electrophoretic separation of an endogenous D-L subcomplex from purified Sulfolobus acidocaldarius RNAP (27). Taken together, these finding are especially significant in the light of the fact that RPB3 and RPB11 contain localized regions of sequence homology to the bacterial [alpha] RNAP subunit and could therefore play a comparable role in the assembly of eukaryotic RNAPs (28). In our previous studies we noted a high degree of type-specificity between the protein interactions of RPB3/RPB11 and AC40/AC19, suggesting that these subunits could have a decisive influence on determining the type-specificity during the early stages of the assembly of eukaryotic RNAPs. According to this view, the RPB3/11 complex would be responsible for the recruitment of both general and RNAPII-specific subunits, wheras the AC40/AC19 complex would channel the various subunits into a RNAPI/RNAPIII assembly pathway (J.J.Eloranta, A.Mata de Urquiza and R.O.J.Weinzierl, unpublished data). In contrast to eukaryotic cells, archaea contain only a single type of RNAP and the D-L complex therefore does not need to encode type-specificity in the same way as its eukaryotic counterparts RPB3-RPB11 and AC40-AC19. This raises several interesting questions, including whether D and L are sufficiently conserved to interact with their eukaryotic counterparts, and if yes, whether there are any detectable differences in the specificity of the interaction with the RNAPII-subunits RPB3/RPB11 and the RNAPI/RNAPIII subunits AC40/AC19. Our results show that the archaeal D subunit is indeed capable of specific interactions with both RPB11 and AC19 in the yeast two-hybrid system. Thus, many of the key amino acid residues involved in this particular protein-protein interaction must have remained essentially invariant after the divergence of the archaeal and eukaryotic evolutionary domains. The archaeal D subunit does not, however, display the same degree of type-specificity that the yAC40 and yRPB3 do in their interactions with the yeast AC19 and RPB11 subunits, respectively. It is likely that the D subunit found in contemporary archaea is similar to the evolutionary precursor that gave rise to the eukaryotic RPB3 and AC40 subunits. The gene encoding such a RPB3/AC40 precursor could have been duplicated during the early stages of eukaryotic evolution, and subsequent diversification of each copy could have played a major role in the establishment of the type-specificity necessary for the assembly of three distinct nuclear RNAPs found in all eukaryotic species. We also found that the ability of the archaeal and eukaryotic subunits to recognize their interaction partners across the evolutionary domain boundary is not completely symmetrical, since the archaeal L subunit is not capable of interacting with either yRPB3 or yAC40 under the same experimental conditions. A possible solution to this enigma emerges from NMR studies of recombinant yeast RPB11 and archaeal L (J.J.Eloranta, R.O.J.Weinzierl and S.Matthews, unpublished observations) which show that these proteins are relatively unstructured in solution, suggesting that they may be strongly dependent on their interaction partners (yRPB3 and subunit D, respectively) to induce a suitable fold for a stable protein-protein interaction. We therefore speculate that the lack of interaction of L with either yRPB3 or yAC40 could be due to the fact that the eukaryotic interaction partners somehow fail to initiate a correct restructuring of the archaeal L subunit.

Parallels to eukaryotic RNAP subunit interactions

The D-L subunit interaction provides direct evidence that the quaternary arrangements of subunits in archaeal RNAPs is likely to reflect, at least in broad outline, the subunit interactions in eukaryotic RNAPs. Our additional observation, that the archaeal RPB10 homolog (subunit N) can either stably associate with either subunit D alone or with the D-L binary complex, extends this important point one step further. Genetic studies have indirectly indicated that yRPB10 could be associated with the yAC40/yAC19 complex (18) and recent biochemical studies, based on the controlled dissociation of endogenous RNAPII from Schizosaccharomyces pombe, also suggest that RPB3 and RPB11 are in tight contact with RPB10 (23). Our results show that a comparable situation prevails in archaeal RNAPs. A similar direct interaction between yRPB10 and yRPB3/yAC40 is thought to exist in eukaryotic systems. The genetic data obtained by Lalo et al. (18) in S.cerevisiae is consistent with such an interpretation and `GST-pulldown' assays with human RNAPII subunits have revealed a specific interaction between hRPB3 and hRPB10, whereas no signal was detectable between hRPB10 and hRPB11 (23). A similar conclusion was reached by Ishiguro et al., using a crosslinking approach to study the subunit arrangement in native S.pombe RNAPII (25).

In summary, we succeeded in the in vitro assembly of a biochemically-defined subcomplex of archaeal RNAP that mirrors the known subunit interactions present in the eukaryotic RPB3/RPB10/RPB11 and AC40/AC19/RPB10 complexes. This archaeal D-L-N complex will provide us with a suitable platform for the incorporation of other recombinant archaeal RNAP subunits to study protein-protein contacts and the functional properties of such partial RNAP assemblies. A detailed knowledge of the quaternary arrangement of archeal subunits will be valuable for testing the various proposed models of RNAP structure (23,25) and reveal the structural similarities and differences between enzymes separated by at least one billion years of evolutionary divergence (1,2).

ACKNOWLEDGEMENTS

We wish to thank Miki Nakanishi for her participation in parts of the described experimental work. This work was supported by MRC project grant G9517777MB to R.O.J.W.

REFERENCES

1. Woese,C.R., Kandler,O. and Wheelis,M.L. (1990) Proc. Natl Acad. Sci. USA, 87, 4576-4579. MEDLINE Abstract

2. Bult,C.J., White,O., Olsen,G.J., Zhou,L., Fleischmann,R.D, Sutton,G.G., Blake,J.A., FitzGerald,L.M., Clayton,R.A., Gocayne,J.D., Kerlavage,A.R., Dougherty,B.A., Tomb,J.F., Adams,M.D., Reich,C.I., Overbeek,R., Kirkness,E.F., Weinstock,K.G., Merrick,J.M., Glodek,A., Scott,J.L., Geohagen,N.S.M. and Venter,J.C. (1996) Science, 273, 1058-1073. MEDLINE Abstract

3. Sandman,K., Kryzycki,J.A., Dobrinski,B., Lurz,R. and Reeve,J.N. (1990) Proc. Natl Acad. Sci. USA, 97, 5788-5791. MEDLINE Abstract

4. Starich,M.R., Sandman,K., Reeve,J.N. and Summers,M.F. (1996) J. Mol. Biol., 255, 187-203. MEDLINE Abstract

5. Marsh,T.L., Reich,C.I., Whitelock,R.B. and Olsen,G.J. (1994) Proc. Natl Acad. Sci. USA, 91, 4180-4184. MEDLINE Abstract

6. Rowlands,T., Baumeister,P. and Jackson,S.P. (1994) Science, 264, 1326-1329. MEDLINE Abstract

7. Qureshi,S.A. and Jackson,S.P. (1998) Mol. Cell., 1, 389-400. MEDLINE Abstract

8. Zillig,W., Stetter,K.O. and Janekowic,D. (1979) Eur. J. Biochem., 96, 597-604. MEDLINE Abstract

9. Zillig,W., Palm,P., Klenk,H.-P., Langer,D., Hudepohl,U., Hain,J., Lanzendorfer,M. and Holz,I. (1993). In Kates,M., Kushner,D.J. and Matheson,A.T. (eds), The Biochemistry of Archaea (Archaebacteria). Elsevier, Amsterdam.

10. Baumann,P., Qureshi,S.A. and Jackson,S. (1995) Trends Genet., 11, 279-283. MEDLINE Abstract

11. Langer,D., Hain,J., Thuriaux,P. and Zillig,W. (1995) Proc. Natl Acad. Sci. USA, 92, 5768-5772. MEDLINE Abstract

12. Woychik,N.A., Liao,S.-M., Kolodziej,P.A. and Young,R.A. (1990) Genes Dev., 4, 313-323. MEDLINE Abstract

13. Kolodziej,P. and Young,R. (1989) Mol. Cell Biol., 9, 5387-5394. MEDLINE Abstract

14. Woychik,N.A., McKune,K., Lane,W.S. and Young,R.A. (1993) Gene Expression, 3, 77-82. MEDLINE Abstract

15. Mann,C., Buhler,J.-M., Treich,I. and Sentenac,A. (1987) Cell, 48, 627-637. MEDLINE Abstract

16. Deqart-Chablat,M., Riva,M., Carles,C. and Sentenac,A. (1991) J. Biol. Chem., 266, 15300-15307.

17. Woychik,N.A. and Young,R.A. (1993) J. Biol. Chem., 265, 17816-17819.

18. Lalo,D., Carles,C., Sentenac,A. and Thuriaux,P. (1993) Proc. Natl Acad. Sci. USA, 90, 5524-5528. MEDLINE Abstract

19. Ulmasov,T., Larkin,R.M. and Guilfoyle,T.J. (1996) J. Biol. Chem., 271, 5085-5094. MEDLINE Abstract

20. Larkin,R.M. and Guilfoyle,T.J. (1997) J. Biol. Chem., 272, 12824-12830. MEDLINE Abstract

21. Korobko,I.V., Yamamoto,K., Nogi,Y. and Muramatsu,M. (1997) Gene, 185, 1-4. MEDLINE Abstract

22. Fanciulli,M., Bruno,T., Di Padova,M., De Angelis,R., Lovari,S., Floridi,A. and Passananti,C. (1998) FEBS Lett., 427, 236-240. MEDLINE Abstract

23. Acker,J., de Graaff,M., Cheynel,I., Khazak,V., Kedinger,C. and Vigneron,M. (1997) J. Biol. Chem., 272, 16815-16821. MEDLINE Abstract

24. Kimura,M., Ishiguro,A. and Ishihama,A. (1997) J. Biol. Chem., 272, 25851-25855. MEDLINE Abstract

25. Ishiguro,A., Kimura,M., Yasui,K., Iwata,A., Ueda,S. and Ishihama,A. (1998) J. Mol. Biol., 279, 703-712. MEDLINE Abstract

26. Fields,S. and Song,O. (1989) Nature, 340, 245-246. MEDLINE Abstract

27. Lanzendorfer,M., Langer,D., Hain,J., Klenk,H.-P., Holz,I., Arnoldhammer,I. and Zillig,W. (1994) System. Appl. Microbiol., 16, 656-664.

28. Zhang,G. and Darst,S.A. (1998) Science, 281, 262-266. MEDLINE Abstract

*To whom correspondence should be addressed. Tel: +44 171 594 5236; Fax: +44 171 225 0960; Email: r.weinzierl@ic.ac.uk

This page is run by Oxford University Press, Great Clarendon Street, Oxford OX2 6DP, as part of the OUP Journals
Comments and feedback: www-admin{at}oup.co.uk
Last modification: 3 Dec 1998
Copyright©Oxford University Press, 1998.
Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
 J. Biol. Chem.Home page
B. Goede, S. Naji, O. von Kampen, K. Ilg, and M. Thomm
Protein-Protein Interactions in the Archaeal Transcriptional Machinery: BINDING STUDIES OF ISOLATED RNA POLYMERASE SUBUNITS AND TRANSCRIPTION FACTORS
J. Biol. Chem., October 13, 2006; 281(41): 30581 - 30592.
[Abstract] [Full Text] [PDF]

Home page
 Genome ResHome page
A. A. Best, H. G. Morrison, A. G. McArthur, M. L. Sogin, and G. J. Olsen
Evolution of Eukaryotic Transcription: Insights From the Genome of Giardia lamblia
Genome Res., August 1, 2004; 14(8): 1537 - 1547.
[Abstract] [Full Text] [PDF]

Home page
 Proc. Natl. Acad. Sci. USAHome page
L. Minakhin, S. Bhagat, A. Brunning, E. A. Campbell, S. A. Darst, R. H. Ebright, and K. Severinov
Bacterial RNA polymerase subunit omega and eukaryotic RNA polymerase subunit RPB6 are sequence, structural, and functional homologs and promote RNA polymerase assembly
PNAS, January 30, 2001; 98(3): 892 - 897.
[Abstract] [Full Text] [PDF]

Home page
 Nucleic Acids ResHome page
F. Werner, J. J. Eloranta, and R. O. J. Weinzierl
Archaeal RNA polymerase subunits F and P are bona fide homologs of eukaryotic RPB4 and RPB12
Nucleic Acids Res., November 1, 2000; 28(21): 4299 - 4305.
[Abstract] [Full Text] [PDF]

Home page
 Proc. Natl. Acad. Sci. USAHome page
F. Todone, R. O. J. Weinzierl, P. Brick, and S. Onesti
Crystal structure of RPB5, a universal eukaryotic RNA polymerase subunit and transcription factor interaction target
PNAS, June 6, 2000; 97(12): 6306 - 6310.
[Abstract] [Full Text] [PDF]

Home page
 Proc. Natl. Acad. Sci. USAHome page
A. Yee, V. Booth, A. Dharamsi, A. Engel, A. M. Edwards, and C. H. Arrowsmith
Solution structure of the RNA polymerase subunit RPB5 from Methanobacteriumthermoautotrophicum
PNAS, June 6, 2000; 97(12): 6311 - 6315.
[Abstract] [Full Text] [PDF]

Home page
 Proc. Natl. Acad. Sci. USAHome page
C. D. Mackereth, C. H. Arrowsmith, A. M. Edwards, and L. P. McIntosh
Zinc-bundle structure of the essential RNA polymerase subunit RPB10 from Methanobacteriumthermoautotrophicum
PNAS, June 6, 2000; 97(12): 6316 - 6321.
[Abstract] [Full Text] [PDF]

Home page
 J. Bacteriol.Home page
T. J. Darcy, W. Hausner, D. E. Awery, A. M. Edwards, M. Thomm, and J. N. Reeve
Methanobacterium thermoautotrophicum RNA Polymerase and Transcription In Vitro
J. Bacteriol., July 15, 1999; 181(14): 4424 - 4429.
[Abstract] [Full Text]

Home page
 Proc. Natl. Acad. Sci. USAHome page
A. Flores, J.-F. Briand, O. Gadal, J.-C. Andrau, L. Rubbi, V. Van Mullem, C. Boschiero, M. Goussot, C. Marck, C. Carles, et al.
A protein-protein interaction map of yeast RNA polymerase III
PNAS, July 6, 1999; 96(14): 7815 - 7820.
[Abstract] [Full Text] [PDF]

Home page
 J. Bacteriol.Home page
J. N. Reeve
Archaebacteria Then ... Archaes Now (Are There Really No Archaeal Pathogens?)
J. Bacteriol., June 15, 1999; 181(12): 3613 - 3617.
[Full Text]

This Article
Right arrow Abstract Freely available
Right arrow Print PDF (224K) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (19)
Right arrowRequest Permissions
Right arrow Commercial Re-use Guidelines
for Open Access NAR Content
Google Scholar
Right arrow Articles by Eloranta, J. J.
Right arrow Articles by Weinzierl, R. O.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Eloranta, J. J.
Right arrow Articles by Weinzierl, R. O.
Social Bookmarking
Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?