| Nucleic Acids Research | Pages |
Biochemical and genetic characterization of the DNA ligase encoded by Saccharomyces cerevisiae open reading frame YOR005c, a homolog of mammalian DNA ligase IV
Introduction
Materials And Methods
Expression plasmid constructs
In vitro transcription and translation
Bacterial and yeast strains
Construction and verification of dnl4 mutant strains
Partial purification and assay of Cdc9 and Dnl4 from yeast
Analysis of cell viability and morphology
Sporulation and ascospore analysis
Results
The polypeptide encoded by YOR005c is a DNA ligase
The open reading frame, YOR005c, encodes the activity previously designated as S.cerevisiae DNA ligase II
Inactivation of the DNL4 gene does not confer sensitivity to DNA damaging agents
Inactivation of DNL4 causes temperature-sensitive growth
Inactivation of the DNL4 gene has no effect on sporulation
Discussion
Acknowledgements
References
Biochemical and genetic characterization of the DNA ligase encoded by Saccharomyces cerevisiae open reading frame YOR005c, a homolog of mammalian DNA ligase IV
ABSTRACT
INTRODUCTION
Three mammalian genes encoding DNA ligases, LIG1, LIG3 and LIG4, have been identified (reviewed in 1). The enzymes encoded by the LIG1 and LIG3 genes were characterized prior to cloning of the genes (2-6). In contrast, the LIG4 gene was isolated before DNA ligase IV activity had been detected (6,7). Although these enzymes are responsible for the DNA joining steps in the pathways of DNA replication, DNA repair and genetic recombination that occur in mammalian cells, the cellular functions of each of the DNA ligases have not been definitively established. There is substantial experimental evidence demonstrating that DNA ligase I is the enzyme that joins Okazaki fragments during DNA replication (8-11). However, the sensitivity of both DNA ligase I- (8,12) and DNA ligase III-deficient cell lines (13,14) to alkylating agents indicates that the DNA ligases may play distinct roles in the cellular responses to DNA damage.
The Saccharomyces cerevisiae CDC9 gene, which encodes a DNA ligase, was initially identified in a screen for conditional lethal cell division cycle mutants (15). Subsequently, it was demonstrated that cdc9 mutants exhibit hypersensitivity to a wide range of DNA damaging agents and hyper-recombination (16-19). Based on amino acid sequence homology, the polypeptide encoded by the CDC9 gene is most similar to human DNA ligase I, suggesting that these enzymes may be functionally equivalent (1,5). In agreement with this notion, mammalian DNA ligase I and Cdc9 DNA ligase have the same polynucleotide substrate specificity (20) and cDNAs encoding human DNA ligase I complement the conditional lethal phenotype of an S.cerevisiae cdc9 mutant (5).
Until recently it had been assumed that Cdc9 DNA ligase was the only species of DNA ligase in S.cerevisiae. However, the partial purification and characterization of a yeast DNA ligase activity, DNA ligase II, which is biochemically and immunologically distinct from Cdc9 DNA ligase (21) and the identification of an open reading frame, YOR005c, in the yeast genome that contains motifs which are conserved in ATP-dependent DNA ligases suggests that yeast cells also contain more than one species of DNA ligase (21-24). Here, we demonstrate that DNA ligase II is encoded by YOR005c. Given the homology between the amino acid sequences of YOR005c and mammalian DNA ligase IV (21-24), the open reading frame will be referred to as DNL4 and the enzyme activity will be renamed Dnl4.
MATERIALS AND METHODS
Expression plasmid constructs
The YOR005c (DNL4) ORF was amplified by the PCR (25) from yeast genomic DNA, using Pfu polymerase and primers [sense, d(CGGGATCCATGATATCAGCACTAGATTCTATA); antisense, d(AACTGCAGTTAAATGCTGTTCAGATATTGCTT)] that anneal across the YOR005c ORF translation start and stop codons (bold), respectively. The underlined BamHI and PstI restriction sites were added to facilitate subcloning of the PCR product. After purification using a Qiaquick PCR Purification Kit (Qiagen), the PCR product was digested with BamHI and PstI and subcloned into pBluescript IIKS (Stratagene). The nucleotide sequences at the ends of the PCR fragment were confirmed by double-strand DNA sequencing prior to subcloning in-frame into the Escherichia coli expression vectors pGSTag (26) and pQE30 (Qiagen), to produce GST and poly(histidine) fusion proteins, respectively. In addition, the YOR005c (DNL4) ORF was subcloned into the yeast expression vector pTB326 to produce the plasmid pWR-YOR005c, in which the ORF is expressed from the ADH promoter.
In vitro transcription and translation
Coupled in vitro transcription and translation reactions were performed with the TNT Coupled Reticulocyte Lysate System (Promega) using [35S]methionine as recommended by the manufacturer. Labeled polypeptides were partially purified by ammonium sulfate precipitation as described (27).
Bacterial and yeast strains
The temperature-sensitive, ligase-defective E.coli strain AK76 lig ts7 was provided by Francis Barany (Cornell University Medical College). The congenic S.cerevisiae strains, M1-2B and L94-4D (Table 1), were supplied by Lee Johnston (National Institute of Medical Research, UK).
Construction and verification of dnl4 mutant strains
The DNL4 gene (YOR005c) was inactivated in several different yeast strains (Table 1) using the one-step gene disruption technique (28). Sense [d(GCCAAGCTTCGGTGGTCGAGTGTTCTT)] and antisense [d(CGGAAGCTTTATCGTGATGAGCAAGAAGGGA)] primers, which anneal 1 kb upstream of the YOR005c ORF translation start codon and 1 kb downstream of the stop codon, respectively, were used to amplify YOR005c (DNL4 gene) and flanking regions of DNA from the genome of the S.cerevisiae strain M1-2B by PCR. The underlined HindIII restriction sites were added to facilitate subcloning of the PCR product into the HindIII site of pBluescript IIKS. The S.cerevisiae URA3 gene was amplified from the plasmid pYES2 (Invitrogen) by PCR with the following primers: sense, d(ACCTCCGGACTCATCTTTGACAGCTTATCATCG) (underlined BspEI site); antisense, primer d(TCGCAGCTGCCCGGCGTCAATACGGGATAAT) (underlined PvuII site). To construct a dnl4::URA3 null allele, the 600 bp BspEI-Eco47III fragment of the YOR005c ORF, which encodes the putative adenylation site of the DNA ligase (1), was replaced by blunt end ligation of the 1.1 kb BspE1-PvuII PCR fragment that encodes the URA3 gene. The resultant plasmid, pdnl4::URA3, was digested with HindIII to release the dnl4::URA3 null allele with flanking DNA sequences to direct targeted gene replacement at the DNL4 locus by homologous recombination during yeast transformation. The genomic structure of URA3+ colonies that grew on drop-out medium lacking uracil was analyzed by Southern blotting (29) and/or PCR to identify strains in which the DNL4 gene had been replaced by the dnl4::URA3 null allele. Tetrad analysis of the transformants in two related strain backgrounds, `SideX[Delta]' and `SideY[Delta]' (Table 1), demonstrated single gene segregation for the disrupted dnl4::URA3 null allele. In addition, the observed genetic segregation of the dnl4::URA3 null allele in both genetic backgrounds was confirmed physically by Southern blotting analysis of the tetrad products. The identical phenotypic and genetic behavior of the dnl4::URA3 null allele in the multiply backcrossed hybrid, CG2706, compared with the primary disruptant hybrid, CG2596, demonstrates the single gene inheritance of the dnl4::URA3 null allele and the absence of phenotypic or sporulation modifiers in these transformed strains.
Table 1.
| M1-2B | MAT[alpha] ura3 trp1 |
| WR-1 | M1-2B dnl4::URA3 |
| WR-2 | M1-2B dnl4::URA3 |
| WR-3 | M1-2B dnl4::URA3 |
| L94-4D | MAT[alpha] cdc9-7 ura3 trp1 |
| WR-4 | L94-4D dnl4::URA3 |
| CG2582 | MATa Side X[Delta] |
| CG2568 | MAT[alpha] dnl4::URA3 Side X[Delta] |
| CG2573 | a/[alpha] HO SideX[Delta]/SideX[Delta] dnl4::URA3/dnl4::URA3 |
| CG2579 | a/[alpha] HO SideY[Delta]/SideY[Delta] dnl4::URA3/dnl4::URA3 |
| CG2583 | a/[alpha] HO SideX[Delta]/SideX[Delta] DNL4/DNL4 |
| CG2584 | a/[alpha] HO SideY[Delta]/SideY[Delta] DNL4/DNL4 |
| CG2595 | a/[alpha] ho SideX[Delta]/SideY[Delta] dnl4::URA3/dnl4::URA3 |
| CG2596 | a/[alpha] ho SideX[Delta]/SideY[Delta] dnl4::URA3/dnl4::URA3 |
| CG2597 | a/[alpha] ho SideX[Delta]/SideY[Delta] dnl4::URA3/DNL4 |
| CG2706 | a/[alpha] ho SideX[Delta]/SideY[Delta] dnl4::URA3/dnl4::URA3, multiply backcrossed |
Partial purification and assay of Cdc9 and Dnl4 from yeast
Yeast cells from a 1 l culture were harvested and resuspended in 50 mM Tris-HCl (pH 7.5), 0.75 M NaCl, 10 mM 2-mercapto-ethanol, 1 mM KPO4 and a cocktail of protease inhibitors (20). A clarified lysate, which was prepared as described previously (20), was applied to a hydroxyapatite column. Bound proteins were eluted stepwise with 50, 200 and 400 mM KPO4 (pH 7.5) buffers, each containing 0.5 mM DTT and protease inhibitors. Protein in the eluates was quantitated by the method of Bradford (30). Fractions in each of the eluates that contained significant levels of protein were pooled and dialyzed against 50 mM Tris-HCl (pH 7.5), 50 mM NaCl, 1 mM EDTA, 0.5 mM DTT, 50% glycerol and protease inhibitors prior to storage at -20°C. Assays to detect formation of labeled enzyme-adenylate complexes were carried out as described previously (21). After separation by SDS-PAGE (31), labeled polypeptides were detected by autoradiography.
Analysis of cell viability and morphology
Overnight cultures, which were grown in the appropriate drop-out medium at 30°C, were diluted 1:50 in the same medium and then incubated at 37°C. At the indicated time intervals, aliquots (100 µl) were removed to determine the cell cycle distribution and viability. For the cell cycle distribution analysis, at least 1000 cells were classified as single cells, single cells with small buds, single cells with large buds or single cells with multiple small buds after visualization by light microscopy (400× magnification). To determine cell viability, cells in aliquots from the liquid cultures were counted under the light microscope (cells with one or more buds were counted as a single cell), diluted and then plated on the appropriate drop-out agar plates. After incubation at 30°C for 4-5 days, colonies were counted.
Sporulation and ascospore analysis
Frozen stocks of diploid strains were streaked directly onto a YPAD plate and incubated at 30°C for 2 days to form single colonies. Four independent colonies of each strain were patched onto a YPAD plate, incubated overnight at 30°C, replica plated to supplemented sporulation medium and incubated for 5 days at 30°C to allow completion of sporulation. Sporulation data obtained from the four independent colonies of each strain were examined for quantitative variation and pooled for subsequent analysis. Sporulated strains were examined by phase contrast light microscopy (320×) to assay the efficiency of sporulation, as calculated by the percent of the total population which formed phase bright, morphologically well-defined asci. To assay meiotic progression, the quality of sporulation (r) was calculated as the ratio of one and two spore asci (diagnostic for incomplete meiotic progression) to three and four spore asci (diagnostic for successful meiotic progression).
Viability of sporulation products was determined by micromanipulation and tetrad dissection on a YPAD plate followed by incubation for 3 days at 30°C to allow spore clone colony formation. For tetrad dissection, a loop of sporulated cells was incubated in 4% glusulase (NEN) for 4-5 min at 30°C to digest the ascal sac and to release the tetrad for micromanipulation on a Zeiss Tetrad Dissection Microscope (160×). Only complete four spore asci were chosen for dissection and viability analysis. To assay proper meiotic chromosome recombination and segregation, the viability pattern of dissected tetrads was determined and compared with the calculated wild-type pattern assuming random spore death.
RESULTS
The polypeptide encoded by YOR005c is a DNA ligase
ATP-dependent DNA ligases interact with ATP to form a covalent enzyme-AMP complex (1) in which the AMP moiety is linked to a lysine residue within a motif, KXDGXR, that is diagnostic for ATP-dependent DNA ligases (1). Searches of the S.cerevisiae genome with this motif identified the CDC9 gene, as expected, and also a second open reading frame, YOR005c. The 944 amino acid polypeptide encoded by YOR005c contains other regions that exhibit homology with amino acid sequences conserved in the catalytic domain of eukaryotic DNA ligases and is most similar to human DNA ligase IV. Notably, the amino acid homology between the polypeptides encoded by YOR005c and the human LIG4 gene is not restricted to the catalytic domain and in fact extends over the entire linear amino acid sequences (data not shown).
Although the E.coli DNA ligase utilizes NAD+ as a co-factor (1), expression of ATP-dependent DNA ligases such as human DNA ligase I (32) and human DNA ligase III (Fig.
Figure 1. Effect of expression of the putative DNA ligase encoded by YOR005c (DNL4) on the temperature-sensitive phenotype of an E.coli lig mutant. The temperature-sensitive, ligase-defective E.coli strain AK76 lig ts7 transformed with the empty vector (pGSTag) and plasmids encoding GST-YOR005c (pGST-YOR005c) and GST-human DNA ligase III[beta] (pGST-hLigIII). Overnight cultures were streaked out on LB-AMP plates containing 2 mM IPTG. (A) Incubation overnight at 30°C. (B) Incubation at 30°C for 2 h and then at 42°C overnight. In a previous study we described the partial purification and characterization of a 90 kDa DNA ligase that we designated DNA ligase II, since it had different biochemical properties than Cdc9 DNA ligase and was not recognized by a Cdc9 antiserum (21). Although the predicted molecular weight of the polypeptide encoded by YOR005c is 104 000, a major labeled 90 kDa polypeptide was produced after in vitro transcription and translation of several independent isolates of YOR005c that were subcloned after PCR amplification from yeast genomic DNA. The electrophoretic mobility of the polypeptide labeled by in vitro translation of one such recombinant plasmid is shown in Figure Figure 2. Size of the polypeptide encoded by YOR005c: effects of disruption and overexpression of YOR005c (DNL4) on yeast DNA ligase activities. (A) Coupled in vitro transcription and translation reactions were carried out with 2 µg of plasmid as described in Materials and Methods. Lane 1, pBluescript; lane 2, pBluescript-YOR005c (DNL4). (B) Yeast cell extracts were fractionated by hydroxyapatite chromatography as described in Materials and Methods. Proteins (10 µg) in the 200 and 400 mM KPO4 eluates from the hydroxyapatite column were assayed for the ability to form labeled polypeptide-AMP complexes. Lane 1, M1-2B 200 mM KPO4 eluate; lane 2, M1-2B 400 mM KPO4 eluate; lane 3, WR-1 dnl4::URA3 200 mM KPO4 eluate; lane 4, WR-1 dnl4::URA3 400 mM KPO4 eluate; lane 5, WR-1 dnl4::URA3 pWR-YOR005c (DNL4) 200 mM KPO4 eluate; lane 6, WR-1 dnl4::URA3 pWR-YOR005c (DNL4) 400 mM KPO4 eluate. After denaturing gel electrophoresis, labeled polypeptides were detected in the dried gels by autoradiography. The positions of 14C-labeled molecular mass standards (Amersham) are indicated on the left. To investigate the relationship between DNA ligase II and the DNA ligase encoded by YOR005c, we disrupted YOR005c in the haploid yeast strain M1-2B by homologous recombination. After fractionation of cell lysates by hydroxyapatite chromatography, we measured the levels of DNA ligase using an assay which monitors the formation of a labeled covalent enzyme-adenylate complex. In agreement with our previous study (21), the M1-2B extract contained two species of DNA ligase that could be resolved by hydroxyapatite chromatography (Fig. The viability of the WR-1 dnl4::URA3 strain described above demonstrates that DNL4 is not an essential gene. Furthermore, a dnl4::URA3 cdc9-7 strain is viable even though extracts from the cdc9-7 strain grown at the permissive temperature have no detectable DNA ligase activity (5). Inactivation of the DNL4 gene in either a CDC9 or cdc9 genetic background does not increase sensitivity to killing by UV radiation or methylmethane sulfate (data not shown), indicating that the DNL4 gene is not required for the repair of DNA damage that is recognized by the major DNA repair pathways operating in yeast. In S.cerevisiae, the repair of DNA double-strand breaks occurs predominantly by a homologous recombination pathway that involves products of genes in the RAD52 epistasis group. A pathway for the repair of DNA double-strand breaks by a non-homologous end joining (NHEJ) mechanism does exist in yeast cells and can be measured by recircularization of linearized plasmid molecules (33-35). Disruption of the DNL4 gene reduced the transformation efficiency with linearized plasmid DNA compared with an isogenic wild-type strain 15- to 20-fold (data not shown), in agreement with previous reports (22-24). This deficiency presumably reflects an inability to recircularize the linear plasmid molecules by a NHEJ mechanism and implies that the product of the DNL4 gene is required for the NHEJ pathway in yeast. During the experiments described above it became apparent that the WR-1 strain grew more slowly in liquid media compared with its isogenic parental strain. Results similar to those shown in Figure
Figure 3. Effects of inactivation of the DNL4 gene on cell growth. (A) Overnight cultures of WR-1 dnl4::URA3 (filled-in squares) and its parental strain M1-2B (open squares) were diluted to 5 × 105 cells/ml with the appropriate selective medium and then incubated at 30°C. Proliferation was monitored by measuring absorbance at 600 nm. (B) Overnight cultures of WR-1 dnl4::URA3 ([Delta]DNL4) and its parental strain M1-2B (WT) containing either the empty vector (pTB326) or the recombinant plasmid (pWR-YOR005c), in which YOR005c (DNL4) is expressed from an ADH promoter, were streaked onto drop-out plates lacking tryptophan. The plates were incubated for 4-5 days at 30 or 37°C as indicated. Table 2. To further examine the temperature-sensitive growth phenotype, WR-1 cells growing exponentially in liquid medium at 30°C were transferred to 37°C and, at various time intervals, plated on solid medium. The viability of the WR-1 dnl4::URA3 cells decreased progressively with time. After 24 h at 37°C, only 34% of the cells were able to form colonies. In contrast, 90% of the cells from the isogenic parental strain were able to form colonies after 24 h at 37°C. Introduction of a plasmid expressing the DNL4 gene from a constitutively active ADH promoter markedly improved the viability of the dnl4::URA3 strain to 65% after 24 h at 37°C (data not shown). Next we examined the morphology of the yeast cells before and after the temperature shift by phase contrast microscopy. At 30°C, the WR-1 dnl4::URA3 strain exhibited a small reduction in the percentage of cells with large buds and a small increase in the percentage of single cells compared with the isogenic parental strain (Table 2). After 24 h at 37°C, the cell cycle distribution in cultures of the M1-2B and WR-1 dnl4::URA3 strains were dramatically different (Table 2). Notably, 25% of the dnl4::URA3 cell population were large cells that appeared to have more than one bud. Examples of this abnormal cell morphology are shown in Figure The DNA content of the dnl4::URA3 cells that had been incubated for 24 h at 37°C was examined by DAPI staining. The majority of the putative buds on multiply budded cells contained DNA (Fig. Figure 4. Analysis of the terminal morphology of WR-1 dnl4::URA3 cells at the non-permissive temperature by fluorescence light microscopy. An overnight culture of WR-1 cells grown at 30°C on drop-out medium lacking tryptophan was diluted 1:50 in the same medium and then incubated at 37°C for 24 h. Aliquots (25 µl) were removed from the culture and diluted with 1 ml of deionized water. Cells were harvested, washed and then resuspended in 100 µl of deionized water. After the addition of 4[prime],6-diamino-2-phenolindole propidium iodide (DAPI) (5 µl of a 1 µg/ml solution), the suspension was incubated for 15 min at room temperature. Cells were harvested, washed twice with 1 ml of deionized water and then resuspended in 20 µl of deionized water. (A) Phase contrast microscopy (magnification 800×); (B) the same field visualized by epifluorescence using a Zeiss fluorescence microscope. Cell morphology was not altered by the DAPI staining protocol. Inactivation of the yeast homologs that encode subunits of the heterodimeric DNA binding complex Ku also results in temperature-sensitive growth (33,34,36,37). In addition to participating in the NHEJ pathway, Ku is implicated in the maintenance of telomeres (33,34). Thus, it is possible that the growth defect in these strains is due to telomere shortening rather than a defect in NHEJ. The length of telomeres in cells from the WR-1 dnl4::URA3 strain and its parental strain M1-2B were measured by hybridization of XhoI-digested genomic DNA with a labeled poly(GT)20 probe (33). Since inactivation of the DNL4 gene had no significant effect on telomere length (data not shown), we conclude that the temperature-sensitive growth of the WR-1 dnl4::URA3 strain is not a consequence of progressive telomere shortening. Table 3. 
The open reading frame, YOR005c, encodes the activity previously designated as S.cerevisiae DNA ligase II
Inactivation of the DNL4 gene does not confer sensitivity to DNA damaging agents
Inactivation of DNL4 causes temperature-sensitive growth
A
B
Cell morphology
Cells with large buds (%)
Single cells (%)
Cells with small buds (%)
Cells with multiple buds (%)
M1-2B
30°C
8 h
41
29
30
0
37°C
2 h
40
39
21
0
8 h
45
33
22
0
24 h
15
60
25
<1
M1-2B dnl4::URA3
30°C
8 h
35
34
30
1
37°C
2 h
45
36
18
1
8 h
35
40
20
5
24 h
5
45
25
25
M1-2B dnl4::URA3 pWR-YOR005c
f
30°C
8 h
40
30
30
0
37°C
2 h
40
39
20
1
8 h
38
37
24
1
24 h
15
62
22
1
Strain
Relevant genotype
No. of cells scored
Sporulation efficiency (%)
Sporulation quality (r)
CG2573
SideX[Delta]/SideX[Delta] dnl4/dnl4
3100
88.6
0.06
CG2579
SideY[Delta]/SideY[Delta] dnl4/dnl4
2100
89.6
0.08
CG2595
SideX[Delta]/SideY[Delta] dnl4/dnl4
800
90.3
0.04
CG2596
SideX[Delta]/SideY[Delta] dnl4/dnl4
800
88.5
0.07
CG2706
SideX[Delta]/SideY[Delta] dnl4/dnl4
1400
93.1
0.05
Subtotal
dnl4
8200
89.8
0.06
CG2597
SideX[Delta]/SideY[Delta] dnl4/DNL4
800
87.0
0.06
CG2583
SideX[Delta]/SideX[Delta] DNL4/DNL4
1100
86.8
0.07
CG2584
SideY[Delta]/SideY[Delta] DNL4/DNL4
2400
87.2
0.08
Subtotal
DNL4
4300
87.1
0.07
Table 4.
| Strain | Relevant genotype | No. of tetrads | Spore viability (%) | Tetrad class (viable:inviable) | ||||
| 4:0 | 3:1 | 2:2 | 1:3 | 0:4 | ||||
| CG2573 | SideX[Delta]/SideX[Delta] dnl4/dnl4 | 120 | 94.0 | 97 | 18 | 4 | 1 | 0 |
| CG2579 | SideY[Delta]/SideY[Delta] dnl4/dnl4 | 24 | 90 | 16 | 6 | 2 | 0 | 0 |
| Subtotal | dnl4 observed | 144 | 93.4 | 113 | 24 | 6 | 1 | 0 |
| Theoretical random tetrad class distribution | 110 | 31 | 3 | 0 | 0 | |||
| CG2583 | SideX[Delta]/SideX[Delta] DNL4/DNL4 | 120 | 91.5 | 92 | 16 | 11 | 1 | 0 |
| CG2584 | SideY[Delta]/SideY[Delta] DNL4/DNL4 | 24 | 90 | 16 | 6 | 2 | 0 | 0 |
| Subtotal | DNL4 observed | 144 | 91.1 | 108 | 22 | 13 | 1 | 0 |
| Theoretical random tetrad class distribution | 99 | 39 | 6 | 0 | 0 | |||
Inactivation of the DNL4 gene has no effect on sporulation
The elevated levels of LIG4 gene expression in human testis (6) suggests that DNA ligase IV may be involved in germ cell differentiation. Since yeast sporulation is functionally equivalent to gametogenesis in mammals, we have disrupted the DNL4 gene in two different yeast strains and compared the sporulation behavior of these strains with isogenic parental strains. Inactivation of the DNL4 gene had no significant effect on the efficiency or quality of sporulation (Table 3). Furthermore, we observed no difference in spore viability in either of the dnl4::URA3 mutant strains compared with their isogenic wild-type parental strains (Table 4). These data demonstrate that normal meiotic chromosome behavior does not require the DNL4 gene product.
Because disruption of the DNL4 gene in the M1-2B genetic background (but not in the strain backgrounds used in the sporulation studies) results in temperature-sensitive vegetative growth, sporulation was examined at 35°C. The sporulation behavior of each of the dnl4::URA3 strains was indistinguishable from that of its isogenic parental strain at the higher temperature (data not shown). In contrast to these results, it has been reported previously that dnl4 mutants exhibit a delay during meiosis I, reduced sporulation efficiency and an increase in the proportion of inviable spores (22). Since the correction of this meiotic phenotype by reintroduction of the wild-type DNL4 gene was not demonstrated, we suggest that the relatively subtle defects in sporulation previously ascribed to loss of Dnl4 activity (22) are more likely caused by secondary mutations introduced during disruption of the DNL4 gene.
DISCUSSION
Previously we partially purified and characterized a DNA ligase activity from S.cerevisiae extracts that was distinct from Cdc9 DNA ligase (21). At the same time we reported that an open reading frame, YOR005c, which was identified during sequencing of the S.cerevisiae genome, exhibited homology with other eukaryotic DNA ligases, in particular human DNA ligase IV. To confirm that YOR005c does encode a DNA ligase, we have shown that expression of this polypeptide complements the temperature-sensitive phenotype of an E.coli lig mutant. To determine the relationship between YOR005c and the previously described yeast DNA ligase activities (20,21), the open reading frame was disrupted. This had no effect on Cdc9 DNA ligase but resulted in the loss of the activity that we originally designated DNA ligase II (21). Furthermore, this enzyme activity was restored by the introduction of a plasmid containing YOR005c into the dnl4::URA3 mutant strain. Thus, we conclude that DNA ligase II activity is encoded by YOR005c and, because of the homology between YOR005c and human LIG4, we now refer to YOR005c as DNL4 and the enzyme activity as Dnl4.
Disruption of the DNL4 gene does not confer significant cellular sensitivity to DNA damage, indicating that this gene product does not play a critical role in the major DNA repair pathways operating in yeast. However, in the absence of Dnl4 activity, the cells exhibit a marked defect in the ability to recircularize transfected linear plasmid DNA molecules. These results are similar to those reported by other laboratories (22,24) and are consistent with the idea that Dnl4 functions in a non-homologous end joining pathway whose inactivation has a relatively minor effect on sensitivity to exogenous DNA damaging agents because homologous recombinational repair predominates in yeast. In support of this notion, mutation of the DNL4 gene confers increased sensitivity to DNA damage only when the homologous recombination pathway has been inactivated (23,24). It appears that Dnl4 and Ku, which is a heterodimer that binds avidly to DNA double-strand ends, function in the same NHEJ pathway because disruption of both the DNL4 and HDF1 (which encodes one of the subunits of the Ku heterodimer) genes does not cause any further increase in sensitivity to DNA damage (23,24),
A distinguishing feature of one of the dnl4::URA3 strains constructed in this study, WR-1, was its temperature-sensitive growth. It is unlikely that this phenotype is caused by other genetic changes introduced during gene disruption, since several independently isolated dnl4::URA3 transformants in this genetic background exhibited the same phenotype and the temperature-sensitive growth defect was complemented by plasmid-borne copies of the DNL4 gene. Crosses of WR-1 with a non-temperature-sensitive strain confirm our conclusion that the temperature-sensitive growth of WR-1 is a complex phenotype dependent upon both the dnl4::URA3 mutation and additional epistatic interactions present in the M1-2B genetic background. Interestingly, hdf mutants also exhibit temperature-sensitive growth (33,34,36-38). It has been suggested that the abnormal growth of these strains is caused by their failure to maintain telomeres (33,34). This cannot account for the temperature-sensitive growth of the WR-1 dnl4::URA3 strain, because telomere length was found to be normal in these cells. Alternatively, it has been suggested that, in the absence of the NHEJ pathway, some forms of spontaneous DNA damage are not repaired and that the accumulation of this damage in the genome eventually triggers a cell cycle checkpoint (38). It is possible that the network of pathways which monitor genome integrity and transduce signals to the cell cycle apparatus after DNA damage are less efficient in the M1-2B cells and because of this difference these cells are extremely sensitive to the low levels of DNA damage that are normally repaired by the NHEJ pathway. It should be noted, however, that the terminal morphology observed in the dnl4 strain at the non-permissive temperature is different from that observed in the hdf strains (38) and does not resemble that commonly associated with cell cycle arrest. Elucidation of the molecular basis for the terminal morphology of the dnl4 strain awaits further investigation.
In humans, DNA ligase IV is highly expressed in the thymus and the testis (6). Given the predicted involvement of DNA ligase IV in V(D)J recombination (39,40), one would expect this gene to be highly expressed in lymphoid tissues but not in reproductive organs containing germ cells, which are characterized by a high frequency of homologous recombination. However, a previous study of yeast sporulation reported that inactivation of DNL4 caused a delay during meiosis I, a reduced efficiency of sporulation and an increased proportion of inviable spores (22). In our study, inactivation of the DNL4 gene in two different strains had no effect on sporulation. Based on these results we conclude that Dnl4 is dispensable for proper meiotic chromosome behavior and the production of haploid gametes in yeast. Since the previously reported meiotic defects were not shown to be uniquely conferred by the dnl4 mutation (22), we suggest that they may be a consequence of secondary genetic changes introduced during gene disruption rather than Dnl4 deficiency.
The non-homologous end-joining pathway involving Dnl4 has been more extensively studied in mammalian cells. In these cells, the joining activity of DNA ligase IV is stimulated by an interaction with Xrcc4, a protein which is involved in NHEJ and V(D)J recombination (39-41). Xrcc4 also enhances DNA binding by Ku and the assembly of the DNA-dependent protein kinase (DNA-PK) (42). Although yeast lacks an obvious homolog of the catalytic subunit of DNA-PK, it does possess homologs of Ku (33-38) and, more recently, Lif1, a functional homolog of Xrcc4, has been identified (43). Thus, it appears that the fundamental mechanisms of NHEJ are conserved and so further biochemical and genetic studies of non-homologous end joining in yeast should continue to provide insights into the functionally homologous pathways in higher eukaryotes.
ACKNOWLEDGEMENTS
We thank Lee Johnston and Patrick Sung for yeast strains and plasmids and David Levin for comments on the manuscript. This work was supported by grants from the Department of Health and Human Services (GM47251 to A.E.T.) and the March of Dimes Birth Defects Foundation (to C.G.).
REFERENCES
This article has been cited by other articles:
This page is run by Oxford University Press, Great Clarendon Street, Oxford OX2 6DP, as part of the OUP Journals
Comments and feedback: www-admin{at}oup.co.uk
Last modification: 3 Dec 1998
Copyright©Oxford University Press, 1998.
CiteULike 
Connotea 
Del.icio.us What's this?
H.-M. Tseng and A. E. Tomkinson
Processing and Joining of DNA Ends Coordinated by Interactions among Dnl4/Lif1, Pol4, and FEN-1
J. Biol. Chem.,
November 12, 2004;
279(46):
47580 - 47588.
[Abstract]
[Full Text]
[PDF]
H. van Attikum, P. Bundock, R. M. Overmeer, L.-Y. Lee, S. B. Gelvin, and P. J. J. Hooykaas
The Arabidopsis AtLIG4 gene is required for the repair of DNA damage, but not for the integration of Agrobacterium T-DNA
Nucleic Acids Res.,
July 15, 2003;
31(14):
4247 - 4255.
[Abstract]
[Full Text]
[PDF]
H.-M. Tseng and A. E. Tomkinson
A Physical and Functional Interaction between Yeast Pol4 and Dnl4-Lif1 Links DNA Synthesis and Ligation in Nonhomologous End Joining
J. Biol. Chem.,
November 15, 2002;
277(47):
45630 - 45637.
[Abstract]
[Full Text]
[PDF]
S. M. Gasser
A Sense of the End
Science,
May 26, 2000;
288(5470):
1377 - 1379.
[Abstract]
[Full Text]
G. C.M. Smith and S. P. Jackson
The DNA-dependent protein kinase
Genes & Dev.,
April 15, 1999;
13(8):
916 - 934.
[Full Text]
This Article 
Abstract
Print PDF (137K)
Alert me when this article is cited
Alert me if a correction is posted
Services
Email this article to a friend
Similar articles in this journal
Similar articles in ISI Web of Science
Similar articles in PubMed
Alert me to new issues of the journal
Add to My Personal Archive
Download to citation manager
Search for citing articles in:
ISI Web of Science (15)
Request Permissions
Commercial Re-use Guidelines
for Open Access NAR Content
Google Scholar
Articles by Ramos, W.
Articles by Tomkinson, A. E.
Search for Related Content
PubMed
PubMed Citation
Articles by Ramos, W.
Articles by Tomkinson, A. E.
Social Bookmarking
What's this?