| Nucleic Acids Research | Pages |
Dimerization of the testis brain RNA-binding protein (translin) is mediated through its C-terminus and is required for DNA- and RNA-binding
Introduction
Materials And Methods
Preparation of recombinant TB-RBP and its truncated forms
TB-RBP mobility shift assays
Glycerol gradient centrifugation of TB-RBP
Reducing and non-reducing SDS-PAGE of TB-RBP and its truncations
Yeast two hybrid assays
Results
Synthesis of truncated forms of TB-RBP
The C-terminus of TB-RBP is essential, but not sufficient for TB-RBP to bind DNA and RNA
TB-RBP forms dimers in vivo
The leucine zipper domain of TB-RBP is required for dimerization
TB-RBP forms dimers in vitro
TB-RBP in testicular extracts forms dimers
A dimer is the minimum DNA binding unit of TB-RBP
A disulfide bond involving cysteine 225 stabilizes TB-RBP dimers
Multimers of TB-RBP greater than dimers also bind DNA
Discussion
Acknowledgements
References
Dimerization of the testis brain RNA-binding protein (translin) is mediated through its C-terminus and is required for DNA- and RNA-binding
ABSTRACT
INTRODUCTION
The testis brain-RNA-binding protein (TB-RBP) was first identified as a RNA-binding protein in testis (1) where it binds to highly conserved elements in the 3[prime] untranslated regions of a number of mRNAs which are translated in male germ cells at specific stages of differentiation (2,3). TB-RBP can inhibit the in vitro translation of mRNA constructs containing specific consensus sequences (2) and also bind mRNAs to reconstituted microtubules from testis and brain (4). These data suggest that in the cytoplasm TB-RBP plays a role in translational regulation and in RNA movement and localization (2,4).
We have recently purified TB-RBP and cloned its cDNA (5). Sequence analysis shows that TB-RBP is the mouse homologue of the human protein translin, a single-stranded DNA binding protein which specifically binds to consensus sequences of breakpoints of chromosomal translocations in lymphomas (6). TB-RBP and translin are highly conserved, differing in 3 of 228 amino acids. Translin/TB-RBP is a 26 kDa protein which contains a leucine zipper in its C-terminus. As a DNA-binding protein, translin has been proposed to recognize single-stranded DNA ends generated at recombination hot spots (7). It may also function in DNA repair, since the DNA damaging reagents, mitomycin C and etoposide, initiate nuclear transport of translin (7).
To better understand the structural interactions between TB-RBP and single-stranded DNA and RNA, we have expressed full-sized and truncated forms of TB-RBP from a series of deletions of the cloned TB-RBP cDNA. Here we show that dimers of TB-RBP are the minimum binding unit for DNA- or RNA-binding and the C-terminus of TB-RBP is required for binding to DNA or RNA.
MATERIALS AND METHODS
Preparation of recombinant TB-RBP and its truncated forms
TB-RBP was expressed in Escherichia coli as a GST fusion protein and purified as previously described (5). Truncated forms of TB-RBP, generated by PCR amplification using specific synthetic oligodeoxynucleotides, were expressed and purified as previously reported for wild-type TB-RBP (5). Purified proteins were stored at -20°C in phosphate buffered saline with 10% glycerol.
TB-RBP mobility shift assays
Gel electrophoresis mobility shift assays were performed with the DNA probe, Bcl-CL1 or the RNA probe, transcript c (1,4,5). Bcl-CL1 was labeled with [[gamma]-32P]ATP using T4 polynucleotide kinase, while transcript c was transcribed in vitro from a pGem 3Z plasmid using SP6 RNA polymerase and [[alpha]-32P]CTP (5). Recombinant protein (100 ng) was incubated with 20 000-30 000 c.p.m. of DNA or RNA probe for 10 min at room temperature (RT) in 20 µl of binding buffer (20 mM HEPES, pH 7.6, 3 mM MgCl2 40 mM KCl, 0-10 mM DTT, 5% glycerol) and DNA-protein and RNA-protein complexes were detected by gel shift assays in 4% polyacrylamide gels (60:1) or in 6% polyacrylamide gels (19:1) in TBE buffer, respectively (5).
Glycerol gradient centrifugation of TB-RBP
Recombinant TB-RBP (10 µg) was incubated with 20 ng of 32P-labeled Bcl-CL1 for 10 min at RT in 100 µl of binding buffer. To calibrate the gradient, 40 µg of standard proteins (ovalbumin, 43 kDa; albumin, 67 kDa; aldolase, 158 kDa; catalase, 232 kDa; ferritin, 440 kDa; blue Dextran, 2000 kDa) were added to the sample and loaded immediately onto a 5 ml 4-15% glycerol gradient (containing 10 mM Na2HPO4 and 130 mM NaCl) (8). After centrifugation at 45 000 r.p.m. for 2.5 h at 20°C in a Beckmann Ti60 rotor, fractions (250 µl) were collected. Aliquots (40 µl) from each fraction were electrophoresed in a 10% SDS polyacrylamide gel (9), mobility shift assays were performed, and DNA-protein complexes were detected by radioautography (5). Proteins in the SDS gel were detected by Coomassie blue staining (10).
Reducing and non-reducing SDS-PAGE of TB-RBP and its truncations
Recombinant protein (1 µg in 10 µl of PBS) or testicular cytoplasmic extracts (20 µg) (5) were electrophoresed in reducing and non-reducing SDS polyacrylamide gels. For the reducing SDS polyacrylamide gels, protein samples were mixed with SDS loading buffer and boiled for 3 min before loading. For non-reducing SDS polyacrylamide gels, the protein samples were mixed with 2 µl of 50% glycerol containing 0.03% bromophenol blue and directly loaded onto gels without boiling. The reduced and non-reduced protein samples were loaded onto the same SDS polyacrylamide gels and electrophoresis was performed (9). Coomassie blue staining was used to detect the recombinant protein, and western blotting was used to detect TB-RBP in testicular extracts (5).
Yeast two hybrid assays
A cDNA encoding the complete open reading frame (ORF) of TB-RBP and cDNAs encoding truncated forms of TB-RBP were cloned into the EcoRI/SmaI sites of the bait plasmid pBD-GAL4 (Stratagene). A cDNA clone containing a complete ORF of TB-RBP was inserted into the EcoRI/XhoI sites of the target plasmid pAD-GAL4 (Stratagene). The latter clone was obtained by screening a testicular cDNA library from 17 day old mice using TB-RBP as the bait protein. The target plasmid encoding TB-RBP and the bait plasmid encoding TB-RBP or truncated forms of TB-RBP were co-transformed into yeast YRG2 cells. Transformants were selected on SD medium without leucine and tryptophane. Protein-protein interactions were detected by growth on SD medium lacking leucine, tryptophane and histidine and by the filter lift assay for [beta]-galactosidase. The procedures used for transformation and the filter lift assay were as described by the manufacturer (Stratagene).
Figure 1. Sequence of mouse TB-RBP and diagram of its truncated proteins. (A) Amino acid sequence of TB-RBP. The leucine zipper domain is in boldand the putative transmembrane domain is underlined. The sites where truncations and point mutations have been made are indicated by numbers. (B) A schematic representation of wild-type TB-RBP and its truncated forms. The leucine zipper region is designated as a thick line.
RESULTS
Synthesis of truncated forms of TB-RBP
TB-RBP is a protein of 228 amino acids which contains a leucine zipper motif in its C-terminus from amino acids 177 to 218 (see bold printed amino acids in Fig. 1A), a transmembrane helix from amino acids 93 to 114, and two relatively basic motifs from amino acids 56 to 64 and from 86 to 97. TB-RBP contains two cysteines at amino acids 57 and 225.
To determine which structural elements are important for DNA- and RNA-binding, a number of truncated, or sequence altered TB-RBP GST fusion proteins, were generated (Fig. 1B). In mutant TB-RBPC225A, the cysteine at amino acid 225 was changed to alanine. In mutant TB-RBP1-204, part of the leucine zipper domain was deleted, while the entire leucine zipper domain was deleted in mutants TB-RBP1-176 and TB-RBP1-116. In mutant TB-RBP1-90, both the leucine zipper and the transmembrane domain were deleted. Two additional constructs, TB-RBP177-228 and TB-RBP205-228, contain either the entire leucine zipper domain (amino acids 177-228), or part of the leucine zipper domain (amino acids 205-228).
Figure 2. Gel mobility shift assay of TB-RBP and its truncated or altered forms. GST-TB-RBP fusion proteins were incubated with 32P-labeled oligodeoxynucleotide Bcl-CL1 (GCCCTCCTGCCCTCCTTCCGCGGG) (A) or 32P-labeled RNA transcript c (B) for 10 min at RT. For the TB-RBP-RNA binding assay, heparin was added (final concentration of 5 mg/ml) after the incubation. DNA-TB-BP and RNA-TB-RBP complexes (indicated by arrowheads) were detected by mobility shift assays on a 4% native polyacrylamide gels (60:1). Figure 3. Yeast two hybrid assay. (A) Growth test of yeast transformants. Yeast YRG1 cells were co-transformed with pAD-GAL4 containing full length TB-RBP and pBD-GAL4 plasmids containing full length TB-RBP (wt), TB-RBP in which alanine replaces cysteine 225 or truncated forms of TB-RBP (1-204, 1-176, 1-116, 1-90, 1-43, 176-228 or 205-228). The transformants were plated onto SD dishes without leucine or tryptophane (left) or SD without leucine, tryptophane and histidine (right). (B) Filter lift assay for [beta]-galactosidase activity produced by yeast co-transformants plated on a SD dish without leucine and tryptophane and transferred onto a Whatman filter. The filter was frozen in liquid nitrogen briefly, placed over another filter soaked in Z buffer containing X-gal and 2-mercaptoethanol, and incubated at 30°C for 2 h. 
The C-terminus of TB-RBP is essential, but not sufficient for TB-RBP to bind DNA and RNA
To compare the nucleic acid binding properties of TB-RBP and its truncated forms, GST fusion proteins were synthesized. The control GST-TB-RBP binds the single-stranded DNA probe Bcl-CL1 (Fig. 2A, lane 2) and the RNA probe, transcript c (Fig. 2B, lane 2), while no binding is seen with GST alone (Fig. 2A and B, lane 1). Similar DNA- and RNA-binding activities are seen with the TB-RBP fusion protein in which the cysteine at amino acid 225 has been changed to alanine (Fig. 2A and B, lane 3). Truncated forms of TB-RBP containing amino acids 1-204, 1-175, 1-116, 1-90 and 1-43, do not bind DNA or RNA (Fig. 2A and B, lanes 4-10). This suggests an intact leucine zipper in the C-terminus of TB-RBP is essential for DNA- and RNA-binding. Since mutant TB-RBP177-228, consisting of the entire leucine zipper, does not show any DNA- or RNA-binding activity, we conclude the leucine zipper is essential but not sufficient for DNA- and RNA-binding (Fig. 2A and B, lane 9).
Figure 4. SDS-PAGE of recombinant TB-RBP and its truncated forms. Recombinant proteins (1 µg) were boiled in SDS loading buffer (R+) or mixed with 0.1 vol of 50% glycerol (R-) before loading. Proteins were electrophoresed in 10% SDS polyacrylamide gels and stained with Coomassie blue. Monomers and dimers of TB-RBP are indicated by single and double arrowheads, respectively.
TB-RBP forms dimers in vivo
To identify proteins that functionally interact with TB-RBP, we screened a mouse testis cDNA library using a full length TB-RBP cDNA as bait in a yeast two hybrid system assay. The first 10 positive clones we isolated encoded TB-RBP. For each of the positive clones, yeast co-transformants of bait and target plasmids containing TB-RBP were able to grow on SD medium lacking leucine, tryptophane and histidine (Fig. 3A). The positive clones also produce [beta]-galactosidase in a filter lift assay (Fig. 3B). These data demonstrate that two molecules of TB-RBP interact in vivo in yeast forming a dimer.
The leucine zipper domain of TB-RBP is required for dimerization
The yeast two hybrid system was also used to determine the domains of TB-RBP needed for dimerization in vivo. Co-transformants of pAD-GAL4-TB-RBP/pBD-GAL4-TB-RBP, pAD-GAL4-TB-RBP/pBD-GAL4-TB-RBPC225A and pAD-GAL4-TB-RBP/pBD-GAL4-TB-RBP1-204 can grow on SD medium without leucine, tryptophane and histidine (Fig. 3A). The co-transformants of pAD-GAL4-TB-RBP/pBD-GAL4-TB-RBP and pAD-GAL4TB-RBP/pBD-GAL4-TB-RBPC225A produce [beta]-galactosidase in filter lift assays, but the co-transformants of pAD-GAL4-TB-RBP/pBD-GAL4-TB-RBP1-204 do not (Fig. 3B). These data suggest that TB-RBP, TB-RBPC225A and TB-RBP1-204 form dimers in yeast cells, but the dimer of TB-RBP1-204 is less stable and is not maintained during the filter lift assay.
TB-RBP forms dimers in vitro
In SDS-PAGE, wild-type recombinant GST-TB-RBP migrates under non-reducing conditions as a dimer (double arrowhead in Fig. 4). No dimers are detected with GST-TB-RBP fusion proteins in which the cysteine at amino acid 225 is replaced by alanine (Fig. 4, lanes 3 and 4), the GST-TB-RBP fusion protein lacking the leucine zipper (Fig. 4, lanes 5 and 6), the leucine zipper alone (Fig. 4, lanes 7 and 8), or a region of the leucine zipper fused to GST (Fig. 4, lanes 9 and 10).
TB-RBP in testicular extracts forms dimers
To determine whether dimers could form with the TB-RBP present in mouse tissues, testicular extracts were incubated under non-reducing and reducing conditions and analyzed by SDS-PAGE. Results identical to those seen with recombinant TB-RBP were obtained, with dimers being detected in the absence of [beta]-mercapethanol (Fig. 5, lane 1). In the presence of [beta]-mercapethanol, virtually all of the testicular TB-RBP migrated as a monomer (Fig. 5, lane 2).
Figure 5. TB-RBP in testicular extracts forms dimers. Testicular cytoplasmic extract (20 µg) was treated under non-reducing (R-) or reducing (R+) conditions (see Materials and Methods) before loading onto a 10% SDS polyacrylamide gel. After electrophoresis, the proteins were transferred onto a nitrocellulose filter and TB-RBP was detected by western blotting with a polyclonal antibody to TB-RBP (5). The monomer and dimer of TB-RBP are indicated by single and double arrowheads, respectively.
A dimer is the minimum DNA binding unit of TB-RBP
A translin octamer is detected by electron microscopy when the human homologue of TB-RBP, translin, binds to single-stranded DNAs (7). To determine the minimum unit of TB-RBP that is capable of binding DNA, we have used glycerol gradient centrifugation to measure the size of TB-RBP-Bcl-CL1 complexes. We detect the majority of TB-RBP-DNA complexes in fractions 5-7 of the glycerol gradient, an estimated molecular size of between 43 and 67 kDa (Fig. 6). The majority of TB-RBP, as detected by Coomassie blue staining, sedimented similarly (data not shown), an expected result since dimerization does not require nucleic acid binding and Bcl-CL1 is only 24 nt. Since TB-RBP is [sim]26 kDa, this further established that a dimer is the minimum unit of TB-RBP for DNA binding.
Figure 6. The dimer is the minimum structural unit of TB-RBP for DNA binding. Recombinant TB-RBP was incubated with 32P-labeled Bcl-CL1 for 10 min at RT. After calibration proteins were added, the mixture was immediately centrifuged for 2.5 h at 45 000 r.p.m. in a 5 ml 4-15% glycerol gradient (prepared in 130 mM NaCl and 10 mM Na2HPO4, pH 7.2). Fractions (250 µl) were collected and aliquots from each fraction were analyzed by mobility shift assays on a 4% native polyacrylamide gel (66:1). The peak fractions for ovalbumin (43 kDa) and BSA (67 kDa) are marked with a thin bar. Peak fractions of the TB-RBP-Bcl-CL1 are indicated by a dashed line. Protein-RNA complexes are indicated by an arrowhead.
A disulfide bond involving cysteine 225 stabilizes TB-RBP dimers
The homodimer formed by TB-RBP can be detected by SDS-PAGE under non-reducing conditions, suggesting it is quite stable (Fig. 4, lane 1). Under the same non-reducing conditions, no dimers are detected with TB-RBP molecules in which the cysteine at amino acid 225 has been replaced with alanine (Fig. 4, lane 3), or with TB-RBP lacking part of the leucine zipper motif and cysteine 225 (Fig. 4, lane 5). This suggests that the disulfide-bond involving cysteine 225 is needed to maintain the stability of TB-RBP dimers.
The importance of disulfide bond formation between TB-RBP was confirmed by incubations of TB-RBP with DTT (Fig. 7). At concentrations of DTT as low as 1 mM (Fig. 7, lane 2), no dimers of recombinant TB-RBP are detected in non-reducing SDS-PAGE.
Figure 7. DTT reduces the stability of TB-RBP dimers. Recombinant TB-RBP was mixed with 0, 1, 5 and 10 mM DTT at RT and subjected to 10% SDS-PAGE. Proteins were detected by Coomassie blue staining. Monomers and dimers of TB-RBP are indicated by single and double arrowheads, respectively.
Multimers of TB-RBP greater than dimers also bind DNA
Mobility shift assays of recombinant TB-RBP and the single-stranded DNA, Bcl-CLI, reveal multimeric complexes with dimers as the major band (Fig. 8). The amount of multimer decreases with increasing concentrations of DTT, although the amount of dimer remains relatively constant.
DISCUSSION
TB-RBP/translin is a RNA- and DNA-binding protein which has been proposed to be involved in mRNA transport (4), translational regulation (2), DNA recombination (6) and DNA damage repair (7). Here we show that TB-RBP forms dimers in vivo in yeast (Fig. 3) and dimers are detected in non-reducing SDS polyacrylamide gels following in vitro incubations (Figs 4 and 5). We believe that the homodimers of TB-RBP are the minimum structure capable of binding DNA (Fig. 6), although we have also detected DNA-TB-RBP complexes of multimers of 4, 8 and possibly more, by mobility shift gel electrophoresis of recombinant TB-RBP in polyacrylamide gels (Fig. 8). An 8-member ring structure of translin that binds DNA has been detected by electron microscopy (7). Although DTT concentrations up to 10 mM did not decrease the amount of dimer DNA complexes we detected, the amounts of slower migrating multimers decrease in the presence of increasing amounts of DTT (Fig. 7). The dimer form of TB-RBP is also the minimum structure for RNA binding, since the RNA-TB-RBP complex has an electrophoretic mobility similar to that of DNA-TB-RBP complexes in mobility shift assays (Fig. 2, data not shown).
There are at least two structural elements in the C-terminus of TB-RBP, the leucine zipper domain, and cysteine 225, which are needed for dimerization of TB-RBP (Table 1). The leucine zipper motif is absolutely required for dimerization (Figs 3 and 5). Leucine zipper motifs form alpha-helices which interact with other alpha-helices and facilitate dimerization for many nucleic acid binding proteins (11). Although the leucine zipper motif of TB-RBP is essential, it is not sufficient to form a dimer alone, since TB-RBP176-228, a construct containing the complete leucine zipper, fails to interact with wild-type TB-RBP in a yeast two-hybrid assay and dimers of this truncated molecule are not detected in non-reducing SDS polyacrylamide gels (Figs 3 and 5). Although needed for dimerization, cysteine 225 appears to be dispensable for dimerization, because the substitution of alanine for cysteine 225 does not prevent protein-protein interactions in the yeast two hybrid assay (Fig. 3). Since no dimer is detected by SDS-PAGE when alanine replaces this cysteine (Fig. 4), this suggests that cysteine 225 does not initiate dimerization but only enhances the stability of the TB-RBP dimer. We propose that the leucine zipper, and perhaps additional regions of TB-RBP such as the transmembrane domain, facilitate dimerization of TB-RBP and cysteine 225 stabilizes the dimer through disulfide bond formation. The observation that the dimer formed with truncated protein TB-RBP1-204, which lacks cysteine 225 but has an intact leucine zipper, is less stable than TB-RBPC225A supports this hypothesis (Fig. 3).
Figure 8. TB-RBP complexes greater than dimers bind DNA. TB-RBP (100 ng) was incubated with 32P-labeled Bcl-CL1 at RT for 10 min in the presence of increasing amounts of DTT. The DNA-protein complexes were detected on a 6% native polyacrylamide gel (19:1). The dimeric complex was indicated by a double arrowhead and the multimer complexes were indicated by an asterisk. Although TB-RBP binds RNA as well as DNA, it does not contain any known RNA binding motif suggesting that the RNA binding may be mediated through the same domains used for single-stranded DNA binding. One of these domains is the C-terminus (Fig. 2). It is not clear, however, whether the leucine zipper domain alone or together with other sequences is required. The leucine zipper domain has been reported to be involved in DNA binding of many proteins (11). A basic leucine zipper-like domain was shown to be the major determinant of hnRNP C protein binding to RNA (12). Since the C-terminus is not sufficient for DNA- and RNA-binding (Fig. 2), other domain(s) of TB-RBP, such as the highly conserved basic regions, may be involved (13). It is also possible that dimerization of TB-RBP is required for DNA- and RNA-protein binding, since there is a good correlation between DNA- and RNA-binding and dimerization (Table 1). For a number of transcriptional regulatory proteins such as GCN4, c/EBP, CREB, Jun and MYC, the amino acid sequences required for DNA-binding include the leucine zipper as the dimerization domain and a DNA-binding domain enriched in basic amino acids (11,14-18). Dimer formation has been shown to be required for efficient DNA binding of some of these proteins (11). Table 1. Dimerization of proteins has been shown to be important for the regulatory functions of many proteins (11,18,19). Homodimerization and heterodimerization of a number of proteins have been shown to be involved in many cellular processes including the regulation of DNA binding (20), transcription (21), the cell cycle and apoptosis (19). Moreover large differences in binding site sizes are found for multimers of single-stranded DNA-binding proteins suggesting different binding modes may be associated with different metabolic processes (22). It will be of great interest to identify protein(s) interacting with TB-RBP to elucidate the biological functions of TB-RBP.
Protein
DNA binding
RNA binding
Dimerization
in vitro
in vivo
TB-RBP
+++
+++
+
+
TB-RBPC225A
++
++
-
+
TB-RBP1-204
-
-
-
-
TB-RBP1-175
-
-
-
-
TB-RBP1-116
-
-
-
-
TB-RBP1-90
-
-
-
-
TB-RBP1-43
-
-
-
-
TB-RBP176-228
-
-
-
-
TB-RBP205-228
-
-
-
-
ACKNOWLEDGEMENTS
We thank Dr E.M.Eddy of NIEHS for generously sharing yeast two hybrid system reagents and Ms J.Wood for her outstanding secretarial assistance. This research was supported by NIH grant HD28832.
REFERENCES
This page is run by Oxford University Press, Great Clarendon Street, Oxford OX2 6DP, as part of the OUP Journals
Comments and feedback: www-admin{at}oup.co.uk
Last modification: 24 Mar 1998
Copyright© Oxford University Press, 1998.
CiteULike 
Connotea 
Del.icio.us What's this?
This article has been cited by other articles:
|
|
 |
|
  S. H. Mellon, S. R. Bair, C. Depoix, J.-L. Vigne, N. B. Hecht, and P. B. Brake Translin Coactivates Steroidogenic Factor-1-Stimulated Transcription Mol. Endocrinol., January 1, 2007; 21(1): 89 - 105. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 O. Laufman, R. B. Yosef, N. Adir, and H. Manor Cloning and characterization of the Schizosaccharomyces pombe homologs of the human protein Translin and the Translin-associated protein TRAX Nucleic Acids Res., July 25, 2005; 33(13): 4128 - 4139. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Y. S. Cho, V. M. Chennathukuzhi, M. A. Handel, J. Eppig, and N. B. Hecht The Relative Levels of Translin-associated Factor X (TRAX) and Testis Brain RNA-binding Protein Determine Their Nucleocytoplasmic Distribution in Male Germ Cells J. Biol. Chem., July 23, 2004; 279(30): 31514 - 31523. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Yang, Y. S. Cho, V. M. Chennathukuzhi, L. A. Underkoffler, K. Loomes, and N. B. Hecht Translin-associated Factor X Is Post-transcriptionally Regulated by Its Partner Protein TB-RBP, and Both Are Essential for Normal Cell Proliferation J. Biol. Chem., March 26, 2004; 279(13): 12605 - 12614. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 G. B. GONSALVEZ, K. A. LEHMANN, D. K. HO, E. S. STANITSA, J. R. WILLIAMSON, and R. M. LONG RNA-protein interactions promote asymmetric sorting of the ASH1 mRNA ribonucleoprotein complex RNA, November 1, 2003; 9(11): 1383 - 1399. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 V. Chennathukuzhi, J. M. Stein, T. Abel, S. Donlon, S. Yang, J. P. Miller, D. M. Allman, R. A. Simmons, and N. B. Hecht Mice Deficient for Testis-Brain RNA-Binding Protein Exhibit a Coordinate Loss of TRAX, Reduced Fertility, Altered Gene Expression in the Brain, and Behavioral Changes Mol. Cell. Biol., September 15, 2003; 23(18): 6419 - 6434. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. Yang, V. Chennathukuzhi, K. Miki, D. A. O'Brien, and N. B. Hecht Mouse Testis Brain RNA-Binding Protein/Translin Selectively Binds to the Messenger RNA of the Fibrous Sheath Protein Glyceraldehyde 3-Phosphate Dehydrogenase-S and Suppresses Its Translation In Vitro Biol Reprod, March 1, 2003; 68(3): 853 - 859. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Z. Zhang, R. Sapiro, D. Kapfhamer, M. Bucan, J. Bray, V. Chennathukuzhi, P. McNamara, A. Curtis, M. Zhang, E. J. Blanchette-Mackie, et al. A Sperm-Associated WD Repeat Protein Orthologous to Chlamydomonas PF20 Associates with Spag6, the Mammalian Orthologue of Chlamydomonas PF16 Mol. Cell. Biol., November 15, 2002; 22(22): 7993 - 8004. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
P.T.K. Saunders, S.M. Maguire, S. Macpherson, M.C. Fenelon, S. Sakakibara, and H. Okano RNA Binding Protein Musashi1 Is Expressed in Sertoli Cells in the Rat Testis from Fetal Life to Adulthood Biol Reprod, February 1, 2002; 66(2): 500 - 507. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
V. M. Chennathukuzhi, Y. Kurihara, J. D. Bray, J. Yang, and N. B. Hecht Altering the GTP binding site of the DNA/RNA-binding protein, Translin/TB-RBP, decreases RNA binding and may create a dominant negative phenotype Nucleic Acids Res., November 1, 2001; 29(21): 4433 - 4440. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
X.-Q. Wu and N. B. Hecht Mouse Testis Brain Ribonucleic Acid-Binding Protein/Translin Colocalizes with Microtubules and Is Immunoprecipitated with Messenger Ribonucleic Acids Encoding Myelin Basic Protein, {alpha} Calmodulin Kinase II, and Protamines 1 and 2 Biol Reprod, March 1, 2000; 62(3): 720 - 725. [Abstract] [Full Text]
|
|
|
|
|
|
V. M. Chennathukuzhi, Y. Kurihara, J. D. Bray, and N. B. Hecht Trax (Translin-associated Factor X), a Primarily Cytoplasmic Protein, Inhibits the Binding of TB-RBP (Translin) to RNA J. Biol. Chem., April 13, 2001; 276(16): 13256 - 13263. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||