Skip Navigation

This Article
Right arrow Abstract Freely available
Right arrow Print PDF (146K) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrowRequest Permissions
Right arrow Commercial Re-use Guidelines
for Open Access NAR Content
Google Scholar
Right arrow Articles by Shen, M. R.
Right arrow Articles by Thelen, M. P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Shen, M. R.
Right arrow Articles by Thelen, M. P.
Social Bookmarking
Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Nucleic Acids Research Pages 1032-1037

Mutations in hamster single-strand break repair gene XRCC1 causing defective DNA repair
Introduction
Materials And Methods
   Cell culture
   Cell extracts
   Irradiation
   Survival curves
   Immunodetection
   RT-PCR and sequence determination
Results And Discussion
   Mutant CHO cell lines forming the XRCC1 complementation group
   Absence of XRCC1 protein in mutant CHO cell extracts
   Identification of mutations in the hamster XRCC1 coding sequence
Acknowledgements
References

Mutations in hamster single-strand break repair gene XRCC1 causing defective DNA repair

Mutations in hamster single-strand break repair gene XRCC1 causing defective DNA repair M. Richard Shen, Malgorzata Z. Zdzienicka1, Harvey Mohrenweiser, Larry H. Thompson and Michael P. Thelen*

Biology and Biotechnology Research Program, Lawrence Livermore National Laboratory, PO Box 808, L-452, Livermore, CA 94550, USA and 1MGC-Department of Radiation Genetics and Chemical Mutagenesis, Leiden University and J.A.Cohen Institute, Leiden, The Netherlands

Received October 6, 1997; Revised and Accepted December 9, 1997

DDBJ/EMBL/GenBank accession no. AF034203

ABSTRACT

The molecular basis for the DNA repair dysfunction observed in mutant Chinese hamster ovary cell lines of X-ray repair cross complementing group 1 (XRCC1) is unknown and the exact role of the XRCC1 protein remains unclear. To help clarify the role of the XRCC1 gene we analyzed four mutant cell lines of this complementation group and a revertant cell line for XRCC1 protein content and for sequence alterations in the XRCC1 coding region. Immunoblot analysis of cellular extracts indicated that each of four mutant lines was lacking XRCC1 protein, whereas the repair-proficient revertant line derived from one of these mutants contained a normal level of XRCC1. Although each of these cell lines expressed XRCC1 mRNA, we found in all cases a distinct point mutation resulting in crucial alterations in the encoded XRCC1 protein sequence of 633 amino acids. Two of the mutations cause non-conservative amino acid changes, Glu102 -> Lys and Cys390 -> Tyr, at positions that are invariant among hamster, mouse and human XRCC1 sequences and are located in putative functional domains. A third debilitating mutation disrupts RNA splicing, generating multiple transcripts of different length that contain deletions spanning a region of >100 amino acids in the midsection of the XRCC1 coding sequence. A fourth mutation results in a termination codon that shortens the open reading frame to 220 amino acids, however, in the revertant cell line a further mutation in the same codon, Stop221 -> Leu, permits translation of a full-length functional variant protein. These mutational data indicate the importance of the putative functional regions in XRCC1, such as the BRCA1 C-terminal (BRCT) domain found in common with BRCA1 and other DNA repair and cell cycle checkpoint proteins, and also regions necessary for interaction with DNA polymerase [beta] and DNA ligase III.

INTRODUCTION

XRCC1 encodes a protein that functions in repair of single-strand breaks in DNA, presumably through its interactions with DNA ligase III (Lig III) (1,2) and DNA polymerase [beta] (Pol [beta]) (3,4). The critical role of XRCC1 in the cellular response to DNA damage was found when the repair defects of certain mutant Chinese hamster ovary (CHO) cell lines were corrected by transfection with the human XRCC1 gene (5), cDNA (6) or with the purified XRCC1 polypeptide (7). These CHO cell lines, EM7 (8), EM9 (8) and EM-C11 (9), comprise the known members of X-ray repair cross complementing group 1 (XRCC1). All cells in this group are characterized by hypersensitivity to (m)ethylation agents, sensitivity to ionizing radiation, accumulation of single-strand breaks in DNA after damage and an unusually high frequency of sister chromatid exchange (SCE) (9,10). These characteristics appear to be unique among mammalian cell mutants. EM9 and EM-C11 cells were found to be deficient not only in XRCC1 protein (11) but also in Lig III (11,12), leading to the prediction that mutations in XRCC1 might destabilize the specific association between these two proteins (11).

The probable participation of XRCC1 in base excision repair (BER) has been demonstrated by its interaction with proteins known to function in this pathway. In a reconstituted system for uracil removal using purified proteins, including Pol [beta] and Lig III (3), addition of XRCC1 inhibited the strand displacement activity of Pol [beta], apparently limiting polymerization to 1 nt. However, these in vitro experiments indicated that XRCC1 was not essential for repair and no defect was seen in cellular extracts. Another base excision repair protein, poly(ADP-ribose) polymerase (PARP), which binds to nicks in DNA (13), may also form a complex with XRCC1 (4). Although it is not clear from these studies what the biochemical function of XRCC1 might be, it is apparent that in the XRCC1 complementation group a critical step is disabled during repair of some types of base damage. The notion that this compromised step is close to or coupled with ligation following repair synthesis is substantiated by the interaction between XRCC1 and Lig III and by a requirement for XRCC1 for Lig III stability (1,2,11,14).

The biological function of XRCC1 has also been examined in mouse. Along with Lig III and Pol [beta], XRCC1 appears to have a role in meiosis, as it is most highly expressed in mouse pachytene spermatocytes (15). It is also essential for development, since mouse embryos lacking the Xrcc1 gene are unable to survive past 8 days (16). Another indicator of biological function is given by structural features recently found through sequence comparisons. Even though there is no significant overall sequence homology between mammalian XRCC1 protein and known proteins from other organisms, a 90 amino acid peptide domain named after the BRCA1 C-terminus (BRCT) was identified in XRCC1, Lig III and also in PARP (17,18). The BRCT module appears to be a feature retained in many DNA damage response and cell cycle checkpoint proteins (17,18), such as human BRCA1, 53BP1, Saccharomyces cerevisiae Rad9 and Dpb11 and Schizosaccharomyces pombe rad4(cut5). A similar domain has been located in the interacting regions of the XRCC4 and DNA ligase IV proteins (19).

Since mutant cell lines of the XRCC1 complementation group were classified by cellular hybridization studies and have not been related directly to alterations in the XRCC1 gene, we examined the status of XRCC1 mRNA, the coding sequence and protein product. During this study a new mutant cell line was characterized as a member of this complementation group. The entire collection of mutant cells were found to contain abnormal levels of XRCC1 protein, accompanied by point mutations in XRCC1 that directly affect DNA repair function.

MATERIALS AND METHODS

Cell culture

The origins of CHO lines AA8, CHO9 and their derivatives are given in Table 1. Cultivation conditions were described previously (5). The TOR hybridization/selective system described earlier (9) was used with polyethylene glycol-induced fusion of one double-marked line (TOR, thioguanine-resistant and ouabain-resistant) to one unmarked line. A population of hybrids (>100 clones) was collected from each cross and then used to estimate survival following EMS exposure and to determine the modal chromosome number.

Table 1. CHO cell lines used in this study
CHO cell line Cell line origin
(reference)		 EMS sensitivitya Sensitivity
(reference)
CH09 27   This study, 24
EM-C11 9 8× 9
EM-C12 This study 8× This study
AA8 28   5
EM7 8 10× 5
EM9 8 10× 5
EM9R1 23 ~1×b 23
aBased on D10 or D37 values of survival curves.
bThe hypersensitivity was extrapolated from the SCE level, which was very close to the wild-type level, i.e. 98% corrected (26).

Cell extracts

Total RNA was isolated from cell lines grown in T150 tissue culture flasks to 80% confluency. After discarding the culture medium cells were lysed directly in the flask with 5 ml denaturing solution (4 M guanidinium thiocyanate, 25 mM sodium citrate, pH 7, 0.1 M [beta]-mercaptoethanol and 0.5% N-lauroylsarcosine) and processed as previously described (20). Poly(A)+ mRNA was isolated using the PolyATtract mRNA isolation system according to the manufacturer's instructions (Promega, Madison, WI). Isolated RNA was stored at -80°C as an ethanol precipitate. For genomic DNA isolation and protein extracts cells were trypsinized and washed with 10 mM sodium phosphate, pH 7.4, 150 mM NaCl (PBS). In the case of genomic DNA isolation pelleted cells from a T75 rotor at 90% confluency were resuspended in 2 ml digestion buffer (100 mM NaCl, 10 mM Tris-HCl, pH 8, 25 mM EDTA, 0.5% SDS and 0.1 mg/ml proteinase K) and processed as previously described (20). For immunoblots cells were resuspended in 0.1 vol. 50 mM Tris-HCl, pH 8, 300 mM NaCl, 1 mM EDTA, 1 mM dithiothreitol, 10% glycerol and lysed by sonication (3 × 30 s bursts at half power using a microtip) and cellular debris removed by centrifugation at 20 000 g. Cell extracts were stored in small aliquots at -80°C and used only once after thawing.

Irradiation

To estimate the sensitivity of the cell lines to X-ray exposure cells were irradiated in medium at a dose rate of 3 Gy/min (200 kV, 4 mA, 0.78 mm Al). For irradiation with UV light of 254 nm a Philips TUV germicidal lamp was used with a fluence rate of 0.19 W/m2, measured with an IL/770 germicidal radiometer.

Survival curves

Cultures in exponential growth were trypsinized and 300-3000 cells were plated, in duplicate, on 10 cm dishes and left to attach for 4 h. Cells were then either irradiated or treated with mitomycin C (MMC) or ethylmethane sulfonate (EMS) for 24 or 1 h respectively. After chemical treatment the medium was removed and cells were rinsed twice with PBS. Normal medium was then added and cells were incubated for 8-10 days. After incubation dishes were rinsed with NaCl (0.9%), air dried and stained with methylene blue (0.25%) and visible colonies counted. Each survival series was carried out at least three times for statistical evaluation.

Immunodetection

Protein extracts from CHO cell lines were separated by SDS-PAGE and transferred to a polyvinylidene difluoride (PVDF) membrane using a blotting apparatus (BioRad Inc., Richmond, CA) at 20 V overnight. Protein molecular mass markers were detected using the S-tag system from Novagen Inc. (Madison, WI). XRCC1 protein was detected using a polyclonal antibody raised in mice against the human XRCC1 polypeptide, obtained by bacterial overexpression and purified as described previously (11). The antibody was isolated by protein A affinity chromatography and further purified using a column containing immobilized S-peptide-XRCC1 fusion protein (Thelen, unpublished data). After washing the membrane a secondary anti-mouse IgG labeled with fluorescein isothiocyanate (FITC)-alkaline phosphatase (BioRad) was applied and processed for enhanced chemifluorescence using a Storm Phosphorimager (Molecular Dynamics Inc., Sunnyvale, CA). The scanned image was quantitated according to the manufacturer's instructions using background subtraction for each band representing XRCC1. At least four experiments were performed for each of the cell extracts.

RT-PCR and sequence determination

Hamster XRCC1 cDNAs were sequenced by a strategy employing direct sequencing of PCR products generated from cross-species RT-PCR. The cDNA was amplified in five overlapping segments to facilitate direct sequencing. Since the nucleotide sequence of the hamster XRCC1 cDNA was not known, PCR primers (Table 2) were directed to the most highly conserved regions of the mouse and human XRCC1 cDNAs and were chosen to match the mouse sequence. Most of the hamster XRCC1 cDNA coding sequence could be amplified in four PCR products. Once some hamster cDNA sequence was available, additional PCR primers were designed that amplified regions that could not be amplified previously with primers matching mouse sequences. 5'-RACE was performed to obtain the nucleotide sequence of the 5'-region of the XRCC1 cDNA. The 5'-RACE System (Life Technologies, Rockville, MD) was used according to the manufacturer's instructions. The unique PCR primers for 5'-RACE are listed in Table 2. These unique primers were used along with the provided anchor primers for the 1° and 2° nested PCR reactions. Appended to the 5'-end of the PCR primers were DNA sequencing primer binding sites for the forward or reverse DYEnamic ET primers (Amersham Life Science, Cleveland, OH).

First strand cDNA substrates for PCR were generated using an oligo(dT) primer and the Superscript Preamplification kit according to the manufacturer's instructions (Life Technologies). The first strand cDNA reactions were performed on 5 µg total RNA for all cell lines except for EM9, in which 500 ng poly(A)+ RNA was used.

PCR reactions were performed in a 50 µl volume using a hot-start format. The final components of the reaction were as follows: 1× PCR buffer (10 mM Tris-HCl, pH 8.3 at 20°C, 1.5 mM MgCl2, 50 mM KCl), 200 mM each dNTP, 0.5 µM each primer, 1.25 U Taq DNA polymerase (Boehringer Mannheim, Indianapolis, IN) and 2 µl unpurified first strand cDNA product or 50 ng genomic DNA. All the reaction components except for Taq DNA polymerase were combined in a 40 µl volume. The reactions were then placed in a Perkin Elmer 9600 GeneAmp thermocycler and subjected to the following thermocycle conditions: initial denaturation at 94°C for 5 min (during which the Taq DNA polymerase in 10 µl 1× PCR buffer was added to the reaction mix); 35 cycles of denaturation at 94°C for 30 s, primer annealing at 63°C for 45 s and primer extension at 72°C for 1 min; a final incubation at 72°C for 7 min. PCR products were then analyzed in a 2% agarose gel containing 1× TAE buffer.

Prior to DNA sequencing the PCR reactions were digested with exonuclease I and calf intestinal alkaline phosphatase to remove excess primers and dNTPs (21). We found that calf intestinal alkaline phosphatase substituted equally for shrimp alkaline phosphatase and saw no decrease in sequence quality. The PCR reactions (5 µl) were added to 5 µl digestion mix (containing 2.5 U exonuclease I and 2.5 U calf intestinal alkaline phosphatase in 10 mM Tris-HCl, pH 8.3 at 20°C, 1.5 mM MgCl2, 50 mM KCl) and incubated at 37°C for 60 min. The enzymatic digestions were terminated by heating the reaction to 75°C for 15 min. The treated PCR products were diluted 5-fold by addition of 40 µl 10 mM Tris-HCl, pH 8, 0.1 mM EDTA prior to direct use in sequencing reactions. The DYEnamic direct cycle sequencing kit with the -40 M13 forward and -28 M13 reverse DYEnamic ET primers (Amersham Life Science, Cleveland, OH) were used for sequencing of the PCR products. The sequencing reactions were set up as per the manufacturer's instructions. The thermocycle conditions were as follows: 25 cycles of 95°C for 30 s, 50°C for 5 s and 72°C for 1 min. Following the thermocycle protocol the A, C, G and T reactions were pooled and ethanol precipitated. The precipitated products were washed with 70% ethanol and evaporated to dryness under vacuum. The precipitated sequencing products were resuspended in 6 µl of the provided formamide loading dye, heat denatured at 70°C for 3 min, quenched on ice and 2.5 µl were then loaded into a Applied Biosystems 373 stretch DNA sequencer.

Initial data analysis (lane tracking and base calling) was performed with the ABI prism DNA sequencing analysis software. Chromatograms generated by the ABI sequencing analysis software were then transfered to a Unix workstation and further analyzed with the Phred, Phrap and Consed programs. Base calls and quality values were set by Phred, sequences were assembled with Phrap and the resultant data was displayed with Consed (documentation is available through http://www.genome.washington.edu). Point mutations in the hamster XRCC1 cDNA and splice site sequence were identified by comparisons with the parental cell lines (AA8 or CHO9).

Table 2 . Oligodeoxyribonucleotide primers used in RT-PCR
Segment Primer Sequencea Sourceb
1 F1s_3.Xr1 d(F-CCAGGACTCGACCCATTGT) Mouse
  R1a_1.Xr1 d(R-ATCCTCCTCTTTCACACGA) Mouse
2 F2s_2.Xr1 d(F-GACGAGGCGGAGACTCCAT) Hamster
  R2a_2.Xr1 d(R-GGCAAAGGCACAGATGAGG) Hamster
3 F3s_1.Xr1 d(F-GCTCAGTGGCTTCCAGAAC) Mouse
  R3a_1.Xr1 d(R-ACGGGTCCTCGCCATTCTC) Mouse
4.1 F4s_1.Xr1 d(F-ACACCGAGGATGAACTGAG) Mouse
  R4a_1.Xr1 d(R-CTCAGGCCTGGGGCACCAC) Mouse
4.2 F4s_1.Xr1 See above  
  R4a_2.Xr1 d(R-CGTGTGCACTCAGGCCTGT) Mouse
Intron 8 F3s_1.Xr1 See above  
  R2a_3.Xr1 d(R-CCGCAGGCGGTAACAGTCCA) Hamster
5'-RACE (1°) 5rce_a1 d(GTCACCAGCACCTCTACGAA) Hamster
5'-RACE (2°) 5rce_a2 d(GCTCCTCCTTCTCCAACTGT) Hamster
aF and R represent appended sequences of primer binding sites for the forward and reverse sequencing primers respectively.
bPrimer sequences are derived from this sequence source.

RESULTS AND DISCUSSION

Mutant CHO cell lines forming the XRCC1 complementation group

To identify mutations within XRCC1 responsible for the defective DNA repair seen in CHO mutant cells, we analyzed the EMS-hypersensitive cell lines in the XRCC1 complementation group. Previous studies reported isolation of three mutants in this group (8-10). As summarized in Table 1, the mutants originated from two different CHO lines, AA8 and CHO9. Line EM9R1, an EMS-resistant phenotypic revertant of EM9, was derived by UV mutagenesis and EMS selection (23).


Figure 1. Sensitivity of EM-C12 mutant cells to DNA damaging agents. CHO9 and mutant EM-C12 cells were irradiated with either X-rays or 254 nm UV at the doses indicated or treated with MMC or EMS at the concentrations in culture as indicated. The values given are the mean of at least three experiments. Standard deviation from the mean is given as half-vertical bars. l, CHO9; [circle], EM-C12.

A new EMS-sensitive mutant, EM-C12, was isolated from an N-ethyl-N-nitrosourea (ENU)-mutagenized population of CHO9 cells on the basis of its hypersensitivity to EMS, by replica plating as described earlier (24). In the initial screen two clones, EMC-12a and EM-C12b, were isolated that maintained their EMS sensitivity for several months of continuous culture. Based on genetic complementation analyses (results not shown), these two cell lines were assigned to the EM-C11/EM9 complementation group. Nucleotide sequence data (see below) determined that EMC-12a and EM-C12b contained the same mutation and were apparently subclones of a single mutant, named here EM-C12.

EM-C12 was characterized by cell survival analysis for several DNA damaging agents (Fig. 1). In comparison with the wild-type line, EM-C12 cells were only moderately sensitive to irradiation by UV and X-rays (1.5- and 1.7-fold sensitive at 37% survival respectively) and to exposure with the crosslinking agent MMC (1.8-fold sensitive). In contrast, these cells were 8-fold more sensitive to treatment with the alkylating agent EMS than the parental line, a level of sensitivity similar to mutant lines EM-C11 (9), EM7 and EM9 (5).

Absence of XRCC1 protein in mutant CHO cell extracts

The CHO cell lines listed in Table 1 were examined for the presence of XRCC1 protein by immunoblot analysis. Previous immunoblot experiments using a monoclonal antibody found no full-length protein in EM9 and EM-C11 cell extracts (11). To increase detection sensitivity and also to observe any truncated XRCC1 polypeptides (i.e. multiple epitopes), we have produced a mouse polyclonal antibody specific for XRCC1. Using a high sensitivity fluorescence detection system we consistently observed the presence of XRCC1 protein in extracts from the repair-proficient cell lines, whereas neither full-length nor lower molecular weight forms of XRCC1 were detected in extracts from the repair-deficient mutant cells (Fig. 2A). These results are consistent with the destabilizing effect of mutations in other proteins and, moreover, confirm the previous report of XRCC1 deficiency in EM9 and EM-C11 cells (11). Quantification of the fluorescence signal indicated that the revertant EM9R1 cells contain a level of XRCC1 protein that is consistent with the wild-type AA8 and CHO9 cells (Fig. 2B).


Figure 2. Analysis of XRCC1 protein levels in CHO cell extracts. Cellular protein (50 µg) from each extract was processed for immunodetection using affinity-purified polyclonal antibody specific for XRCC1. (A) Composite fluorescence image from two membranes. Hamster XRCC1 protein was detected at a position in the gel corresponding to human XRCC1 expressed in hamster cells (not shown) and with an estimated mass of 80 kDa compared with standard protein markers. (B) Quantification of XRCC1 protein levels. Signal intensities for XRCC1 from AA8 and EM9R1 were averaged for three individual experiments and expressed as the fraction relative to the CHO9 values (relative fluorescence). Standard deviation from the mean is given as vertical bars. -, the signal for XRCC1 was below the detection threshold (<10% of the CHO9 sample) in five separate experiments.

Table 3. Mutations in hamster XRCC1
Cell line Codon Nucleotide positiona Base change Type of change
EM-C12 102 304 GAG -> AAG Missense
EM-C11 390 1169 TGT -> TAT Missense
EM9 221 661 CAG -> TAG Stop
EM9R1 221 662 TAG -> TTG Revertant
EM7 Intron 8   AG -> TG Splice acceptor
aHamster (Cricetulus griseus) XRCC1 coding sequence, accession no. AF034203

Identification of mutations in the hamster XRCC1 coding sequence

To determine whether the phenotype that characterizes these CHO mutants arises from alterations in the XRCC1 cDNA, we sequenced the hamster XRCC1 ORF from each cell line by cross-species RT-PCR. Mutation analysis was simplified by the fact that CHO lines are hemizygous for XRCC1 (22). As evidenced by the ability to obtain portions of the XRCC1 cDNA after reverse transcription of RNA from each cell line, the mutants are capable of expressing the XRCC1 gene. Sequence analysis revealed point mutations within the cDNAs of all the cell lines (Table 3) and these nucleotide changes result in significant alterations in the encoded amino acid sequence (Fig. 3).

EM-C12 cells contain a G -> A substitution at nt 304, causing a Glu -> Lys change at residue 102 (E102 -> K) and therefore altering the charge at that position from negative to positive (Fig. 3). This Glu residue is strictly conserved in the mammalian homologs of XRCC1. Since this mutation is in the region of the XRCC1 protein demonstrated to interact with Pol [beta] (3,4), the negative charge in the native protein is likely to be crucial for protein-protein binding; alternatively, the change in charge may have a deleterious effect on XRCC1 protein folding and therefore also on protein-protein interactions.


Figure 3. Amino acid sequence alignment of hamster XRCC1 and mammalian homologs. Hamster (Cg) deduced amino acid sequence was compared with the mouse (Mm) and human (Hs) sequences using the ClustalW alignment program (29) and displayed here to indicate differences among sequences. ..., residues identical with the hamster sequence; larger bold letters, sites of mutations in CHO cell lines, with the mutations found in each cell line given below. Annotations above the sequences indicate functional regions as described in the text. The hamster XRCC1 amino acid sequence is 90% identical to that of mouse and 84% to that of human.

The mutation found in EM-C11 cells, a G -> A substitution at nt 1169, results in a C390 -> Y amino acid change. The Cys residue at this position, again strictly conserved in the mammalian XRCC1 homologs, is also conserved among many of the DNA repair and cell cycle checkpoint proteins containing the recently identified BRCT domain (Fig. 3; 17,18). Substitution of a Cys, one of only six cysteines in XRCC1, could disrupt normal disulfide formation and result in incorrect protein folding. Moreover, replacing the sulfhydryl group of Cys with the bulky hydrophobic group of Tyr could alter protein folding. This is the first reported amino acid substitution in a BRCT domain that leads to a loss of DNA repair function, a phenomenon that would be predicted based on the widespread presence and the degree of conservation of this domain in DNA damage-responsive proteins (17,18).

Both BRCT modules are deleted from XRCC1 as a result of a C -> T substitution found in EM9 cells. In this case the mutation at nt 661 introduces a termination codon TAG only one third of the way into the coding sequence and results in a truncated polypeptide of 220 residues (Fig. 3). The C-terminal region of XRCC1, overlapping with the BRCT-b domain, is known to interact with Lig III (1,2), perhaps through a similar BRCT module located at the C-terminus of Lig III. XRCC1 protein only complexes with the longer of two alternatively spliced versions of Lig III (2), in which the BRCT domain is present, substantiating the notion that this sequence module in one protein might be interacting with a similar module in the other. Furthermore, the BRCT domain also appears to be necessary for an analogous interaction between DNA ligase IV and XRCC4, a double-strand break repair protein (19). The critical nature of this sequence module can be seen by its loss due to a similar mutation, 1853Stop, in the human BRCA1 gene, leading to early onset breast cancer (25).

In the revertant EM9R1 the mutant TAG originating from the EM9 cell line is changed to TTG (A -> T at nt 662), thereby changing Stop221 to Leu. Although this results in an amino acid change at a strictly conserved Gln, Q221 -> L, the near normal SCE level in EM9R1 cells indicates that the mutant protein is fully functional (26). The amount of XRCC1 protein detected in EM9R1 was comparable with that in AA8 cells (see Fig. 2B), suggesting that Leu221 does not alter the stability of XRCC1 in vivo.

The final mutation in the XRCC1 complementation group was identified in genomic DNA from EM7 cells, in the putative splice site preceding exon 9. The first indication of a splicing abnormality was observed when multiple cDNA products of differing lengths were amplified from RNA of EM7. In this case an A -> T substitution in the splice acceptor AG of XRCC1 intron 8 results in two different transcripts (EM7a and EM7b) containing short in-frame deletions in exon 9 and one out-of-frame transcript (EM7c) from splicing of exon 8 into exon 10 (Fig. 4). These variants occur as a consequence of faulty RNA processing with cryptic splice acceptor sequences downstream. Once again, the mutation affects the BRCT-a module (see Fig. 3), causing complete loss of the Cys at residue 390 (discussed above) and also flanking amino acids such as Trp386, the most highly conserved residue in this domain (17,18).


Figure 4. Aberrantly spliced XRCC1 transcripts in EM7 cells. The mutation in EM7 is in the splice acceptor site of intron 8 and results in deletion of exon 9 as shown in this schematic. The splice donor site of intron 8 aberrantly joins with cryptic splice sites within exon 9 and the splice acceptor site of intron 9.

In conclusion, all of the nucleotide sequence alterations identified here were found in the XRCC1 ORF. Each of the mutations results in a severe reduction in the level of XRCC1 protein and in the cellular capacity to repair strand breaks and certain kinds of base damage (9,10). It is likely that the primary result of these mutations is to destabilize XRCC1 through improper protein folding or through disruption of XRCC1-specific complex formation caused by alteration of critical contact residues. Complexes that are likely to be affected are between XRCC1 and Pol [beta], Lig III and perhaps PARP (see Fig. 3). Furthermore, disabled interactions between these proteins could destabilize more than one of the other complex partners, as appears to be the case where both XRCC1 and Lig III are absent in cells containing a mutation in XRCC1 (11). Finally, the mutations in the BRCT-a domain of XRCC1 help to establish the biological significance of this sequence module.

ACKNOWLEDGEMENTS

The authors are grateful to M.Hwang, K.Brookman and L.Wetselaar for excellent technical assistance in cell culture, antibody preparation and immunodetection, to S.Corzett and Dr R.Balhorn for supplying samples of human XRCC1 protein that were used as antigen, to B.Bruce for helpful suggestions on DNA sequencing and to Drs D.Wilson and S.McCutchen-Maloney for critical comments on the manuscript. This research was performed under the auspices of the US DOE by LLNL under contract no. W-7405-ENG-48 and supported by European Union grant F14PCT90010 to M.Z.

REFERENCES

1 Nash,R.A., Caldecott,K.W., Barnes,D.E. and Lindahl,T. (1997) Biochemistry, 36, 5207-11. MEDLINE Abstract

2 Mackey,Z.B., Ramos,W., Levin,D.S., Walter,C.A., McCarrey,J.R. and Tomkinson,A.E. (1997) Mol. Cell. Biol., 17, 989-998. MEDLINE Abstract

3 Kubota,Y., Nash,R.A., Klungland,A., Schar,P., Barnes,D.E. and Lindahl,T. (1996) EMBO J., 15, 6662-6670. MEDLINE Abstract

4 Caldecott,K.W., Aoufouchi,S., Johnson,P. and Shall,S. (1996) Nucleic Acids Res., 24, 4387-4394. MEDLINE Abstract

5 Thompson,L.H., Brookman,K.W., Jones,N.J., Allen,S.A. and Carrano,A.V. (1990) Mol. Cell. Biol., 10, 6160-6171. MEDLINE Abstract

6 Caldecott,K.W., Tucker,J.D. and Thompson,L.H. (1992) Nucleic Acids Res., 20, 4575-4579. MEDLINE Abstract

7 Caldecott,K.W. and Thompson,L.H. (1994) Ann. NY Acad. Sci., 726, 336-339. MEDLINE Abstract

8 Thompson,L.H., Rubin,J.S., Cleaver,J.E., Whitmore,G.F. and Brookman,K. (1980) Somat. Cell Genet., 6, 391-405. MEDLINE Abstract

9 Zdzienicka,M.Z., van der Schans,G.P., Natarajan,A.T., Thompson,L.H., Neuteboom,I. and Simons,J.W. (1992) Mutagenesis, 7, 265-269. MEDLINE Abstract

10 Thompson,L.H., Brookman,K.W., Dillehay,L.E., Carrano,A.V., Mazrimas,J.A., Mooney,C.L. and Minkler,J.L. (1982) Mutat. Res., 95, 427-440. MEDLINE Abstract

11 Caldecott,K.W., Tucker,J.D., Stanker,L.H. and Thompson,L.H. (1995) Nucleic Acids Res., 23, 4836-4843. MEDLINE Abstract

12 Ljungquist,S., Kenne,K., Olsson,L. and Sandstrom,M. (1994) Mutat. Res., 314, 177-186. MEDLINE Abstract

13 de Murcia,G. and de Murcia,J.M. (1994) Trends Biochem. Sci., 19, 172-176. MEDLINE Abstract

14 Caldecott,K.W., McKeown,C.K., Tucker,J.D., Ljungquist,S. and Thompson,L.H. (1994) Mol. Cell. Biol., 14, 68-76. MEDLINE Abstract

15 Walter,C.A., Trolian,D.A., McFarland,M.B., Street,K.A., Gurram,G.R. and McCarrey,J.R. (1996) Biol. Reprod., 55, 630-635. MEDLINE Abstract

16 Tebbs,R.S., Meneses,J.J., Pedersen,R.A., Thompson,L.H. and Cleaver,J.E. (1996) Environ. Mol. Mutagen., 27 (suppl. 27), 68 (abstract).

17 Bork,P., Hofmann,K., Bucher,P., Neuwald,A.F., Altschul,S.F. and Koonin,E.V. (1997) FASEB J., 11, 68-76. MEDLINE Abstract

18 Callebaut,I. and Mornon,J.P. (1997) FEBS Lett., 400, 25-30. MEDLINE Abstract

19 Critchlow,S.E., Bowater,R.P. and Jackson,S.P. (1997) Curr. Biol., 7, 588-598. MEDLINE Abstract

20 Ausubel,F.M., Brent,R., Kingston,R.E., Moore,D.D., Seidman,J.G., Smith,J.A. and Struhl,K. (eds) (1992) Current Protocols in Molecular Biology. Green Publishing Associates and Wiley-Interscience, New York, NY.

21 Werle,E., Schneider,C., Renner,M., Volker,M. and Fiehn,W. (1994) Nucleic Acids Res., 22,4354-4355. MEDLINE Abstract

22 Thompson,L.H., Bachinski,L.L., Stallings,R.L., Dolf,G., Weber,C.A., Westerveld,A. and Siciliano,M.J. (1989) Genomics, 5, 670-679. MEDLINE Abstract

23 Dillehay,L.E., Thompson,L.H., Minkler,J.L. and Carrano,A.V. (1983) Mutat. Res., 109, 283-296. MEDLINE Abstract

24 Zdzienicka,M.Z. and Simons,J.W. (1987) Mutat. Res., 178, 235-244. MEDLINE Abstract

25 Friedman,L.S., Ostermeyer,E.A., Szabo,C.S., Dowd,P., Lynch,E.D., Rowell,S.E. and King,M.-C. (1994) Nature Genet., 8, 399-404. MEDLINE Abstract

26 Carrano,A.V., Minkler,J.L., Dillehay,L.E. and Thompson,L.H. (1986) Mutat. Res., 162, 233-239. MEDLINE Abstract

27 Burki,H.J., Lam,C.K. and Wood,R.D. (1980) Mutat. Res., 69, 347-356. MEDLINE Abstract

28 Thompson,L.H., Fong,S. and Brookman,K. (1980) Mutat. Res., 74, 21-36. MEDLINE Abstract

29 Thompson,J.D., Higgins,D.G. and Gibson,T.J. (1994) Nucleic Acids Res., 22, 4673-4680. MEDLINE Abstract

*To whom correspondence should be addressed. Tel: +1 510 422 6547; fax: +1 510 422 2282; Email: mthelen@llnl.gov

This page is run by Oxford University Press, Great Clarendon Street, Oxford OX2 6DP, as part of the OUP Journals Comments and feedback: www-admin{at}oup.co.uk
Last modification: 6 Feb 1998
Copyright© Oxford University Press, 1998.

Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
 J. Biol. Chem.Home page
D. Chen, Z. Yu, Z. Zhu, and C. D. Lopez
E2F1 Regulates the Base Excision Repair Gene XRCC1 and Promotes DNA Repair
J. Biol. Chem., May 30, 2008; 283(22): 15381 - 15389.
[Abstract] [Full Text] [PDF]

Home page
 Clin. Cancer Res.Home page
S.-P. Huang, C.-Y. Huang, J.-S. Wang, C.-C. Liu, Y.-S. Pu, H.-J. Yu, C.-C. Yu, T. T. Wu, C.-H. Huang, W.-J. Wu, et al.
Prognostic Significance of p53 and X-ray Repair Cross-complementing Group 1 Polymorphisms on Prostate-Specific Antigen Recurrence in Prostate Cancer Post Radical Prostatectomy
Clin. Cancer Res., November 15, 2007; 13(22): 6632 - 6638.
[Abstract] [Full Text] [PDF]

Home page
 CarcinogenesisHome page
C. Li, Z. Liu, L.-E Wang, S. S. Strom, J. E. Lee, J. E. Gershenwald, M. I. Ross, P. F. Mansfield, J. N. Cormier, V. G. Prieto, et al.
Genetic variants of the ADPRT, XRCC1 and APE1 genes and risk of cutaneous melanoma
Carcinogenesis, September 1, 2006; 27(9): 1894 - 1901.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
P. T. Beernink, M. Hwang, M. Ramirez, M. B. Murphy, S. A. Doyle, and M. P. Thelen
Specificity of Protein Interactions Mediated by BRCT Domains of the XRCC1 DNA Repair Protein
J. Biol. Chem., August 26, 2005; 280(34): 30206 - 30213.
[Abstract] [Full Text] [PDF]

Home page
 Nucleic Acids ResHome page
R. Brem and J. Hall
XRCC1 is required for DNA single-strand break repair in human cells
Nucleic Acids Res., May 2, 2005; 33(8): 2512 - 2520.
[Abstract] [Full Text] [PDF]

Home page
 Cancer Epidemiol. Biomarkers Prev.Home page
S. Leng, J. Cheng, L. Zhang, Y. Niu, Y. Dai, Z. Pan, B. Li, F. He, and Y. Zheng
The Association of XRCC1 Haplotypes and Chromosomal Damage Levels in Peripheral Blood Lymphocyte among Coke-Oven Workers
Cancer Epidemiol. Biomarkers Prev., May 1, 2005; 14(5): 1295 - 1301.
[Abstract] [Full Text] [PDF]

Home page
 Nucleic Acids ResHome page
M. Sossou, C. Flohr-Beckhaus, I. Schulz, F. Daboussi, B. Epe, and J. P. Radicella
APE1 overexpression in XRCC1-deficient cells complements the defective repair of oxidative single strand breaks but increases genomic instability
Nucleic Acids Res., January 12, 2005; 33(1): 298 - 306.
[Abstract] [Full Text] [PDF]

Home page
 Hum Mol GenetHome page
N. Gueven, O. J. Becherel, A. W. Kijas, P. Chen, O. Howe, J. H. Rudolph, R. Gatti, H. Date, O. Onodera, G. Taucher-Scholz, et al.
Aprataxin, a novel protein that protects against genotoxic stress
Hum. Mol. Genet., May 15, 2004; 13(10): 1081 - 1093.
[Abstract] [Full Text] [PDF]

Home page
 Nucleic Acids ResHome page
I. I. Dianova, K. M. Sleeth, S. L. Allinson, J. L. Parsons, C. Breslin, K. W. Caldecott, and G. L. Dianov
XRCC1-DNA polymerase {beta} interaction is required for efficient base excision repair
Nucleic Acids Res., May 11, 2004; 32(8): 2550 - 2555.
[Abstract] [Full Text] [PDF]

Home page
 Cancer Epidemiol. Biomarkers Prev.Home page
X.-O. Shu, Q. Cai, Y.-T. Gao, W. Wen, F. Jin, and W. Zheng
A Population-Based Case-Control Study of the Arg399Gln Polymorphism in DNA Repair Gene XRCC1 and Risk of Breast Cancer
Cancer Epidemiol. Biomarkers Prev., December 1, 2003; 12(12): 1462 - 1467.
[Abstract] [Full Text] [PDF]

Home page
 Nucleic Acids ResHome page
A. Marintchev, M. R. Gryk, and G. P. Mullen
Site-directed mutagenesis analysis of the structural interaction of the single-strand-break repair protein, X-ray cross-complementing group 1, with DNA polymerase {beta}
Nucleic Acids Res., January 15, 2003; 31(2): 580 - 588.
[Abstract] [Full Text] [PDF]

Home page
 BloodHome page
C. Seedhouse, R. Bainton, M. Lewis, A. Harding, N. Russell, and E. Das-Gupta
The genotype distribution of the XRCC1 gene indicates a role for base excision repair in the development of therapy-related acute myeloblastic leukemia
Blood, November 15, 2002; 100(10): 3761 - 3766.
[Abstract] [Full Text] [PDF]

Home page
 Cancer Epidemiol. Biomarkers Prev.Home page
E. J. Duell, R. C. Millikan, G. S. Pittman, S. Winkel, R. M. Lunn, C.-K. J. Tse, A. Eaton, H. W. Mohrenweiser, B. Newman, and D. A. Bell
Polymorphisms in the DNA Repair Gene XRCC1 and Breast Cancer
Cancer Epidemiol. Biomarkers Prev., March 1, 2001; 10(3): 217 - 222.
[Abstract] [Full Text]

Home page
 Cancer Epidemiol. Biomarkers Prev.Home page
D. Ratnasinghe, S.-X. Yao, J. A. Tangrea, Y.-L. Qiao, M. R. Andersen, M. J. Barrett, C. A. Giffen, Y. Erozan, M. S. Tockman, and P. R. Taylor
Polymorphisms of the DNA Repair Gene XRCC1 and Lung Cancer Risk
Cancer Epidemiol. Biomarkers Prev., February 1, 2001; 10(2): 119 - 123.
[Abstract] [Full Text]

Home page
 Nucleic Acids ResHome page
U. Lakshmipathy and C. Campbell
Mitochondrial DNA ligase III function is independent of Xrcc1
Nucleic Acids Res., October 15, 2000; 28(20): 3880 - 3886.
[Abstract] [Full Text] [PDF]

Home page
 Nucleic Acids ResHome page
A. Marintchev, A. Robertson, E. K. Dimitriadis, R. Prasad, S. H. Wilson, and G. P. Mullen
Domain specific interaction in the XRCC1-DNA polymerase {beta} complex
Nucleic Acids Res., May 15, 2000; 28(10): 2049 - 2059.
[Abstract] [Full Text] [PDF]

Home page
 CarcinogenesisHome page
E. J. Duell, J. K. Wiencke, T.-J. Cheng, A. Varkonyi, Z. F. Zuo, T. D. S. Ashok, E. J. Mark, J. C. Wain, D. C. Christiani, and K. T. Kelsey
Polymorphisms in the DNA repair genes XRCC1 and ERCC2 and biomarkers of DNA damage in human blood mononuclear cells
Carcinogenesis, May 1, 2000; 21(5): 965 - 971.
[Abstract] [Full Text] [PDF]

Home page
 Mol. Cell. Biol.Home page
R. M. Taylor, D. J. Moore, J. Whitehouse, P. Johnson, and K. W. Caldecott
A Cell Cycle-Specific Requirement for the XRCC1 BRCT II Domain during Mammalian DNA Strand Break Repair
Mol. Cell. Biol., January 15, 2000; 20(2): 735 - 740.
[Abstract] [Full Text]

Home page
 StrokeHome page
M. Fujimura, Y. Morita-Fujimura, T. Sugawara, P. H. Chan, and C. Y. Hsu
Early Decrease of XRCC1, a DNA Base Excision Repair Protein, May Contribute to DNA Fragmentation After Transient Focal Cerebral Ischemia in Mice • Editorial Comment
Stroke, November 1, 1999; 30(11): 2456 - 2463.
[Abstract] [Full Text] [PDF]

Home page
 Cancer Res.Home page
R. M. Lunn, R. G. Langlois, L. L. Hsieh, C. L. Thompson, and D. A. Bell
XRCC1 Polymorphisms: Effects on Aflatoxin B1-DNA Adducts and Glycophorin A Variant Frequency
Cancer Res., June 1, 1999; 59(11): 2557 - 2561.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
S. Okano, S.-i. Kanno, S. Nakajima, and A. Yasui
Cellular Responses and Repair of Single-strand Breaks Introduced by UV Damage Endonuclease in Mammalian Cells
J. Biol. Chem., October 13, 2000; 275(42): 32635 - 32641.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Print PDF (146K) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrowRequest Permissions
Right arrow Commercial Re-use Guidelines
for Open Access NAR Content
Google Scholar
Right arrow Articles by Shen, M. R.
Right arrow Articles by Thelen, M. P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Shen, M. R.
Right arrow Articles by Thelen, M. P.
Social Bookmarking
Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?