Skip Navigation

This Article
Right arrow Abstract Freely available
Right arrow Print PDF (107K) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (2)
Right arrowRequest Permissions
Right arrow Commercial Re-use Guidelines
for Open Access NAR Content
Google Scholar
Right arrow Articles by Fujiwara, J.
Right arrow Articles by Oishi, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Fujiwara, J.
Right arrow Articles by Oishi, M.
Social Bookmarking
Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Nucleic Acids Research Pages 5734-5737  

Direct cloning by covalent attachment of probe DNA to target DNA
Introduction
Materials And Methods
   Deoxyoligonucleotide probes
   Direct cloning
Results And Discussion
Acknowledgements
References

Direct cloning by covalent attachment of probe DNA to target DNA

Direct cloning by covalent attachment of probe DNA to target DNA

Jun Fujiwara and Michio Oishi1,*

Biotechnology and Medical Engineering Division, Aisin Cosmos R&D Co. Ltd, 5-2-11 Sotokanda, Chiyoda-ku, Tokyo 101, Japan and 1Kazusa DNA Research Institute, 1532-3 Yana, Kisarazu, Chiba 292, Japan

Received August 18, 1998; Revised and Accepted October 27, 1998

ABSTRACT

A novel cloning procedure which makes use of covalent attachment of probe DNA to specific target DNA is reported. We show that specific gene fragments found in complex genomes such as the human genome can be cloned directly from a pool of genomic DNA with very high efficiency. This direct cloning method totally eliminates certain steps in current cloning procedures such as construction of DNA libraries and colony (plaque) hybridization. The resulting process has made cloning methods simpler and more time efficient, while achieving high cloning efficiency due to the stable nature of the probe-target DNA complex through covalent bonding. Most importantly, since clones are directly obtained from a pool of genomic DNA, the isolated clones are considered to be faithful copies of the original genes. This has apparently solved the problem of isolating clones with misincorporated bases or chimeric DNA, both of which are often encountered in cloning processes using PCR or other methods involving in vitro DNA synthesis.

INTRODUCTION

Recognition of specific base sequences in most molecular biological experiments such as DNA-DNA hybridization is carried out with single-stranded DNA obtained from dissociation of double-stranded DNA. Direct recognition of specific base sequences without DNA dissociation would greatly simplify most of the current cloning and probing procedures. In a previous paper (1), we have reported a novel procedure which has enabled direct attachment of oligonucleotide probes to complementary sequences in double-stranded DNA through covalent bonding. In essence, the terminal sequence in double-stranded DNA restriction fragments would first be recognized by a complementary oligonucleotide with a hairpin-like structure through recA-mediated reaction. The oligonucleotide is then covalently bonded to the target DNA by DNA ligase. The hairpin-like structure of the oligonucleotide brings the 3[prime]-terminus of the oligonucleotide into close proximity to the 5[prime]-terminus of the target DNA molecules for ligation. We have demonstrated the application of this procedure to direct probing of specific DNA fragments. Due to elimination of the DNA dissociation and subsequent hybridization (and washing) steps, this procedure has greatly simplified the probing process and has made it more efficient.

We report that the principle for direct probing can be applied to direct cloning of specific DNA sequences and demonstrate that specific gene fragments present in complex genomes such as the human genome can be cloned directly from a pool of genomic DNA. We also discuss the advantages of this procedure over other cloning procedures currently in use.

MATERIALS AND METHODS

Deoxyoligonucleotide probes

Deoxyoligonucleotide probes were synthesized by Kurabo and Sawady technology. The sequences are listed below in which the hairpin sequence (underlined) and mismatched bases (bold) are emphasized. TRI-G-63, 5[prime]-BioTGCAAGTGCTGCGCGACAGTAACGACGGTTTTGTGATTGCGCGGCCGCGGTTTCCGCGGCCGC-3[prime]; TRI-G2-63, 5[prime]-TCGCTAAGCTGTAGCGTCGGTGGCGGGCGGTGCAAAGTGCGCGGCCGCGGTTTCCGCGGCCGC-3[prime]; ACT-B1-63, 5[prime]-BioTACCTGTACACTGACTTGAGACCAGTTGAATAAAAGTGCAGCGGCCGCGGTTTCCGCGGCCGC-3[prime]; ACT-3-63, 5[prime]-TGCACATGCCGGAGCCGTTGTCGACGACGAGCGCGGCGATGCGGCCGCGGTTTCCGCGGCCGC-3[prime]; JUN-B1-63, 5[prime]-BioAGTTGGACTGGGTTCGGTCTGACGGCGCCCCCAGTGTGCAGCGGCCGCGGTTTCCGCGGCCGC-3[prime]; JUN-2-63, 5[prime]-GCGCTACCCGGCTTTGAAAAGTCGCGGTCACTCACTGAGCGCGGCCGCGGTTTCCGCGGCCGC-3[prime]; P53-B1-63, 5[prime]-BioCAAGATGTTTTGCCAACTGGCCAAGACCTGCCCTGTGCAGGCGGCCGCGGTTTCCGCGGCCGC-3[prime]; P53-3-63, 5[prime]-GGGTTGGGGTCGGGGTGGTGGCCTGCCCTTCCAATGGATCGCGGCCGCGGTTTCCGCGGCCGC-3[prime].

Direct cloning

Escherichia coli DNA was isolated using the phenol extraction procedure. Human genomic DNA was purchased from Promega. DNA was digested with FspI (NEB) for the recG, EcoRV/ApaLI (NEB) for the [beta]-actin, Eco47III/ApaLI (MBI Fermentas) for the c-jun and BamHI/PvuII (NEB) for the p53 genes according to the manufacturers' instructions. After phenol extraction, DNA was precipitated with ethanol and dissolved in buffer (10 mM Tris, 1 mM EDTA, pH 8.0) at a concentration of 4 µg/µl.

Hairpin probes (63mer) corresponding to the termini of the gene fragments to be cloned were custom synthesized (Sawady technology); TRI-BG-63 (3[prime]-end) and TRI-G2-63 (5[prime]-end) for the 1273 bp FspI fragment of the recG gene (2); ACT-B1-63 (3[prime]-end) and ACT-3-63 (5[prime]-end) for the 2477 bp EcoRV/ApaLI fragment of the [beta]-actin gene (3); JUN-B1-63 (3[prime]-end) and JUN-2-63 (5[prime]-end) for the 1439 bp Eco47III/ApaLI fragment of the c-jun gene (4); P53-B1-63 (3[prime]-end) and P53-3-63 (5[prime]-end) for the 1312 bp BamHI/PvuII fragment of the p53 gene (5). One 5[prime]-terminus of each pair (TRI-BG-63, ACT-B1-63, JUN-B1-63 and P53-B1-63) was biotinylated (Sawady technology).

Each pair of probes (1.2 µg each) was incubated with recA protein (184.5 µg; Epicentre Technologies) in the presence of ATP-[gamma]-S (4.8 mM) and magnesium acetate (2.5 mM) in Tris-acetate (30 mM), pH 7.2, buffer (120 µl) for 15 min at 37°C. A portion (100 µl) of the reaction mixture was then combined with a mixture (100 µl) containing genomic DNA digests (200 µg), ATP-[gamma]-S (4.8 mM) and magnesium acetate (22.5 mM) in Tris-acetate (30 mM), pH 7.2, buffer followed by incubation for 2 h at 37°C. An aliquot of 200 µl of ligation reaction mixture (400 U Ampligase in 2× RXN buffer; Epicentre Technologies) was added and incubated overnight (or for 2 h) at 60°C.

The reaction was terminated by adding EDTA (110 mM)/SDS (5.6%) solution (36 µl) and treated with proteinase K (400 µg, 15 min at 37°C). After removing free deoxyoligonucleotides by Sephacryl S-400 columns, the reaction mixture was treated with phenol/chloroform and DNA was precipitated by ethanol in the presence of glycogen (20 µg; Boehringer Mannheim), dried in vacuo and dissolved in distilled water (40 µl). The DNA was then incubated with Taq DNA polymerase (1.25 U; Boehringer Mannheim) in a 50 µl reaction mixture containing Taq polymerase buffer (Boehringer Mannheim) and dNTPs for 30 min at 72°C. The DNA was adsorbed to magnetic beads (100 µl; Promega) in a silicon-coated polypropylene tube (Assist) by incubating for 40 min at room temperature. Following incubation in a buffer (0.1% SDS, 1 mM EDTA, 100 mM NaCl, 10 mM Tris, pH 8.0) for 10 min at 50°C, the beads were washed in the same buffer and this process was repeated once more. The beads were then washed once with another buffer (1 mM EDTA, 500 mM NaCl, 10 mM Tris, pH 8.0) and three times with TE. The beads were transferred to a new silicon-coated polypropylene tube and washed (once) with TE. DNA was excised from the beads by treating with NotI (10 U; NEB) in a buffer (NEBuffer3) containing BSA as recommended by the manufacturer. After phenol/chloroform treatment, the purified excised DNA was ligated to a vector (pZErO-1; Invitrogen) and used to transform E.coli (Xl1-Blue Super Competent Cells; Stratagene). Among randomly selected clones, clones carrying inserts with the expected molecular sizes of the respective genes were first chosen. The inserts were then analyzed by examining the restriction patterns of several restriction enzymes. For the human gene clones, the identity of the inserts was confirmed by one path DNA sequencing.

RESULTS AND DISCUSSION

As reported in the preceding paper (1), direct attachment of probe DNA to target DNA molecules through covalent bonding has greatly simplified probing procedures, allowing completion within a fraction of the time required for similar procedures such as Southern hybridization. Taking advantage of the simplicity of this procedure and the stable nature of a covalently bonded probe-target DNA complex, we examined whether the direct attachment of hairpin probes to target DNA can also be applied to cloning of a specific gene (direct cloning). Use of recA protein in enriching specific DNA fragments through the formation of a recA-DNA complex has been reported and has attained limited success (6-8).

For direct cloning, the original protocol for direct probing was modified as follows (details in Materials and Methods). Two hairpin probes, one of them biotinylated, were used to recognize the sequences at each termini of the target DNA molecule in order to increase specificity. This was thought to be crucial, particularly for efficient cloning of specific DNA fragments from complex genomes. Following ligation, the hairpin structure was dissolved at a high temperature and the resulting single-stranded DNA was filled with deoxynucleotides to excise cloned fragments efficiently from the hairpin probe (below). Probe-ligated target DNA was trapped with streptavidin-coated beads and, after repeated washing of the beads under drastic conditions (SDS and high salt solution at a high temperature), target DNA fragments were excised from the beads using NotI. The extra recognition sites for NotI to ensure cutting were created by the filling step described above. Sample DNA was cloned into an appropriate vector and subjected to transformation in E.coli. The procedure is outlined diagrammatically in Figure 1.


Figure 1. Diagrammatic outline of direct cloning of specific base sequences in double-stranded DNA by hairpin-like oligonucleotide probes. Target DNA and deoxyoligonucleotide probe are shown in blue and red, respectively. B in a yellow circle stands for a biotin molecule. Vector DNA sequence is shown in khaki.

Table 1. Direct cloning of specific genes
Gene (source) Restriction fragments to be cloned No. of clones with inserts No. of clones with the fragments of interest (%)
recG (E.coli) FspI (1273 bp) 96 94 (97.9%)
[beta]-actin (human) EcoRV/ApaLI (2477 bp) 41 7 (17.1%)
c-jun (human) Eco47III/ApaLI (1439 bp) 82 4 (4.9%)
p53 (human) BamHI/PvuII (1312 bp) 88 6 (6.8%)
p53 (human) BamHI/PvuII (1312 bp) 282 33 (11.7%)a
Details in Materials and Methods.
aThe result obtained from the experiment which was carried out under optimum transformation conditions.

Using this protocol, cloning of a gene in a less complex genome (E.coli) was examined first. A 1273 bp FspI fragment of the recG gene (2) was cloned directly from E.coli genomic DNA digests (FspI digests). Virtually all of the transformants with inserts (94 out of 96 clones) contained the recG gene fragment (Table 1). Using the same protocol, cloning of specific DNA fragments (the [beta]-actin, c-jun and p53 genes) directly from human genomic DNA digests was then attempted. To identify clones corresponding to these genes, clones carrying inserts with expected molecular sizes for the respective genes were first selected and further analyzed by examining restriction patterns of the inserts after treatment with several restriction enzymes. Typical restriction patterns among randomly selected clones as well as restriction patterns of one insert for the c-jun gene are shown in Figure 2A and B, respectively. The identity of the inserts was further confirmed by one path DNA sequencing. A summary is shown in Table 1. As seen in Table 1, a significant portion of the inserts for clones obtained from human genomic DNA digests were targeted DNA fragments: 17.1% (seven of 41) for the [beta]-actin gene (3) (2477 bp EcoRV/ApaLI fragment); 4.9% (four of 82) for the c-jun gene (4) (1439 bp Eco47III/ApaLI fragment); 6.8% (six of 88) for the p53 gene (5) (1312 bp BamHI/PvuII fragment). Recent experiments in which conditions for transformation were substantially improved yielded several times more transformants (for the p53 gene) than described above (see Table 1).


Figure 2. A typical pattern of inserts among randomly selected clones (A) and restriction patterns of an insert in clones for the human c-jun gene (B). Inserts excised by NotI from 16 randomly selected clones were electrophoresed and stained with ethidium bromide (A). One clone (lane 4, starred) carrying an insert of the expected molecular size (1439 bp) was selected and the insert was further treated with either NotI alone, NotI + PstI or NotI + HpaI and electrophoresed (B). Lane 1, NotI alone; lane 2, NotI + PstI; lane 3, NotI + HpaI. In (A), a band ~3 kb in size, which is present among all clones except for lanes 2, 8, 15 and 16, represents DNA from vector. DNA size markers, [lambda] HindIII digests (lane M) and NotI digests of the recG FspI fragment (lane M*) are shown with their approximate molecular sizes in kb.


It is quite clear that the covalent attachment of oligonucleotide probes to target DNA molecules through recA- and ligase-mediated reactions can be applied effectively to cloning of specific genes from complex genomes. Since the procedure neither includes steps which require DNA dissociation, such as colony (plaque) hybridization, nor steps for construction of DNA libraries, the entire cloning process has become quite simple and can be completed in less than a few days.

Considering the complexity of human genomic DNA, it is quite striking that a single cloning process yielded clones in which a substantial portion (5-15%) of the inserts represented targeted DNA fragments. We attribute this, at least in part, to double ligation of probes to both termini of the same DNA fragment resulting in increased specificity in selecting specific sequences. This was made possible by the high efficiency of recA-mediated base recognition and pairing. Also, the covalent bonding of probe DNA to target DNA has allowed us to employ stringent manipulations such as SDS and high salt concentration treatment of beads to thoroughly remove non-specific DNA.

Besides the simplicity of this cloning procedure, perhaps the greatest advantage of this procedure would be that DNA sequences in the clones thus obtained more faithfully reflect those in the original genes. This is because the procedure does not include steps involving in vitro DNA synthesis, which is known to produce artificial gene products, including those with misincorporated bases or chimeric DNA fragments, as often observed in clones obtained using PCR.

ACKNOWLEDGEMENTS

We thank Drs Y. Shigemori, K. Okumura and T. Yamamoto for their helpful discussions. This work was supported by the R & D Project of the Innovative Technology for the Earth Program which is sponsored by NEDO (New Energy and Industrial Technology Development Organization).

REFERENCES

1. Fujiwara,J. and Oishi,M. (1998) Nucleic Acids Res., 26, 5717-5722.

2. Lloyd,R.G. and Sharples,G.J. (1991) J. Bacteriol., 173, 6837-6843. MEDLINE Abstract

3. Nakajima-Iijima,S., Hamada,H., Reddy,P. and Kakunaga,T. (1985) Proc. Natl Acad. Sci. USA, 82, 6133-6137. MEDLINE Abstract

4. Hattori,K., Angel,P., Le Beau,M.M., Karin,M. (1988) Proc. Natl Acad. Sci. USA, 85, 9148-9152. MEDLINE Abstract

5. Futreal,P.A., Barret,J.C. and Wiseman,R.W. (1991) Nucleic Acids Res., 19, 6977. MEDLINE Abstract

6. Rigas,B., Welcher,A.A., Ward,D.C. and Weissman,S.M. (1986) Proc. Natl Acad. Sci. USA, 83, 9591-9595. MEDLINE Abstract

7. Taidi-Laskowski,B., Tyan,D., Honigberg,S.M., Radding,C.M. and Grumet,F.C. (1988) Nucleic Acids Res., 16, 8157-8169. MEDLINE Abstract

8. Teintze,M., Arzimanoglou,I.I., Lovelace,C.I.P., Xu,Z.-j. and Rigas,B. (1995) Biochem. Biophys. Res. Commun., 211,804-811. MEDLINE Abstract

*To whom correspondence should be addressed. Tel: +81 438 52 3944; Fax: +81 438 52 3911; Email: oishi@kazusa.or.jp

This page is run by Oxford University Press, Great Clarendon Street, Oxford OX2 6DP, as part of the OUP Journals
Comments and feedback: www-admin{at}oup.co.uk
Last modification: 3 Dec 1998
Copyright©Oxford University Press, 1998.
Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
 DNA ResHome page
Y. Shigemori and M. Oishi
Stable Triple-Stranded DNA Formation and its Application to the SNP Detection
DNA Res, January 1, 2005; 12(6): 441 - 449.
[Abstract] [Full Text] [PDF]

Home page
 Genome ResHome page
Y. Shigemori, H. Haruta, T. Okada, and M. Oishi
Marking of specific sequences in double-stranded DNA molecules--SNP detection and direct observation
Genome Res., December 1, 2004; 14(12): 2478 - 2485.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Print PDF (107K) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (2)
Right arrowRequest Permissions
Right arrow Commercial Re-use Guidelines
for Open Access NAR Content
Google Scholar
Right arrow Articles by Fujiwara, J.
Right arrow Articles by Oishi, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Fujiwara, J.
Right arrow Articles by Oishi, M.
Social Bookmarking
Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?