Skip Navigation

This Article
Right arrow Abstract Freely available
Right arrow Print PDF (238K) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (48)
Right arrowRequest Permissions
Right arrow Commercial Re-use Guidelines
for Open Access NAR Content
Google Scholar
Right arrow Articles by Priestley, A.
Right arrow Articles by Taccioli, G. E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Priestley, A.
Right arrow Articles by Taccioli, G. E.
Social Bookmarking
Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Nucleic Acids Research Pages 1965-1973

Molecular and biochemical characterisation of DNA-dependent protein kinase-defective rodent mutant irs-20
Introduction
Materials And Methods
   Cell culture
   cDNA synthesis and sequencing
   PCR
   Northern blot analysis
   End binding and DNA-PK assays
   Immunoblotting
   YAC libraries screened
   YAC growth conditions, retrofitting, pulse field gel analysis and transfer to mammalian cells
Results
   Expression of the DNA-PK components in irs-20
   DNA-PKcs from irs-20 cells is able to interact with DNA but lacks kinase activity
   Sequence analysis of the 3'-terminal region of the DNA-PKcs cDNA from irs-20 cells
   Complementation of irs-20 by YACs encoding human DNA-PKcs
   Complementation of irs-20and V-3 cells by YACs encompassing mouse DNA-PKcs
   Examination of hybrid YAC fusion clones
Discussion
Acknowledgements
References


Molecular and biochemical characterisation of DNA-dependent protein kinase-defective rodent mutant irs-20

Molecular and biochemical characterisation of DNA-dependent protein kinase-defective rodent mutant irs-20 A. Priestley, H. J. Beamish, D. Gell1, A. G. Amatucci2, M. C. Muhlmann-Diaz3, B. K. Singleton, G. C. M. Smith1, T. Blunt, L. C. Schalkwyk4, J. S. Bedford3, S. P. Jackson1, P. A. Jeggo* and G. E. Taccioli2

MRC Cell Mutation Unit, University of Sussex, Brighton BN1 9RR, UK, 1Wellcome CRC Institute and Department of Zoology, Cambridge University, Tennis Court Road, Cambridge CB2 1QR, UK, 2Boston University, School of Medicine, Department of Microbiology, 80E Concorde Street, Boston, MA 02118, USA, 3Department of Radiological Health Sciences, Colorado State Univeristy, Fort Collins, CO 80523, USA and 4Max Planck Institut fur Molekulare Genetik, Ihnestrasse 73, D14195 Berlin-Dahlem, Germany

Received December 8, 1997; Revised and Accepted February 18, 1998

ABSTRACT

The catalytic subunit of the DNA-dependent protein kinase (DNA-PKcs) is a member of a sub-family of phosphatidylinositol (PI) 3-kinases termed PIK-related kinases. A distinguishing feature of this sub-family is the presence of a conserved C-terminal region downstream of a PI 3-kinase domain. Mutants defective in DNA-PKcs are sensitive to ionising radiation and are unable to carry out V(D)J recombination. Irs-20 is a DNA-PKcs-defective cell line with milder [gamma]-ray sensitivity than two previously characterised mutants, V-3 and mouse scid cells. Here we show that the DNA-PKcs protein from irs-20 cells can bind to DNA but is unable to function as a protein kinase. To verify the defect in irs-20 cells and provide insight into the function and expression of DNA-PKcs in double-strand break repair and V(D)J recombination we introduced YACs encoding human and mouse DNA-PKcs into defective mutants and achieved complementation of the defective phenotypes. Furthermore, in irs-20 we identified a mutation in DNA-PKcs that causes substitution of a lysine for a glutamic acid in the fourth residue from the C-terminus. This represents a strong candidate for the inactivating mutation and provides supportive evidence that the extreme C-terminal motif is important for protein kinase activity.

INTRODUCTION

DNA-dependent protein kinase (DNA-PK) consists of the heterodimeric Ku protein, comprising subunits of 80 and 70 kDa, and a large catalytic component termed the catalytic subunit (DNA-PKcs) (1,2). Ku serves as a DNA targetting component, specifically recognising double-stranded (ds) DNA ends and binding of DNA-PKcs to DNA-bound Ku triggers the kinase activity. DNA-PK has been shown to function in DNA double-strand break repair and V(D)J recombination (for reviews see 3,4). DNA-PKcs at 14 kb is one of the largest cDNAs known and is a member of a sub-family of phosphatidylinositol (PI) 3-kinases, termed PIK-related kinases (5). In common with other members of the PI 3-kinase superfamily, DNA-PKcs has a conserved kinase motif close to its C-terminus. PIK-related kinases, including DNA-PKcs, have, in addition, a highly conserved domain at their extreme C-terminus (6-8). All members of this sub-family are large proteins and include the ATM protein, Schizosaccharomyces pombe rad3p and its homologues Mec1p, mei41, Tel1p, FRAP, Tor1p and Tor2p.

Radiation-sensitive mutants of cultured rodent cell lines have been categorised into complementation groups designated IR groups 1-10 (9,10). Members of three groups (4, 5 and 7) exhibit almost identical properties, including defects in DNA double-strand break rejoining and inability to carry out V(D)J recombination (11). The genes (XRCC5 and XRCC7) defined by two of these groups (5 and 7) encode components of DNA-PK (Ku80 and DNA-PKcs respectively) (12-16). Rodent mutants defective in Ku70 have not been identified in mutant hunts screening for radiosensitivity, but knock-out Ku70 embryonic stem cell lines have been constructed and display the anticipated ionising radiation sensitivity and V(D)J recombination defects (17). XRCC4, the gene defined by IR group 4, has also been cloned and recently shown to interact tightly with DNA ligase IV (18,19). The associated defect in V(D)J recombination in these mutants was surprising and is not a phenotype displayed by radio-sensitive mutants belonging to the other complementation groups. An early step during V(D)J recombination is formation of a site-specific double-strand break at the sub-exon segments that ultimately form the immunoglobulin and T cell receptor loci (for reviews see 20-22). The cell therefore appears to utilise the same machinery, which involves DNA-PK and the product of XRCC4, to repair radiation-induced double-strand breaks and enzyme-induced site-specific double-strand breaks introduced during development of the immune response.

A number of group 5 mutants (xrs 1-6, sxi 1 and 3, XRV-15B and XRV9B) have been isolated and the mutational change in XRCC5 (Ku80) has been identified for some of them (23-26). The mutations reported to date result in large deletions in Ku80 cDNA or lack of expression of Ku80 protein and have therefore not been informative for identification of important residues. All the Ku80 mutants lack both dsDNA end binding activity and detectable DNA-PK activity. They also lack Ku70 as well as Ku80 protein, indicating that co-association of the two Ku subunits is required for their stabilisation. Whilst studies involving site-directed mutagenesis are in progress to identify and investigate important domains within Ku70 and Ku80 (see for example 24,27), such an approach is proving difficult with DNA-PKcs due to its large size. An alternative and complementary approach is to characterise mutants defective in these proteins.

The scid cell line derived from the SCID mouse is a well-characterised group 7 mutant. Scid cells retain DNA end binding activity but lack detectable DNA-PK activity and have been shown to harbour a nonsense mutation in the C-terminus of DNA-PKcs resulting in a protein truncated by 83 amino acids (14-16,28-30). V-3, which is derived from the hamster CHO AA8 cell line represents another group 7 mutant. In this case no residual DNA-PKcs protein can be detected (14,16,31). Recently irs-20, a radio-sensitive mutant derived from another CHO cell line, CHO 10B2, has been shown to belong to the same complementation group (32-34). Irs-20 differs from V-3 and scid cells in showing less sensitivity to ionising radiation, indicating that it may retain some residual protein function. In this study we have characterised irs-20 at the biochemical level and have identified a mutational change in the C-terminus of DNA-PKcs. Our results suggest an explanation for the phenotype of irs-20 cells and provide supportive evidence that the highly conserved C-terminal region that lies downstream of the PI 3-kinase domain is required for kinase activity. To complement these studies YACs encoding human and mouse DNA-PKcs were introduced into irs-20 and V-3 cells and substantial complementation was achieved. The results provide evidence for further interactions between the components of DNA-PK and additional proteins.

MATERIALS AND METHODS

Cell culture

Irs-20 was isolated from a mutagenised culture of Chinese hamster ovary (CHO) 10B2 cells as described previously (32). V-3 and xrs-6 cells were derived from the CHO cell lines AA8 and CHO-K1 respectively (31,35). V-3 cells were a gift from Dr G.Whitmore. The scid cell line SCGR11 is an immortalised line derived from neonatal scid mice and was obtained from D.Weaver (36). Cells were cultured in minimal essential medium (Gibco) supplemented with non-essential amino acids and 10% fetal calf serum. Estimation of [gamma]-ray sensitivity was as described previously (32,37). A dose rate of 1.3 Gy/min was utilised for the high dose rate experiments. For the continuous exposure experiments (low dose rate) the dose rates utilised were from 3 to 12 cGy/h. V(D)J recombination assays were carried out as described previously (38,39)

cDNA synthesis and sequencing

Poly(A)+ RNA was extracted from 5 × 107 cells using a Quickprep Micro mRNA Purification Kit (Pharmacia Ltd). cDNA was synthesised from 0.5-1.0 µg poly(A)+ RNA using oligo(dT) primers and reverse transcriptase. For irs-20 sequencing, RT-PCR products were amplified using PfuI polymerase and primers A and HCS6, the products were cloned into pCR.22 and sequenced from single-stranded (ss)DNA using a Sequenase kit (Amersham Life Science Inc.).

PCR

PCR was carried out in 20 µl containing 2 µl 10× PCR buffer (500 mM KCl, 100 mM Tris-HCl, pH 8.3, 15 mM MgCl2, 0.1% gelatin), 1.5 µl dNTPs (2.5 mM each dATP, dCTP, dGTP and dTTP), 2-5 pmol each oligonucleotide primer and 0.25 U Taq polymerase (HT Biotechnology Ltd). When necessary amplified products were separated on LMP agarose gels, excised and cleaned using the Wizard DNA Clean-up System (Promega Ltd) and cloned into a T vector (40). The annealing temperature was routinely 60°C, except for primer pairs HCS24/HCS20 and HCS6/MCS4, which were annealed at 68 and 65°C respectively. Primers utilised were (5' -> 3'): primer A, CACTTCACTTGAGTCTCTTCT; MCS4, GAAGAGACTCAAGTGAAGTGC; HCS6, CTGCTGTCAGTGAAGGTCTAGGAG; MCS2, GTCAGTCTCATGTTGCCAATG; MCS5, AGTTATAACAGCTGGGTTGGC; HCS20, ACCGAGGAGCCAGTGGCTGAT; HCS24, GGAGCTAATCGTACAGAAACAGTCACGGCT; HCS7, AAGAAAAAGTGATGCTGGAG; MCS6, GAGGAGCCAGTGGCTGATGCA; HCS4, GACTCAAAGCCACCTGGGAACCTG.

Northern blot analysis

Aliquots of 8.5 µg total RNA were size separated by electrophoresis in 0.8% agarose-formaldehyde gels, transferred overnight to Hybond N (Amersham Life Science Inc.) in 20× SSC, baked at 80°C for 2 h and UV cross-linked. The probe was a 1.5 kb C-terminal fragment from hamster DNA-PKcs obtained by PCR amplification. The filters were also probed with full-length hamster Ku80 cDNA to verify levels of RNA loaded. The probes were labelled by random priming. Hybridisation was carried out under standard conditions.

End binding and DNA-PK assays

EMSA experiments to measure DNA end binding activity were carried out essentially as described previously (1,12). In brief, extracts were prepared as described previously (41), incubated with [gamma]-32P-labelled ds oligo M1/M2 at room temperature for 30 min and DNA-protein complexes resolved on 4% polyacrylamide gels containing 5% glycerol. To examine DNA-PK activity DNA binding proteins were microfractionated using 80-100 µg whole cell extract and 5 mg DNA-cellulose beads. The microfractionated proteins were resuspended in Z'0.05 buffer and incubated with peptide and [[gamma]-32P]ATP (4000 µCi/mmol) in a final volume of 20 µl at 30°C for 10 min as described previously (42). The phosphorylated peptide was either precipated on Whatman P81 filter paper, washed and quantified by scintillation counting (Fig. 5B) or separated through 18% polyacrylamide gels using a Tris-tricine buffer system. Separation of the phosphorylated peptide from other proteins present in the extracts which might have become phosphorylated during the assay provides a more sensitive assay by reducing the background (see Fig. 2B). A peptide mutated for the DNA-PK consensus sequence was used as a control for the experiments in which the peptide was scintillation counted to detect any background labelling of other proteins.

Immunoblotting

Whole cell extracts were boiled in SDS-PAGE loading buffer and the proteins resolved by SDS-PAGE using 6 or 8% polyacrylamide for DNA-PKcs or Ku proteins respectively. The separated proteins were transferred to nitrocellulose membranes using a wet blotting apparatus, blocked for 1 h to overnight at 4°C with 5% skimmed milk solution and 0.05% Tween in PBS. The Ku antibodies utilised were Ku80-4 and Ku70-5, which were raised against Baculovirus-expressed Ku80 and Ku70 proteins respectively (Serotech, UK). The filters were developed using an enhanced chemiluminescence (ECL) kit (Amersham). The DNA-PKcs antibodies utilised were 42-27 and 18-2, hybridoma antibodies raised against purified human DNA-PKcs (43), FLA, raised against full-length human DNA-PKcs (44,45), and DNA-PKcs-3M, which was raised against the N-terminal region of mouse DNA-PKcs (this study). For 42-27 and 18-2 the secondary antibody was anti-mouse immunoglobulin and for the others anti-rabbit immunoglobulin antibody was utilised.

YAC libraries screened

Library screening to identify human DNA-PKcs YAC 147 (29F, C4), derived from the ICI library, has been described previously (14). Two mouse YAC libraries (ICRF and Whitehead) were screened by PCR and hybridisation (46,47). YAC 155 is designated WIBRy910HO4186 and was shown to map to a single region of mouse chromosome 16 by in situ hybridisation.

YAC growth conditions, retrofitting, pulse field gel analysis and transfer to mammalian cells

Yeast cultures containingYACs were grown in SD medium containing adenine, tryptophan and tyrosine but lacking uracil according to Green and Olson (48). The dominant selectable marker, the neoR gene, was introduced into YACs by a retrofitting technique as described (49) and retrofitted YACs were grown in medium containing uracil, tryptophan and tyrosine but lacking adenine. The sizes of YACs were estimated before and after retrofitting by pulse field gel electrophoresis (PFGE) using a Waltzer Apparatus (50). YACS were transferred to mammalian cells by a protoplast fusion technique as described previously (14).

RESULTS

Expression of the DNA-PK components in irs-20

Expression of DNA-PKcs transcript and protein in irs-20 and parental CHO 10B2 cells was examined by northern and western blot analysis (Fig. 1A and B). The level of DNA-PKcs mRNA was a few fold decreased in irs-20 compared with CHO 10B2. Scid fibroblasts also have slightly decreased DNA-PKcs transcript levels, but V-3 cells have very considerably reduced, although detectable, DNA-PKcs mRNA (29). DNA-PKcs protein expression was examined by western immunoblotting using three anti-human DNA-PKcs antibodies, FLA, 42-27 and 18-2, and an anti-mouse DNA-PKcs antibody, DNA-PKcs-3M, using whole cell extracts from irs-20 and wild-type hamster cells. In all cases a residual level of cross-reacting protein was detectable in irs-20 extracts, which represents ~10% of the DNA-PKcs level present in wild-type cells (shown in Fig. 1B using antibody 18-2). The decreased DNA-PKcs protein levels in irs-20, which are more marked than the decrease in transcription level, may arise as a result of decreased transcript expression or stability as well as decreased protein stability. Extracts of V-3 and scid fibroblasts were also examined for DNA-PKcs expression using the same antibody for comparison with irs-20 (Fig. 1B). In line with previous observations, V-3 cells lack detectable DNA-PKcs protein but scid fibroblasts have just detectable DNA-PKcs levels that are considerably lower than that seen in irs-20 extracts (14,16,51). In these western analyses we, like others, have also observed a strongly cross-reacting p220 protein in rodent extracts (28). Since this band is present in V-3 cells, which have very low DNA-PKcs transcript levels, it is unlikely to be a DNA-PKcs breakdown product and may represent a DNA-PKcs-related protein, possibly another member of the PI 3-kinase family. Interestingly, we have observed this band to be present at variable levels in extracts of wild-type cells but consistently present at high levels in extracts of all DNA-PKcs-defective cells.


Figure 1. (A) Northern analysis of DNA-PKcs in irs-20. Aliquots of 8.5 µg total RNA from irs-20 and CHO 10B2 cells were used for Northern blot analysis as described in Materials and Methods. (B) Western blot analysis of IR group 7 mutants using anti-DNA-PKcs antibody 18-2. Whole cell extracts of the parent cells and group 7 mutants shown were size fractionated in 6% polyacrylamide gels and subjected to western blotting with anti-DNA-PKcs antibody 18-2. The level of protein loaded is indicated in the figure. Scid fb is the scid fibroblast cell line SCGR11; V-3 is a previously characterised group 7 mutant. The position of the 450 kDa DNA-PKcs band is indicated by the arrow. The strong smaller band is a 220 kDa product seen in all samples with DNA-PKcs antibodies and probably represents a cross-reacting protein (see text).


Figure 2. DNA-PKcs from irs-20 cells can bind DNA but does not have DNA-PK activity. Extracts from CHO 10B2 and irs-20 cells were incubated with dsDNA-cellulose beads and the DNA-bound proteins recovered by centrifugation. The beads were washed twice with 50 mM Z' buffer and divided into two equal aliquots; one aliquot was boiled with SDS-PAGE loading buffer and subjected to Western immunoblotting analysis (A), the second was assessed for DNA-PK activity using the peptide phosphorylation assay (B).

Expresssion of Ku70 and Ku80 was also examined in extracts from irs-20 cells using antibodies Ku70-5 and Ku80-4 respectively. Wild-type levels of Ku70 and Ku80 were found in irs-20, V-3 and scid cells (data not shown). Therefore, the Ku protein complex is stable in the absence of DNA-PKcs.

DNA-PKcs from irs-20 cells is able to interact with DNA but lacks kinase activity

The presence of DNA-PKcs protein in irs-20 cells permitted an examination of its ability to bind to DNA. dsDNA-cellulose beads were mixed with whole cell extracts from irs-20 and CHO 10B2 cells and the microfractionated DNA-bound proteins were detached by boiling and analysed by immunoblotting using antibody 18-2. Figure 2A shows that, surprisingly, equal levels of DNA-bound DNA-PKcs were recovered from whole cell extracts of irs-20 and CHO 10B2, even though the DNA-PKcs level present in whole cell extracts of irs-20 cells was 10-fold lower than that seen in CHO 10B2 cells (Fig. 1B). The level of DNA-bound DNA-PKcs recovered from irs-20 cells compared with CHO 10B2 cells varied considerably between experiments but was consistently greater than the 10% parental level seen with whole cell extracts. The amount of DNA substrate available was not rate limiting in these experiments. Notwithstanding these differences, these results show that DNA-PKcs in irs-20 cells retains the ability to interact with DNA in the presence of Ku.

The ability to recover DNA-PKcs from DNA-cellulose beads enabled us to assess whether the mutant irs-20 protein also retained DNA-PK activity. We therefore assayed the DNA-bound DNA-PKcs from CHO 10B2 and irs-20 cells for DNA-PK activity using the same extracts used to assess DNA-PKcs protein levels in Figure 2A (Fig. 2B). Although CHO 10B2 had significant levels of DNA-PK activity, no activity could be detected in extracts from irs-20cells.

To verify the presence of a functional binding component of DNA-PK the dsDNA end binding activity of Ku was examined by EMSA using crude whole cell extracts of irs-20, xrs-6 and wild-type hamster cells. As expected, irs-20cells, like scid and V-3 cells, were found to have wild-type levels of end binding activity (data not shown).

Taken together, these results confirm the conclusions based on cell fusion analysis that irs-20 belongs to group 7 and, like its fellow mutants, is defective in DNA-PKcs activity. In addition, and more significantly, these results show that the mutant irs-20 protein retains the ability to bind DNA in the presence of Ku but is unable to function as a protein kinase.

Sequence analysis of the 3'-terminal region of the DNA-PKcs cDNA from irs-20 cells

Previously we and others have identified a T -> Amutational change which gives rise to an ochre stop codon at amino acid 4045 in the extreme 3'-region of XRCC7 cDNA. We therefore examined this region of irs-20 XRCC7 (DNA-PKcs) by RT-PCR using primers MCS4 and HCS6 followed by cloning and sequence analysis of the products. Notably, we identified a G -> A mutational change in irs-20 cells at codon 4120 (the fourth residue from the C-terminus) that results in substitution of a lysine for a glutamic acid residue at this site. Since none of the clones derived from irs-20 (17 clones sequenced) contained the wild-type sequence we conclude that only the mutated allele is expressed. The mutational change destroys a NlaIV restriction site present in the wild-type sequence, thereby allowing the presence of the mutation to be examined in genomic DNA. Primers MCS4 and HCS6 were used to amplify a 156 bp fragment encompassing the mutated site from irs-20 and CHO 10B2 genomic DNA. The product was digested with NlaIV as well as FokI, a restriction enzyme used as a control since its restriction site is close to the NlaIV site but is not affected by the mutational change. The product derived from CHO 10B2 cells was completely digested by NlaIV yielding the two similarly sized products expected. The product from irs-20 gave a band the same size as the undigested PCR product in addition to the two smaller bands seen with CHO 10B2 (Fig. 3). Digestion with FokI yielded the two bands expected from both cell lines. Our results are consistent with the presence of the mutation in one allele of irs-20 genomic DNA and a wild-type sequence in the second allele. Only the allele with a mutational change in the C-terminal region of DNA-PKcs is expressed.


Figure 3. Verification of a mutation in the C-terminal domain of irs-20 cells. (A) Genomic DNA (200 ng) from CHO 10B2 and irs-20 cells was amplified using primers MCS4 and HSC6 and digested with FokI or NlaIV. The products were separated on 11% polyacrylamide gels. (B) Fragment sizes expected from digestion with FokI or NlaIV.

In addition, we observed that some of the clones sequenced had an insertion of 70 bp at codon 3858. Amplification and sequencing of this region from genomic DNA using primers HCS20 and HCS24 revealed that the inserted sequences were derived from a small intron. This region was amplified by RT-PCR from irs-20, CHO 10B2, CHO K1, xrs-6 and V-3 cells and the products analysed by electrophoresis. In all cases the dominant product was of the size expected from the cDNA sequence (174 bp), but a weaker larger band of the size expected for retention of the intron (244 bp), representing ~10% of the RT-PCR products, was also detected (data not shown). The genomic DNA representing the original RT-PCR product amplified encompassed 6 introns but the only one retained was the small one identified, making it unlikely that our cDNA was contaminated with a low level of genomic DNA. We conclude that a 70 bp intron is retained in a small percentage of cDNAs in wild-type and irs-20 cells. Although this aberrant splicing event may be of functional significance, it appears to be unrelated to the irs-20 mutation.

Complementation of irs-20 by YACs encoding human DNA-PKcs

YACs encoding human DNA-PKcs partially complement the radiosensitivity of V-3 cells, but give full correction of the defect in V(D)J recombination (14). To verify that irs-20cells are defective in DNA-PKcs and to establish whether the partial complementation is a feature common to other group 7 mutants we introduced the retrofitted YAC encoding human DNA-PKcs (YAC 147) into irs-20 cells by protoplast fusion. Four out of seven independent G418R (the selectable marker present on the retrofitted YAC) clones obtained showed significant correction of the [gamma]-ray sensitivity characteristic of irs-20 cells using our standard high dose rate irradiation procedure (Fig. 4A). irs-20 cells are reproducibly less sensitive than V-3 cells by this procedure, but exhibit more dramatic sensitivity when survival is examined under continuous low dose rate exposure conditions. Two representative clones were therefore examined under these conditions and although significant correction was observed, wild-type levels of resistance were not achieved (Fig. 4B).

Figure 4. (A) Survival of V-3, irs-20 and YAC fusion hybrids following [gamma]-irradiation. *, AA8; +, CHO 10B2; s,V-3; [Delta], irs-20; [squf], V-3 cells containing YAC 155; -, V-3 cells containing YAC 147; [squ], irs-20 containing YAC 155; [circle], irs-20 containing YAC 147. Error bars representing standard deviations are shown for V-3 and irs-20 cells representing the results of 12 and 6 experiments respectively. (B) Survival of irs-20 and YAC fusion hybrids following continuous exposure conditions. Cells were irradiated under continuous low dose rate conditions and the fraction of cells forming colonies after 7 days estimated. -, CHO 10B2; [circle], cells from C57 mice; t, o, two independent clones containing YAC 147; n, s, two independent clones containing YAC 155; [diamonds], hybrids derived from scid/irs-20 fusions (see 34); [squf], irs-20; [squ], scid cell line.

Figure 5. Biochemical analysis of YAC fusion hybrids. (A) Western blot analysis. Whole cell extracts derived from wild-type cells (AA8 and CHO 10B2), V-3, irs-20 and YAC fusion hybrids encompassing human DNA-PKcs (YAC 155) or mouse DNA-PKcs (YAC 147) were separated in 6% polyacrylamide-SDS gels and subjected to western blotting using anti-DNA-PKcs antibody 18-2. The amount of protein loaded was as indicated. In the exposure shown residual protein in irs-20 is not evident. A band was evident after longer exposures (data not shown but see Fig. 1). (B) Absence of DNA-PK activity in irs-20 and V-3 cells and its restoration in YAC fusion hybrids. DNA-PK activity was assayed as described in Materials and Methods from whole cell extracts derived from wild-type cells (AA8 and CHO 10B2), V-3, irs-20 and hybrids containing YACs encoding human DNA-PKcs (YAC 147) or mouse DNA-PKcs (YAC 155). Aliquots of 25 µg protein were utilised for extracts from cells harbouring YAC 147 and for the human cell extract and 100 µg protein for all other extracts. Assays were carried out in the presence of wild-type (solid bars) or mutant (lighter shaded bars) p53-derived peptide. The mutant peptide has a mutation in the consensus DNA-PK phosphorylation site and can no longer be phosphorylated by DNA-PK. The apparent very low level of activity observed in the extract from irs-20 cells is within background variation and was not reproduced in repeat experiments.

V(D)J recombination was also investigated in irs-20 and in these two clones. irs-20 cells show a dramatic decrease in the frequency of coding joint formation and a modest decrease in signal joint formation, similar to that observed with scid and V-3 cells (34). Here we also sequenced the junctions formed and found, curiously, that both types of joints recovered from irs-20 displayed smaller deletions than those recovered from the other group 7 mutants (data not shown; 38,39,52). In addition, there was an absence of abnormally long p nucleotides, another characteristic feature of coding joins recovered from scid and V-3 cells lines (data not shown). In line with our previous results with V-3 YAC fusion hybrids, the two irs-20 YAC fusion clones were fully complemented for the frequency and fidelity of V(D)J recombination (Table 1). Excluding some minor differences in junctional accuracy at signal junctions (Table 1), the irs-20 YAC fusion hybrids, like the V-3 hybrids expressing human DNA-PKcs, regain the ability to carry out V(D)J recombination to parental levels and with parental fidelity, although only partial correction of the [gamma]-ray sensitivity is achieved.

Complementation of irs-20and V-3 cells by YACs encompassing mouse DNA-PKcs

Group 5 (Ku80) defective rodent mutants are also only partially complemented by human Ku80 cDNA, but full complementation can be achieved using hamster Ku80 cDNA. We therefore tested whether full complementation could be achieved by introducing YACs encompassing the mouse gene for DNA-PKcs, since hamster YAC libraries are not available. The ICRF and Whitehead mouse YAC libraries were screened by hybridisation using a mouse DNA-PKcs cDNA clone and by PCR using primers specific for the 3'-UTR region of the mouse DNA-PKcs gene. Several YACs were obtained and analysed for integrity of DNA-PKcs by Southern hybridisation using cDNA probes to the 5'- and 3'-regions of the genes. By these criteria one YAC (YAC 155) appeared to carry the gene intact and, following retrofitting, was transferred to V-3 and irs-20cells. Six G418R clones from each fusion were analysed for radiation sensitivity and gave significant rescue of the radiosensitive phenotype of the parental cells (results for a representative clone are shown in Fig. 4A). For irs-20hybrids survival was close to the level observed in wild-type cells, although when survival was analysed using the more sensitive continuous exposure assay the hybrids appeared slightly more sensitive than the parent strain and similar in resistance to that observed with the human YACs (Fig. 4B). The V-3 hybrids were also clearly only partially complemented and had survival levels similar to the hybrids expressing human DNA-PKcs (Fig. 4A). Two representative clones from each fusion were shown to carry out V(D)J recombination at frequencies equal to or even greater than those observed in wild-type hamster lines (Table 1). Analysis of the junctions revealed that neither the signal nor coding junctions could be distinguished from those seen in parental cells.

Examination of hybrid YAC fusion clones

Cell extracts from the V-3 and irs-20hybrids containing YAC 147 and YAC 155 were examined for levels of DNA-PKcs protein by western blotting using the anti-DNA-PKcs antibody 18-2 (Fig. 5A). irs-20 and V-3 hybrids containing YAC 147 (human DNA-PKcs) expressed levels of DNA-PKcs protein greater than that observed in parental cells and within the range of that observed with human cell extracts, whilst the hybrids containing YAC 155 (mouse DNA-PKcs) express DNA-PKcs protein at comparable levels to the parental rodent cells. Although the levels of DNA-PKcs expressed in the YAC 155 versus YAC 147 hybrids cannot be compared directly, since the antibody may not cross-react equally with the human and rodent proteins, these results suggest strongly that expression of DNA-PKcs from the YAC in the hamster background relates to that of DNA-PKcs from the species from which the YAC was derived.

Cell extracts from the hybrids and parent strains were also examined for DNA-PK activity (Fig. 5B). The levels of kinase activity approximately reflected DNA-PKcs protein expression levels. Thus hybrids expressing human DNA-PKcs had levels of kinase activity approaching the levels seen in human cells and the hybrids expressing mouse DNA-PKcs had levels comparable with that seen in rodent cells (Fig. 5B). These results verify that the radiosensitivity, V(D)J recombination and DNA-PK defects identified in irs-20cells can be corrected by YACs encoding DNA-PKcs.

Table 1. V(D)J recombination in YAC fusion hybrids and parental cell lines
Cell line [gamma]-Raya DNA-PK activityb pJH200 (signal) pJH290 (coding)
      AmpRCamR/AmpR Percentc Relative parental level Percent correct joinsd AmpRCamR/AmpR Percent Relative parental level
CHO 10B2 R + 65/2110 3.1 1 100 55/2450 2.0 1
Mock R + -/6390 <0.015 <0.005 NA -/4800 <0.02 <0.01
irs-20 S - 60/16200 0.37 0.12 75 2/27300 0.07 0.03
irs-20 + 155e R + 82/668 12.3 4 100 141/1310 10.1 5.1
irs-20 + 147 R ++ 56/6300 0.9 0.3 87 416/19200 2.2 1.1
V-3f S - 54/9750 0.5g 0.22g 47 5/17,100 0.03 0.013
V-3 + 155e R + 54/435 12 4 100 69/1845 3.8 1.9
V-3 + 147f R ++ 224/4260 5.3g 2.12g 100 93/2900 3.2 1.6
Mock represents parental cells transfected with recombination substrates but in the absence of plasmids encoding RAG1/2.
aR, parental level of resistance to ionising radiation; S, sensitivite to ionising radiation. See Figure 4 for radiation survival data.
b+, level of kinase activity found in rodent cells; ++, higher level of kinase activity than found in wild-type rodent cells.
cPercent has been normalised using the parental CH0 10B2 as reference except for the two samples marked.
dPercent of correct RS joins screened by digestion of the PCR products of the recombinant substrates pJH200 with ApaLI.
eThe results shown are from a single radio-resistant clone. Similar results were obtained with another clone harbouring the same YAC.
fThe results shown are taken from Blunt et al. (14). Controls carried out in both sets of experiments gave comparable results.
gThese results have been normalised to the controls used in the original experiments.

Table 2. Properties of group 7 rodent cell lines
Property Murine scid cell line Irs-20 (hamster) V-3 (hamster) Equine SCIDcells
Radiosensitivitya 2 Gy 2.8 Gy 2 Gy 2.7 Gy
V(D)J recombination Large decreased frequency of coding joins: larger deletions at the junctions. Modest impact on signal joins Large decreased frequency of coding joins: smaller deletions. Modest impact on signal joins Large decreased frequency of coding joins: larger deletions. Modest impact on signal joins Defective signal and coding joins
DNA-PKcs levels Just detectable(~1% parental levels) 10% parental levels Undetectable Possibly just detectable
Mutation Premature termination at residue 4045 Base change at residue 4124 Premature termination at residue 4024 in 1 allele; no mutation in C-terminus in 2nd allele Premature termination at residue 3160
Kinase activity Undetectable; protein lacks kinase activity Undetectable; protein lacks kinase activity Undetectable. One allele likely to be non-functional; 2nd allele unknown Undetectable. Likely to be non-functional
Ability of DNA-PKcs to bind DNA Proficient Proficient No residual protein to assess Not examined.
The data presented has been taken from references 15,16,28,29,32-34,38,39,56,58,59. The mutational analysis of V-3 cells are our unpublished observations.
aThe sensitivity has been assessed using D10 values (dose giving 10% survival). A direct comparison of the equine cells with rodent cells is not completely valid. The wt equine cells have similar survival levels compared to wt rodent cells but the survival curve does not have the shoulder characteristic of rodent survival curves.

DISCUSSION

We have characterised at the molecular and biochemical level the defect in the IR group 7 mutant irs-20. The phenotypes of irs-20 and three other DNA-PKcs-defective cell lines are summarised in Table 2. Like the other mutants, irs-20 has wild-type levels of dsDNA end binding activity but no measureable DNA-PK activity. However, in other properties the irs-20 mutation produces a less severe phenotype, including a milder [gamma]-ray sensitivity and V(D)J recombination defect. Compared with V-3 and mouse scid cells, irs-20 retains higher residual levels of DNA-PKcs protein, which is able to bind to DNA but is unable to function as a protein kinase, consistent with similiar observations reported by Peterson et al. (53). Although, whole cell extracts from irs-20 cells had reduced levels of DNA-PKcs compared with wild-type cells, surprisingly, similiar levels were recovered from DNA-cellulose beads. One explanation is that a signficant percentage of DNA-PKcs from wild-type cells is or can become autophosphorylated, which decreases its DNA binding (54). The ablated kinase activity of irs-20 DNA-PKcs precludes autophosphorylation, which might lead to an elevated percentage of DNA-PKcs able to bind to the DNA cellulose. DNA-PKcs from irs-20 cells resembles that from scid cells. Scid lymphocytes and fibroblasts have decreased levels of DNA-PKcs protein which is able to bind DNA (28). Unfortunately, it was not possible to conclude whether the lack of kinase activity in these cell lines resulted from decreased protein levels or non-functional protein. However, a pre-B scid cell line has been described which is unable to carry out V(D)J recombination but retains wild-type levels of scid DNA-PKcs protein. Significantly, though wild-type levels of DNA-PKcs are retained, the pre-B scid cell line lacks DNA-PK activity (55). Therefore, it appears that the DNA-PKcs present in scid cells, like that in irs-20 cells, retains the ability to bind to DNA but cannot function as a protein kinase. Taken together, therefore, there is a striking similarity between the mutant DNA-PKcs protein from mouse scid and irs-20 cells.

We also show here that although irs-20 has two genomic DNA copies of DNA-PKcs, the only allele expressed has a G -> A base change resulting in substitution of a lysine for a glutamic acid as the fourth amino acid from the C-terminal end of the protein. DNA-PK belongs to the PIK-related sub-family of PI 3-kinases (6-8). The sub-family is characterised by a highly conserved motif at the extreme C-terminus, just downstream of the conserved PI 3-kinase domain. Significantly, the PIK-related kinases have protein rather than lipid kinase activity (5). The mutation identified in irs-20 lies within the highly conserved 3'-terminus but outside the conserved PI 3-kinase domain. The changed residue is conserved between human, mouse, hamster and equine DNA-PKcs, although interestingly a lysine residue is found at this site in the ATM protein, another member of the PIK-related sub-family (5,29,56). The substitution of a lysine for a glutamic acid results in change of an acidic to a basic amino acid. This is a significant change in charge and could severly affect the structure and activity of a protein. Sequence analysis of DNA-PKcs from mouse scid cells has shown that the only mutational change creates an ochre mutation and a protein truncated by 83 amino acids (28-30). Like the irs-20 mutation, this does not disrupt the PI 3-kinase domain per se. This mutational change appears to compromise stability of the protein and its ability to function as a protein kinase, but not its ability to interact with DNA-bound Ku.

Since we have sequenced only 1.3 kb of the 14 kb DNA-Pkcs cDNA from irs-20 cells, we are unable to conclude that the mutational change represents the only mutation. However, the milder phenotype of irs-20 compared with scid cells is consistent with the less severe mutational change observed, namely a single amino acid change rather than loss of 83 amino acids. Additionally, the striking similarity between the mutant scid and irs-20 proteins is consistent with the causal mutation occurring in a similiar region of the protein and the presence of full-length protein is in agreement with an inactivating missense mutation. Taken together, this makes the G -> A point mutation identified a likely candidate for the inactivating mutation in XRCC7 in irs-20 cells. If this is the causal mutation, then residue 4120 must be particularly important for kinase function. The milder phenotype of irs-20 cells may arise because there is a higher level of residual protein compared with scid and V-3 cells. The residual protein may retain some kinase activity, a possibility since the PI 3-kinase domain remains intact, or, alternatively, may play some other role in DNA double-strand break repair. An inactivating mutation has also been identified in the C-terminal region of both XRCC7 alleles in equine scid cells and in one allele of V-3 cells (see Table 2). The presence of mutations in the C-terminal region of all these mutants further supports the notion that this region of the protein is indispensible for DNA-PKcs function.

Our sequence analyses reveal that ~10% of cDNAs in all the hamster cell lines we examined retain a small intron. The inserted intron will almost certainly abolish the kinase activity, since it lies within the conserved kinase domain, contains a premature stop codon and renders the remaining cDNA sequence out-of-frame. Previously we have reported aberrant splicing of another intron in DNA-PKcs (29,57). One possibility is that these are forms of alternative splicing of some functional significance, possibly serving to control the level of kinase activity. It will therefore be of interest to determine whether the levels of these aberrant transcripts change after, for example, DNA damage or altered growth conditions.

The analysis of irs-20 and V-3 YAC fusion hybrids expressing human and mouse DNA-PKcs shows that DNA-PKcs expression and kinase activity levels are similar to the species from which the YAC was derived, demonstrating that expression levels are determined by sequences close to or within the DNA-PKcs gene. Additionally, high levels of kinase activity and cross-linking (data not shown) are achieved in the hybrids expressing human DNA-PKcs, showing that there is efficient interaction between the heterologous DNA-PK components. Despite this, the human DNA-PKcs gene did not fully complement the [gamma]-ray sensitivity of the two rodent mutants. Little additional complementation was achieved by introduction of the more closely related mouse DNA-PKcs (Fig. 4). Partial complementation of the radiosensitivity of V-3 cells was particularly surprising considering the full complementation for the V(D)J recombination phenotype and could be explained by the presence of a second mutation affecting radiation sensitivity but not V(D)J recombination. Alternatively, and more plausibly, neither the human nor mouse DNA-PKcs may be able to substitute fully for the hamster gene. The greater apparent complementation in irs-20 cells may simply result from the residual protein levels in these cells. We have previously reported that hamster DNA-PKcs is missing four amino acids within the 1.3 kb C-terminal region compared with the human and mouse proteins (29), which could affect protein conformation and protein-protein interactions. It is also notable that for both [gamma]-ray survival and V(D)J recombination the level of complementation does not parallel the level of kinase activity measured in the in vitro assay, providing further evidence that additional protein interactions are important. This could represent interactions with the in vivo phosphorylation substrate or additional protein interactions.

Despite the lack of full complementation when [gamma]-ray survival is the end-point analysed, the frequency of junctions formed during V(D)J recombination was restored to wild-type levels. Indeed, the frequency of recombination in hybrids containing mouse DNA-PKcs was greater than that obtained in wild-type hamster cells. This result therefore parallels the enhanced cross-linked DNA-PKcs protein seen in these hybrids and provides further evidence for differences between the mouse and hamster proteins as mentioned above. Elevated kinase levels are not seen in these hybrids however. Taken together, these results suggest that there are differences in the requirement of DNA-PKcs for DNA repair versus V(D)J recombination. Our results suggest that V(D)J recombination has a less stringent requirement for interactions involving DNA-PKcs, whereas optimal repair of [gamma]-ray induced double-strand breaks appears to require protein interactions which are not achieved optimally by the heterologous DNA-PK complex. In this context it has been suggested that DNA-PKcs may play a structural role in DNA repair.

In conclusion, we have identified a point mutation in a highly conserved domain of DNA-PKcs in irs-20 cells that represents a likely candidate for the causal inactivating mutation. The single residue changed lies outside the conserved PI 3-kinase domain, but in a region conserved between PIK-related kinases. Our results suggest that this region is required for DNA-PK activity but is not required for interaction of DNA-PKcs with DNA in the presence of Ku. It will therefore be of great interest to determine in greater detail the function of this region and how it modulates DNA-PK-dependent processes.

ACKNOWLEDGEMENTS

We thank Profs A.R.Lehmann and R.Corley for their invaluable support. Work in the S.P.J. and P.A.J. laboratories was supported by a collaborative grant from the Kay Kendall Leukaemia Fund. Additional work in the P.A.J. laboratory was funded by European Union grant F13PCT920007 and in the S.P.J. laboratory by grants SP2143/0101 and SP2143/0201 from the Cancer Research Campaign. G.E.T. is a special fellow of the Leukaemia Society of America and is partially supported by American Cancer Society grant IN97-T. Work in the J.S.B. laboratory is supported, in part, by grants CA09236, CA18023 and CA73926 from the National Cancer Institute, NIH, DHHS, USA.

REFERENCES

1. Gottlieb,T.M. and Jackson,S.P. (1993) Cell, 72, 131-142. MEDLINE Abstract

2. Dvir,A., Peterson,S.R., Knuth,M.W., Lu,H. and Dynan,W.S. (1992) Proc. Natl. Acad. Sci. USA, 89, 11920-11924. MEDLINE Abstract

3. Jeggo,A.P., Taccioli,G.E. and Jackson,S.P. (1995) BioEssays, 17, 949-957.

4. Jackson,S.P. (1996) Cancer Surv., 28, 261-279. MEDLINE Abstract

5. Hartley,K.O., Gell,D., Smith,G.C.M., Zhang,H., Divecha,N., Connelly,M.A., Admon,A., Lees-Miller,S.P., Anderson,C.W. and Jackson,S.P. (1995) Cell, 82, 849-856. MEDLINE Abstract

6. Hunter,T. (1995) Cell, 83, 1-4. MEDLINE Abstract

7. Keith,C.T. and Schreiber,S.L. (1995) Science, 270, 50-51. MEDLINE Abstract

8. Jackson,S.P. (1995) Curr. Biol., 5, 1210-1212. MEDLINE Abstract

9. Zdzienicka,M.Z. (1995) Mutat. Res., 336, 203-213. MEDLINE Abstract

10. Thompson,L.H. and Jeggo,P.A. (1995) Mutat. Res., 337, 131-134. MEDLINE Abstract

11. Jeggo,P.A. (1990) Mutat. Res., 239, 1-16. MEDLINE Abstract

12. Taccioli,G.E., Gottlieb,T.M., Blunt,T., Priestley,A., Demengeot,J., Mizuta,R., Lehmann,A.R., Alt,F.W., Jackson,S.P. and Jeggo,P.A. (1994) Science, 265, 1442-1445. MEDLINE Abstract

13. Smider,V., Rathmell,W.K., Lieber,M.R. and Chu,G. (1994) Science, 266, 288-291. MEDLINE Abstract

14. Blunt,T., Finnie,N.J., Taccioli,G.E., Smith,G.C.M., Demengeot,J., Gottlieb,T.M., Mizuta,R., Varghese,A.J., Alt,F.W., Jeggo,P.A. and Jackson,S.P. (1995) Cell, 80, 813-823. MEDLINE Abstract

15. Kirchgessner,C.U., Patil,C.K., Evans,J.W., Cuomo,C.A., Fried,L.M., Carter,T., Oettinger,M.A., Brown,J.M., Iliakis,G., Mehta,R. and Jackson,M. (1995) Science, 267, 1178-1183. MEDLINE Abstract

16. Peterson,S.R., Kurimasa,A., Oshimura,M., Dynan,W.S., Bradbury,E.M. and Chen,D.J. (1995) Proc. Natl. Acad. Sci. USA, 92, 3171-3174. MEDLINE Abstract

17. Gu,Y., Jin,S., Gao,Y., Weaver,D.T. and Alt,F.W. (1997) Proc. Natl. Acad. Sci. USA, 94, 8076-8081. MEDLINE Abstract

18. Li,Z., Otevrel,T., Gao,Y., Cheng,H.-L., Seed,B., Stamato,T.D., Taccioli,G.E. and Alt,F.W. (1995) Cell, 83, 1079-1089. MEDLINE Abstract

19. Critchlow,S.E., Bowater,R.P. and Jackson,S.P. (1997) Curr. Biol., 7, 588-598. MEDLINE Abstract

20. Alt,F.W., Oltz,E.M., Young,F., Gorman,J., Taccioli,G. and Chen,J. (1992) Immunol. Today, 13, 306-314. MEDLINE Abstract

21. Lewis,S.M. (1994) Adv. Immunol., 56, 27-150. MEDLINE Abstract

22. Gellert,M. (1997) Adv. Immunol., 64, 39-64. MEDLINE Abstract

23. Errami,A., Smider,V., Rathmeli,W.K., He,D.M., Hendrickson,E.A., Zdzienicka,M.Z. and Chu,G. (1996) Mol. Cell. Biol., 16, 1519-1526. MEDLINE Abstract

24. Singleton,B.K., Priestley,A., Gell,D., Blunt,T., Jackson,S.P., Lehmann,A.R. and Jeggo,P.A. (1997) Mol. Cell. Biol., 17, 1264-1273. MEDLINE Abstract

25. Mizuta,R., Taccioli,G.E. and Alt,F.W. (1996) Int. Immunol., 8, 1467-1471. MEDLINE Abstract

26. Boubnov,N.V., Hall,K.T., Wills,Z., Sang,E.L., Dong,M.H., Benjamin,D.M., Pulaski,C.R., Band,H., Reeves,W., Hendrickson,E.A. and Weaver,D.T. (1995) Proc. Natl. Acad. Sci. USA, 92, 890-894. MEDLINE Abstract

27. Wu,X. and Lieber,M.R. (1996) Mol. Cell. Biol., 16, 5186-5193. MEDLINE Abstract

28. Danska,J.S., Holland,D.P., Mariathasan,S., Williams,K.M. and Guidos,C.J. (1996) Mol. Cell. Biol., 16, 5507-5517. MEDLINE Abstract

29. Blunt,T., Gell,D., Fox,M., Taccioli,G.E., Jackson,S.P., Lehmann,A.R. and Jeggo,P.A. (1996) Proc. Natl. Acad. Sci. USA, 93, 10285-10290. MEDLINE Abstract

30. Araki,R., Fujimori,A., Hamatani,K., Mita,K., Saito,T., Mori,M., Fukumura,R., Morimyo,M., Muto,M., Itoh,M., Tatsumi,K. and Abe,M. (1997) Proc. Natl. Acad. Sci. USA, 94, 2438-2443. MEDLINE Abstract

31. Whitmore,G.F., Varghese,A.J. and Gulyas,S. (1989) Int. J. Radiat. Biol., 56, 657-665. MEDLINE Abstract

32. Stackhouse,M.A. and Bedford,J.S. (1993) Radiat. Res., 136, 241-249. MEDLINE Abstract

33. Stackhouse,M.A. and Bedford,J.S. (1994) Int. J. Radiat. Biol., 69, 571-582.

34. Lin,J.D., Muhlmann-Diaz,M.C., Stackhouse,M.A., Robinson,J.F., Taccioli,G.E., Chen,D.J. and Bedford,J.S. (1997) Radiat. Res., 147, 166-171.

35. Jeggo,P.A. and Kemp,L.M. (1983) Mutat. Res., 112, 313-327. MEDLINE Abstract

36. Hendrickson,E.A., Qin,X.-Q., Bump,E.A., Schatz,D.G., Oettinger,M. and Weaver,D.T. (1991) Proc. Natl. Acad. Sci. USA, 88, 4061-4065. MEDLINE Abstract

37. Hafezparast,M., Kaur,G.P., Zdzienicka,M., Athwal,R.S., Lehmann,A.R. and Jeggo,P.A. (1993) Somatic Cell Mol. Genet., 19, 413-421. MEDLINE Abstract

38. Taccioli,G.E., Rathbun,G., Oltz,E., Stamato,T., Jeggo,P.A. and Alt,F.W. (1993) Science, 260, 207-210. MEDLINE Abstract

39. Taccioli,G.E., Cheng,H.-L., Varghese,A.J., Whitmore,G. and Alt,F.W. (1994) J. Biol. Chem., 269, 7439-7442. MEDLINE Abstract

40. Kovalic,D., Kwak,J.-H. and Weisblum,B. (1991) Nucleic Acids Res., 19, 4560. MEDLINE Abstract

41. Scholer,H., Haslinger,A., Heguy,A., Holtgreve,H. and Karin,M. (1986) Science, 232, 76-80. MEDLINE Abstract

42. Finnie,N.J., Gottlieb,T.M., Blunt,T., Jeggo,P.A. and Jackson,S.P. (1995) Proc. Natl. Acad. Sci. USA, 92, 320-324. MEDLINE Abstract

43. Carter,T., Vancurova,I., Sun,I., Lou,W. and DeLeon,S. (1990) Mol. Cell. Biol., 10, 6460-6471. MEDLINE Abstract

44. Casciola-Rosen,L., Nicholson,D.W., Chong,T., Rowan,K.R., Thornberry,N.A., Miller,D.K. and Rosen,A. (1996) J. Exp. Med., 183, 1957-1964. MEDLINE Abstract

45. Song,Q., LeesMiller,S.P., Kumar,S., Zhang,N., Chan,D.W., Smith,G.C.M., Jackson,S.P., Alnemri,E.S., Litwack,G., Khanna,K.K. and Lavin,M.F. (1996) EMBO J., 15, 3238-3246. MEDLINE Abstract

46. Larin,Z., Monaco,A.P., Meier-Ewert,S. and Lehrach,H. (1993) Methods Enzymol., 225, 623-637. MEDLINE Abstract

47. Kusumi,K., Smith,J.S., Segre,J.A., Koos,D.S. and Lander,E.S. (1993) Mamm. Genome, 4, 391-392. MEDLINE Abstract

48. Green,E.D. and Olson,M.V. (1990) Science, 250, 94-98. MEDLINE Abstract

49. Markie,D., Ragoussis,J., Singer,G., Rowan,A. and Sanson,D. (1993) Somatic Cell Mol. Genet., 19, 161-169. MEDLINE Abstract

50. Southern,E.M., Anand,R., Brown,W.R.A. and Fletcher,D.S. (1987) Nucleic Acids Res., 15, 5925-5943. MEDLINE Abstract

51. Kirchgessner,C.U., Tosto,L.M., Biedermann,K.A., Kovacs,M., Araujo,D., Stanbridge,E.J. and Brown,J.M. (1993) Cancer Res., 53, 6011-6016. MEDLINE Abstract

52. Pergola,F., Zdzienicka,M.Z. and Lieber,M.R. (1993) Mol. Cell. Biol., 13, 3464-3471. MEDLINE Abstract

53. Peterson,S.R., Stackhouse,M., Waltman,M.J., Chen,F., Sato,K. and Chen,D.J. (1997) J. Biol. Chem., 272, 10227-10831. MEDLINE Abstract

54. Chan,D.W. and Lees-Miller,S.P. (1996) J. Biol. Chem., 271, 8936-8941. MEDLINE Abstract

55. Grawunder,U., Finnie,N., Jackson,S.P., Riwar,B. and Jessberger,R. (1996) Eur. J. Biochem., 241, 931-940. MEDLINE Abstract

56. Shin,E.K., Perryman,L.E. and Meek,K. (1997) J. Immunol., 158, 3565-3569. MEDLINE Abstract

57. Poltoratsky,V.P., Shi,X., York,J.D., Lieber,M.R. and Carter,T.H. (1995) J. Immunol., 155, 4529-4533. MEDLINE Abstract

58. Blunt,T., Taccioli,G.E., Priestley,A., Hafezparast,M., McMillan,T., Liu,J., Cole,C.C., White,J., Alt,F.W., Jackson,S.P., Schurr,E., Lehmann,A.R. and Jeggo,P.A. (1995) Genomics, 30, 320-328. MEDLINE Abstract

59. Wiler,R., Leber,R., Moore,B.B., Vandyk,L.F., Perryman,L.E. and Meek,K. (1995) Proc. Natl. Acad. Sci. USA, 92, 11485-11489. MEDLINE Abstract

*To whom correspondence should be addressed. Tel: +44 1273 678482; Fax: +44 1273 678121; Email: p.a.jeggo@sussex.ac.uk

This page is run by Oxford University Press, Great Clarendon Street, Oxford OX2 6DP, as part of the OUP Journals
Comments and feedback: www-admin{at}oup.co.uk
Last modification: 27 Mar 1998
Copyright© Oxford University Press, 1998.

Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
 Mol. Cell. Biol.Home page
B. L. Ruis, K. R. Fattah, and E. A. Hendrickson
The Catalytic Subunit of DNA-Dependent Protein Kinase Regulates Proliferation, Telomere Length, and Genomic Stability in Human Somatic Cells
Mol. Cell. Biol., October 15, 2008; 28(20): 6182 - 6195.
[Abstract] [Full Text] [PDF]

Home page
 Genes Dev.Home page
D. A. Mordes, G. G. Glick, R. Zhao, and D. Cortez
TopBP1 activates ATR through ATRIP and a PIKK regulatory domain
Genes & Dev., June 1, 2008; 22(11): 1478 - 1489.
[Abstract] [Full Text] [PDF]

Home page
 Mol. Cell. Biol.Home page
Y. Sun, Y. Xu, K. Roy, and B. D. Price
DNA Damage-Induced Acetylation of Lysine 3016 of ATM Activates ATM Kinase Activity
Mol. Cell. Biol., December 15, 2007; 27(24): 8502 - 8509.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
T. Morita, A. Yamashita, I. Kashima, K. Ogata, S. Ishiura, and S. Ohno
Distant N- and C-terminal Domains Are Required for Intrinsic Kinase Activity of SMG-1, a Critical Component of Nonsense-mediated mRNA Decay
J. Biol. Chem., March 16, 2007; 282(11): 7799 - 7808.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
X. Jiang, Y. Sun, S. Chen, K. Roy, and B. D. Price
The FATC Domains of PIKK Proteins Are Functionally Equivalent and Participate in the Tip60-dependent Activation of DNA-PKcs and ATM
J. Biol. Chem., June 9, 2006; 281(23): 15741 - 15746.
[Abstract] [Full Text] [PDF]

Home page
 Cancer Res.Home page
Y. Peng, R. G. Woods, H. Beamish, R. Ye, S. P. Lees-Miller, M. F. Lavin, and J. S. Bedford
Deficiency in the Catalytic Subunit of DNA-Dependent Protein Kinase Causes Down-Regulation of ATM
Cancer Res., March 1, 2005; 65(5): 1670 - 1677.
[Abstract] [Full Text] [PDF]

Home page
 Mol. Cell. Biol.Home page
K. Rothkamm, I. Kruger, L. H. Thompson, and M. Lobrich
Pathways of DNA Double-Strand Break Repair during the Mammalian Cell Cycle
Mol. Cell. Biol., August 15, 2003; 23(16): 5706 - 5715.
[Abstract] [Full Text] [PDF]

Home page
 Nucleic Acids ResHome page
T. Woods, W. Wang, E. Convery, A. Errami, M. Z. Zdzienicka, and K. Meek
A single amino acid substitution in DNA-PKcs explains the novel phenotype of the CHO mutant, XR-C2
Nucleic Acids Res., December 1, 2002; 30(23): 5120 - 5128.
[Abstract] [Full Text] [PDF]

Home page
 Nucleic Acids ResHome page
S. K. Mauldin, R. C. Getts, W. Liu, and T. D. Stamato
DNA-PK-dependent binding of DNA ends to plasmids containing nuclear matrix attachment region DNA sequences: evidence for assembly of a repair complex
Nucleic Acids Res., September 15, 2002; 30(18): 4075 - 4087.
[Abstract] [Full Text] [PDF]

Home page
 Cancer Res.Home page
C. Mondello, P. Rebuzzini, M. Dolzan, S. Edmonson, G. E. Taccioli, and E. Giulotto
Increased Gene Amplification in Immortal Rodent Cells Deficient for the DNA-dependent Protein Kinase Catalytic Subunit
Cancer Res., June 1, 2001; 61(11): 4520 - 4525.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
R. Fukumura, R. Araki, A. Fujimori, Y. Tsutsumi, A. Kurimasa, G. C. Li, D. J. Chen, K. Tatsumi, and M. Abe
Signal Joint Formation Is Also Impaired in DNA-Dependent Protein Kinase Catalytic Subunit Knockout Cells
J. Immunol., October 1, 2000; 165(7): 3883 - 3889.
[Abstract] [Full Text] [PDF]

Home page
 Cancer Res.Home page
R. Okayasu, K. Suetomi, Y. Yu, A. Silver, J. S. Bedford, R. Cox, and R. L. Ullrich
A Deficiency in DNA Repair and DNA-PKcs Expression in the Radiosensitive BALB/c Mouse
Cancer Res., August 1, 2000; 60(16): 4342 - 4345.
[Abstract] [Full Text]

Home page
 Nucleic Acids ResHome page
L. J. Kienker, E. K. Shin, and K. Meek
Both V(D)J recombination and radioresistance require DNA-PK kinase activity, though minimal levels suffice for V(D)J recombination
Nucleic Acids Res.,