Skip Navigation

This Article
Right arrow Abstract Freely available
Right arrow Print PDF (58K) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (20)
Right arrowRequest Permissions
Right arrow Commercial Re-use Guidelines
for Open Access NAR Content
Google Scholar
Right arrow Articles by Okada, T.
Right arrow Articles by Blaese, R. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Okada, T.
Right arrow Articles by Blaese, R. M.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Nucleic Acids Research Pages 1947-1950


Efficient directional cloning of recombinant adenovirus vectors using DNA-protein complex
Introduction
Materials And Methods
   Plasmid construction
   Isolation of DNA-protein complexes
   Cloning of recombinant adenovirus using directed ligation of a purified transgene insert into DNA-protein complex
   Construction of recombinant adenovirus using homologous recombination
   Expression of transgene inserts
Results And Discussion
   Isolation of DNA-protein complexes
   Cloning efficiencies of recombinant adenoviruses
   Comparison with other cloning systems
Acknowledgements
References


Efficient directional cloning of recombinant adenovirus vectors using DNA-protein complex

Efficient directional cloning of recombinant adenovirus vectors using DNA-protein complex Takashi Okada, W. Jay Ramsey*, Jamalah Munir, Oliver Wildner and R. Michael Blaese

Clinical Gene Therapy Branch, National Human Genome Research Institute, National Institute of Health, Bethesda, MD 20892-1851, USA

Received December 30, 1997; Revised and Accepted March 4, 1998

ABSTRACT

We describe an efficient cloning system utilizing adenoviral DNA-protein complexes which allows the directional cloning of genes into adenoviral expression vectors in a single step. DNA-protein complexes derived from a recombinant adenovirus (AVC2.null) were isolated by sequential use of CsCl step gradients followed by isopycnic centrifugation in a mixture of CsCl and guanidine HCl. AVC2.null is an adenoviral expression vector containing unique restriction sites between the human CMV-IE promoter and the SV40 intron/polyadenylation site. Transgenes were prepared for cloning into this vector by introduction of compatible restriction sites by PCR. A vector expressing rat granulocyte-macrophage colony-stimulating factor (GM-CSF) was constructed using DNA-protein complex as well as by traditional recombination techniques. The efficacy of our adenoviral cloning system utilizing DNA-protein complex was two logs higher than that seen using homologous recombination. All viruses generated by directional ligation of the insert into the vector DNA-protein complexes contained the desired transgene in the correct orientation. This technique greatly simplifies and accelerates the generation of recombinant adenoviral vectors.

INTRODUCTION

Adenoviruses are double stranded linear DNA viruses which are efficient gene transfer vectors for a variety of cell types. They have been used as expression vectors in clinical trials for vaccination (1,2) and gene therapy (3-5). The most widely used method to generate recombinant adenoviruses involves transfection of one segment of deproteinized DNA (isolated from virions or contained within plasmids or cosmids) comprising most or all viral genes and the right viral terminus, in combination with another plasmid containing the desired expression cassette, the left viral DNA terminus, and a segment of adenoviral sequences in common to both molecules which permits homologous recombination. This method of cloning recombinant adenoviruses is time consuming and inefficient despite significant advances in the design of adenoviral plasmids (6) and alternative transfection techniques (7). Ad5 DNA has terminal proteins covalently linked to its ends which enhances the infectivity up to three logs above that obtained by DNA completely free of proteins (8). In this report we describe the development of an adenovirus cloning system that permits the use adenoviral DNA-protein complexes for the rapid and efficient generation of recombinant adenoviruses.

MATERIALS AND METHODS

Plasmid construction

The shuttle plasmid pAVC2 (9), constructed within a pBluescript SK+ (Stratagene, La Jolla, CA, USA) backbone is comprised of Ad5 nucleotide bases 0-400, CMV-IE promoter and enhancer from pCDM8 (Invitrogen, Carlsbad, CA), a multiple cloning site (5'-XbaI-BamHI-PmeI-NspV-SunI-3'), SV40 intron and polyadenylation site from pCDM8 and a Ad5 BglII-HindIII fragment (Ad5 nucleotides 3328-6241; E1b/E2b). Rat granulocyte-macrophage colony-stimulating factor (GM-CSF) cDNA was amplified from a rat macrophage cDNA library (Clontech, Los Angeles, CA) by PCR using the primers GM-5': GCtctaga GCCTCACCCAACCCTGTCACCC and GM-3': CCatcgatCCTCCTCATTTCTGGACCGGC. The PCR product, which contained the newly introduced 5'-XbaI and 3'-ClaI sites (underlined in the primer sequence) was directly cloned into pCR II (Invitrogen, CA) by a TA-cloning strategy generating pCR-II.rGM-CSF the structure of which was confirmed by restriction mapping and sequencing.

Isolation of DNA-protein complexes

The adenoviral expression vector AVC2.null was generated by calcium phosphate co-precipitation of pAVC2 and pJM17 (10) in 293 cells (11) (kindly provided by Frank Graham, McMaster University, Hamilton, Ontario) as previously described (6). AVC2.null was used to infect 1 × 109 293 cells at a MOI of 10. Cells were harvested 36-44 h post-infection and lysed by freezing and thawing three times. The crude viral lysate was spun at 15 000 g for 5 min and the supernatant material was collected. This material was then loaded onto a two-tier CsCl gradient (1.25 and 1.40 g/ml) in 10 mM Tris (pH 8.0) and 1 mM MgCl2. The gradient was spun at 35 000 r.p.m. for 1 h at 4°C in a SW 41 rotor (Beckman Instruments, Palo Alto, CA). The viral band was collected and mixed with an equal volume of 6 M guanidine HCl. To this solution 4 M guanidine HCl/CsCl ([rho] = 1.65 g/ml) and 1 mg of ethidium bromide was added to a final volume of 5.0 ml. CsCl/4 M guanidine HCl was prepared by slowly adding CsCl powder to a stock solution of 4 M guanidinium HCl. Saturation occured at a final density of 1.65 g/ml. This material was centrifuged at 650 000 g in a NVT 90 rotor (Beckman, Fullerton, CA) for 4 h. The band containing DNA-protein complex was visualized with UV light (365 nm) and, after aspiration, diluted to 15 ml with 6 M guanidine HCl. Using a Centriprep 100 (Amicon, Beverly, MA) the material was desalted by three cycles of dilution to 15 ml with TE buffer (pH 8.0) and successive concentration to 0.8 ml according to the manufacturer's instructions. In three independent experiments the yield of AVC2.null DNA-protein complex `arms' was ~100 µg/1 × 109 293 cells.

Cloning of recombinant adenovirus using directed ligation of a purified transgene insert into DNA-protein complex

Plasmid pCR-II.rGM-CSF was amplified in DM-1 (LTI, Grand Island, NY) and the cDNA insert encoding rGM-CSF was excised by restriction digest with XbaI and ClaI, purified by gel electrophoresis, and extracted from the agarose with QIAquick Gel Extraction Kit (Qiagen, Hilden, Germany). AVC2.null DNA-protein complex was digested with XbaI and NspV and treated with bacterial alkaline phosphatase (LTI, Grand Island, NY) at 37°C for 30 min. Enzymes and the 30 bp restriction fragment generated by digestion with XbaI and NspV were removed by three cycles of dilution with TE (pH 8.0) and concentration using a Centricon 100 per manufacturers instructions. The purified transgene insert was mixed with 0.2 µg of XbaI and NspV digested AVC2.null DNA-protein complex at a molar ratio of 3:1 and ligated with 5 Weiss units of T4 DNA ligase (New England Biolabs, Beverly, MA) in a volume of 10 µl overnight at 16°C. The ligated samples were desalted using a Centricon 100 and transfected onto 293 cells by calcium phosphate co-precipitation and overlaid with agar as previously described (6) (Fig. 1A). To determine the efficiency of the recombinant adenovirus generation, plaques of the transfected 293 cells were counted.


Figure 1. (A) and (B) Schematic representation of the generation of recombinant adenoviruses using either (A) the AVC2.null DNA-protein complex method or (B) the conventional homologous recombination of pAVC2.rGM-CSF and pJM17, respectively. The multiple cloning sites of the adenoviral DNA-protein complex contains XbaI and NspV restriction sites, each of which generates termini compatible with those generated by at least three additional restriction enzymes (XbaI is compatible with AvrII, SpeI and NheI and NspV is compatible with ClaI, NarI, Psp1406I, BsaHI, some AccI, and several four base recognition site enzymes).

Construction of recombinant adenovirus using homologous recombination

To compare the efficacy of the method described here, we also generated AVC2.rGM-CSF by homologous recombination. The rGM-CSF cDNA insert was excised from the pCRII.rGM-CSF with XbaI and ClaI, and cloned into XbaI and NspV digested pAVC2 to generate pAVC2.rGM-CSF. To generate recombinant adenovirus, 10 µg of pAVC2.rGM-CSF and 10 µg of pJM17 were co-transfected into 293 cells by calcium phosphate co-precipitation as described previously (6) (Fig. 1B).

Expression of transgene inserts

Virus plaques were isolated, frozen and thawed three times, and inoculated into 293 cells in 24-well plates. After incubation at 37°C for 72 h, the supernatant in each well was analyzed with PCR using the primers GM-5' and GM-3'. Western blot analysis of 293 cells infected with clones of AVC2.rGM-CSF was performed using the monoclonal antibody MAS588p (1: 100 dilution, Accurate, NY) and ECL® (Amersham International, Buckinghamshire, UK) as the detection system according to the manufacturer's instructions. [beta]-Actin served as an internal control and was detected with the monoclonal antibody AC-15 (1:5000 dilution, Sigma, St. Louis, MO).

RESULTS AND DISCUSSION

Isolation of DNA-protein complexes

The replication deficient recombinant adenovirus AVC2.null was generated by homologous recombination of pAVC2 and pJM17 in 293 cells. This virus does not express a heterologous transgene and has two BstZ17I restriction sites at nucleotide positions 4261 and 27490 (Fig. 1A).The presence of the terminal proteins of the AVC2.null DNA-protein complex was demonstrated by restriction digest with BstZ17 to generate three fragments. As two of these are covalently attached to terminal protein they can not migrate into a 1% agarose gel under the conditions we standardly use for gel electrophoresis (Fig. 2, lane 2). However, when digested with proteinase K to remove the terminal protein, all three DNA fragments were readily visible in an ethidium bromide stained agarose gel (Fig. 2, lane 3). Recombinant adenoviruses expressing genes of interest were generated by directional ligation of a purified transgene insert into DNA-protein complex and by conventional homologous recombination technique (Fig. 1A and B).


Figure 2. Identification of DNA-protein complex by digestion patterns. In order to confirm the structure and presence of the terminal protein, AVC2.null DNA-protein complex was subjected to digestion with BstZ17. This generated three fragments, of which two have terminal proteins attached covalently to their termini and thus cannot migrate into the ethidium bromide stained 1% agarose gel (-Prot.K). After treatment of the digest with proteinase K (+Prot.K), two additional fragments of the expected size are visible. Lane M containes [lambda] DNA/HindIII fragments.

The use of adenovirus DNA-protein complex rather than deproteinized genomic adenovirus DNA (either directly from virus or as a plasmid) allows efficient recovery of the desired recombinant adenovirus (8,12,13). In the homologous recombination system reported by Miyake and co-workers (14), DNA-protein complex was digested at several sites with EcoT22I or AseI/EcoRI to reduce the generation of non-recombinant virus. Our method prevents regeneration of the parental virus by creating non-compatible XbaI and NspV overhanging 5'-ends on the isolated DNA-protein complex `arms'. Dephosphorylation of these ends with bacterial alkaline phosphatase (BAP) further reduces the ligation efficiency of any contaminating viral DNA fragments. Finally, removal of the small DNA fragment created by digestion of the multiple cloning site (MCS) occurs during removal of BAP from the DNA-protein complex, further reducing the possible generation of non-recombinant viruses.

Cloning efficiencies of recombinant adenoviruses

The infectivity of ligated DNA-protein complex was 100-fold higher than that seen with conventional cloning methods using homologous recombination (Table 1). The removal of terminal protein by enzymatic digeston with proteinase K effectively eliminated the infectivity increment associated with using DNA-protein complexes. Using AVC2.null DNA-protein complex digested with XbaI and NspV, all viruses screened for the presence and appropriate orientation of the transgene by PCR were positive (six out of six plaques, data not shown). Western blot analysis of 293 cells infected with AVC2.rGM-CSF confirmed the expression of rGM-CSF (Fig. 3).


Figure 3. rGM-CSF expression. Western blot analysis of 293 cells infected with AVC2.rGM-CSF demonstrated the expression of the transgene.

Table 1. Efficiency of various cloning techniques in the generation of recombinant adenoviruses
Transfection p.f.u./µga
pAVC2.rGM-CSF + pJM17 0.3
rGM-CSF insert + AVC2.null DNA-protein complexb
(Proteinase K-treated)
0.5
rGM-CSF insert + AVC2.null DNA-protein complex 30
aVirus plaques were counted on the transfected 293 cells to estimate the infectivity. Similar results were obtained with this technique when tested on repeated occasions.
bAVC2.null DNA-protein complex was deproteinized prior to transfection onto 293 cells.

Comparison with other cloning systems

This method allows the directional cloning of transgenes into an expression cassette in a single step to generate an E1-deleted recombinant adenovirus without the requirement for homologous recombination. This system permits direct cloning of PCR products, after digestion with the appropriate restriction endonucleases, into the adenoviral DNA-protein complex without a need to subclone transgenes into a shuttle plasmid. The system described by Miyake and colleagues (14) also utilizes adenoviral DNA-protein complex. It uses SwaI, which generates blunt termini, as the cloning site for the desired transgene, and does not allow directional cloning. Furthermore their method relies on homologous recombination and regeneration of wild-type adenovirus occurs, although at relatively low frequencies.

Hardy and colleagues (15) describe a method which relies on Cre-loxP mediated recombination to introduce transgenes and to confer negative selection on non-recombinant viruses in order to generate a population containing the desired recombinant vector which can then be plaqued and screened. With our technique we have not observed plaques after ligation of the left and right viral arms of the DNA-protein complex unless a transgene insert with compatible ends is present during the ligation, obviating any need for a period of negative selection (16). Plaque formation typically occurs 6-9 days after transfection, significantly faster than observed using homologous recombination techniques (data not shown).

Systems based on the cloning and manipulation of the full-length adenovirus genome as a stable plasmid in Escherichia coli have been reported which use bacterial homologous recombination machinery to allow the introduction of multiple independent modifications within the virus genome (17,18). The opportunity to omit all bacterial cloning steps, including both screening and amplification, significantly increases the simplicity and rapidity of generating clonal recombinant adenoviruses relative to methods based upon recombination in either eukaryotic or prokaryotic hosts and would have this advantage relative to other systems in use, including those based on Cre-loxP recombination. The preparation of the DNA-protein complex is straightforward and requires no more time than plasmid purification by double CsCl equilibrium centrifugation. The MCS of the adenoviral DNA-protein complex contains XbaI and NspV restriction sites, each of which generates termini compatible with those generated by at least three additional restriction enzymes (XbaI is compatible with AvrII, SpeI and NheI and NspV is compatible with ClaI, NarI, Psp1406 I, BsaHI, some AccI, and several four base recognition site enzymes), giving a low probability that a transgene would contain all potentially usable restriction sites. An average DNA-protein complex preparation from 1 × 109 AVC2.null-infected 293 cells yields enough material to generate ~1000 recombinant adenovirus clones. Similar protocols utilizing DNA-protein complexes from different adenoviral constructs should further enhance this alternative to existing methods for the generation of recombinant adenoviruses.

ACKNOWLEDGEMENTS

The authors wish to acknowledge Dr Masafumi Onodera, Dr John Morris and Jim Higginbotham for helpful discussion and support.

REFERENCES

1. Gurwith, M.J., Horwith, G.S., Impellizzeri, C.A., Davis, A.R., Lubeck, M.D. and Hung, P.P. (1989) Semin. Respir. Infect. 4, 299-303. MEDLINE Abstract

2. Ertl, H.C. and Xiang, Z. (1996) J. Immunol. 156, 3579-3582. MEDLINE Abstract

3. Brody, S.L. and Crystal, R.G. (1994) Ann. NY Acad. Sci. 716, 90-101. MEDLINE Abstract

4. Crystal, R.G., McElvaney, N.G., Rosenfeld, M.A., Chu, C.S., Mastrangeli, A., Hay, J.G., Brody, S.L., Jaffe, H.A., Eissa, N.T. and Danel, C. (1994) Nature Genet. 8, 42-51. MEDLINE Abstract

5. Bowers, W.J., Howard, D.F. and Federoff, H.J. (1997) Exp. Neurol. 144, 58-68. MEDLINE Abstract

6. Graham, F.L. and Prevec, L. (1992) Biotechnology 20, 363-390. MEDLINE Abstract

7. Zhang, W.W., Fang, X., Branch, C.D., Mazur, W., French, B.A. and Roth, J.A. (1993) Biotechniques 15, 868-872. MEDLINE Abstract

8. Jones, N. and Shenk, T. (1978) Cell 13, 181-188. MEDLINE Abstract

9. Lozier, J., Yankaskas, J., Ramsey, J., Chen, L., Berschneider, H. and Morgan, R. (1997) Hum. Gene Ther. 8, 1481-1490. MEDLINE Abstract

10. McGrory, W.J., Bautista, D.S. and Graham, F.L. (1988) Virology 163, 614-617. MEDLINE Abstract

11. Graham, F.L., Smiley, J., Russell, W.C. and Nairn, R. (1977) J. Gen. Virol. 36, 59-74. MEDLINE Abstract

12. Robinson, A.J., Younghusband, H.B. and Bellett, A.J. (1973) Virology 56, 54-69. MEDLINE Abstract

13. Sharp, P.A., Moore, C. and Haverty, J.L. (1976) Virology 75, 442-456. MEDLINE Abstract

14. Miyake, S., Makimura, M., Kanegae, Y., Harada, S., Sato, Y., Takamori, K., Tokuda, C. and Saito, I. (1996) Proc. Natl. Acad. Sci. USA 93, 1320-1324. MEDLINE Abstract

15. Hardy, S., Kitamura, M., Harris-Stansil, T., Dai, Y. and Phipps, M.L. (1997) J. Virol. 71, 1842-1849. MEDLINE Abstract

16. Imler, J.L., Chartier, C., Dieterle, A., Dreyer, D., Mehtali, M. and Pavirani, A. (1995) Gene Ther. 2, 263-268. MEDLINE Abstract

17. Chartier, C., Degryse, E., Gantzer, M., Dieterle, A., Pavirani, A. and Mehtali, M. (1996) J Virol 70, 4805-4810. MEDLINE Abstract

18. Crouzet, J., Naudin, L., Orsini, C., Vigne, E., Ferrero, L., Le, Roux, A., Benoit, P., Latta, M., Torrent, C., Branellec, D. et al. (1997) Proc. Natl. Acad. Sci. USA 94, 1414-1419. MEDLINE Abstract


*To whom correspondence should be addressed at: Clinical Gene Therapy Branch, NHGRI, NIH, Building 10, Room 10C103, MSC 1851, Bethesda, MD 20892-1851, USA. Tel: +1 301 402 4878; Fax: +1 301 496 7184; Email: jramsey@nhgri.nih.gov
The authors wish it to be known that, in their opinion, the first two authors should be regarded as joint First Authors


This page is run by Oxford University Press, Great Clarendon Street, Oxford OX2 6DP, as part of the OUP Journals
Comments and feedback: www-admin{at}oup.co.uk
Last modification: 27 Mar 1998
Copyright© Oxford University Press, 1998.

Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
J. Virol.Home page
M. Hillgenberg, C. Hofmann, H. Stadler, and P. Loser
High-efficiency system for the construction of adenovirus vectors and its application to the generation of representative adenovirus-based cDNA expression libraries.
J. Virol., June 1, 2006; 80(11): 5435 - 5450.
[Abstract] [Full Text] [PDF]


Home page
Nephrol Dial TransplantHome page
J. Fujishiro, S.-i. Takeda, Y. Takeno, K. Takeuchi, Y. Ogata, M. Takahashi, Y. Hakamata, T. Kaneko, T. Murakami, T. Okada, et al.
Gene transfer to the rat kidney in vivo and ex vivo using an adenovirus vector: factors influencing transgene expression
Nephrol. Dial. Transplant., July 1, 2005; 20(7): 1385 - 1391.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
O. Wildner and J. C. Morris
The Role of the E1B 55 kDa Gene Product in Oncolytic Adenoviral Vectors Expressing Herpes Simplex Virus-tk: Assessment of Antitumor Efficacy and Toxicity
Cancer Res., August 1, 2000; 60(15): 4167 - 4174.
[Abstract] [Full Text]


This Article
Right arrow Abstract Freely available
Right arrow Print PDF (58K) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (20)
Right arrowRequest Permissions
Right arrow Commercial Re-use Guidelines
for Open Access NAR Content
Google Scholar
Right arrow Articles by Okada, T.
Right arrow Articles by Blaese, R. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Okada, T.
Right arrow Articles by Blaese, R. M.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?