| Nucleic Acids Research | Pages |
STAT 5 and NF-Y are involved in expression and growth hormone-mediated sexually dimorphic regulation of cytochrome P450 3A10/lithocholic acid 6[beta]-hydroxylase
Introduction
Materials And Methods
Plasmids
Isolation and transfection of primary hepatocytes
Preparation of nuclear extracts
Experimental animals
Gel mobility shift analysis
Results
STAT 5 provides GH-mediated transactivation of the CYP3A10/6[beta]-hydroxylase promoter
NF-Y is a positive transcription factor for the CYP3A10/6[beta]-hydroxylase promoter and modulates GH-mediated regulation by STAT 5
Discussion
Acknowledgements
References
STAT 5 and NF-Y are involved in expression and growth hormone-mediated sexually dimorphic regulation of cytochrome P450 3A10/lithocholic acid 6[beta]-hydroxylase
ABSTRACT
INTRODUCTION
Among the various physiological actions exerted by growth hormone (GH), some are sex-specific, such as expression of a number of sexually dimorphic hepatic proteins. The level of expression of these proteins is primarily determined by plasma GH profiles and only secondarily regulated by gonadal hormones through their effects on the hypothalamo-pituitary axis and its control of GH secretion (reviewed in 1,2). Adult males have a pulsatile profile of GH release with serum levels that vary from undetectable levels to peaks of 200-300 ng/ml, whereas females have a relatively steady-state pattern of GH release with uniform, albeit lower, levels of serum GH (10-20 ng/ml). An important subset of the sexually dimorphic hepatic proteins is certain cytochrome P450s (P450s), which are a superfamily of heme-thiolate proteins that metabolize a variety of endogenous and exogenous substrates, including bile acids.
A good insight has recently been gained into the molecular mechanisms by which GH activates gene transcription (3). GH binds to two receptor molecules causing receptor dimerization and activation of the associated JAK2 tyrosine kinase, which in turn phosphorylates both the receptor as well as JAK2 itself. JAK2 and other serine/threonine kinases then phosphorylate different STAT (signal transducers and activators of transcription) factors which are translocated into the nucleus and activate transcription by binding to specific regulatory elements (3). There are several lines of evidence to strongly suggest that different members of the STAT family of transcriptional factors are involved. First, the promoters of several GH-regulated genes, such as the serine protease inhibitor (Spi) 2.1 gene (4,5), the c-fos gene (6), the rat insulin 1 gene (7) and the hamster cytochrome P450 3A10/lithocholic acid 6[beta]-hydroxylase (CYP3A10/6[beta]-hydroxylase) gene (see below), contain a [gamma]-interferon-activated sequence (GAS) that consists of a TT(N)5AA motif (8), which mediates transcriptional activation of these genes by GH. Second, binding of nuclear proteins to these elements is eliminated in hypophysectomized animals and restored upon GH injection (5,9). Third, GH stimulates tyrosine and serine/threonine phosphorylation of STAT 1, STAT 3 and STAT 5 (6,10-12), which is associated with translocation of STATs from the cytoplasm to the nucleus and binding to their regulatory elements. Fourth, characteristic male body growth rates and male-specific liver gene expression are decreased to wild-type female levels in STAT 5b-/- male mice, whereas female-specific liver gene products are increased to a level intermediate between wild-type male and female levels (13). However, a direct effect of any of these STATs on the activity of any promoter has yet to be demonstrated, except for a modest 2-fold induction of a heterologous promoter made of the thymidine kinase promoter and the serine protease inhibitor GAS-like element 1 brought about by overexpressing STAT 5 in CHO cells (14).
The CCAAT box is a widely distributed regulatory sequence present in several promoters and enhancers, and several proteins have been reported to bind this or related sequences. Among these, NF-Y, a multicomponent factor, has been shown to be involved in expression of a number of different tissue-specific genes (15). NF-Y is not a tissue-specific factor, but it functions along with an appropriate tissue-specific regulatory protein to establish the correct pattern of expression. In the case of the albumin promoter, NF-Y interacts with the liver-enriched factor hepatocyte factor-1 (16) and in the case of the major histocompatibility complex II genes, NF-Y functions synergistically with the X-box DNA binding protein and CIITA, a novel non-DNA binding protein (17). Recently it has been demonstrated that NF-Y plays a role in cholesterol-mediated regulation of two genes involved in maintaining cholesterol homeostasis, HMG-CoA synthase and farnesyl diphosphate synthase (18), although the factor directly involved in cholesterol-mediated regulation of transcription of these genes is the newly characterized sterol regulatory element binding protein (SREBP) (19,20).
We have previously reported the isolation of a hamster liver P450, CYP3A10/6[beta]-hydroxylase, which catalyzes the 6[beta]-hydroxylation of lithocholic acid (LCA) as well as some steroid hormones (21,22) and is expressed at 50-fold higher levels in males versus females (21). Hydroxylation of LCA at position 6[beta] represents the major pathway for LCA catabolism and is important for maintenance of the bile acid pool and for prevention of cholestasis (23). We have also shown that GH is the primary hormone involved in sex-specific expression of CYP3A10/6[beta]-hydroxylase (9). Using chimeric CYP3A10/6[beta]-hydroxylase promoter-luciferase (Luc) reporter constructs transfected into hamster primary hepatocytes, we have shown GH-mediated induction of CYP3A10/6[beta]-hydroxylase promoter activity and have localized a DNA element that mediates this transcriptional activation of the CYP3A10/6[beta]-hydroxylase gene by GH. This element has the characteristics of a GAS element, and the factor that binds to it is absent in hypophysectomized hamster nuclear extracts, whereas it is restored upon injection of GH in a manner that mimics the male pattern of GH secretion, consistent with the observed induction of CYP3A10/6[beta]-hydroxylase expression to male levels. The DNA-protein complex is supershifted by anti-STAT 5 antibodies, supporting the idea that the factor(s) involved in sexually dimorphic expression of CYP3A10/6[beta]-hydroxylase belongs to the STAT family of transcriptional factors (9).
In the present study we have used this system to further dissect the molecular mechanisms involved in sexually dimorphic expression of liver-specific genes. We show that STAT 5 (both 5a and 5b) indeed mediates GH-dependent activation of the CYP3A10/6[beta]-hydroxylase promoter, as suggested by the binding studies. We also demonstrate that NF-Y is involved both in basal activity of the CYP3A10/6[beta]-hydroxylase promoter and in its GH-mediated activation.
MATERIALS AND METHODS
Plasmids
pLuc6[beta]-821 was made as described earlier (9) and contains 821 nucleotides (nt) of the CYP3A10/6[beta]-hydroxylase 5[prime]-flanking region in pGL2 (Promega). pLuc6[beta]-821 Mut -58/-57 was created by oligonucleotide-directed mutagenesis as described previously (24). pCMV-STAT 5a and pCMV-STAT 5b were created by cloning the respective STAT 5 cDNA (a gift from A.Mui) fragments into the EcoRI-XbaI site of pCMV5 (25). Orientation of the inserted fragments was confirmed by DNA sequencing. pNF-YA29 was a gift from R.Mantovani and contains the cDNA for a dominant negative mutant (26) in a mammalian expression vector.
Isolation and transfection of primary hepatocytes
Hepatocytes were prepared for primary culture by perfusion of isolated female hamster livers as described earlier (9). Cells were co-transfected by the calcium phosphate co-precipitation method, also as described earlier (9), using 5 µg test plasmid, 1 µg pCMV-RGHR and 1 µg pCMV-Gal and, where indicated, up to 3 µg corresponding expression plasmid. Human GH (National Hormone and Pituitary Program) treatment, harvesting of cells and luciferase and [beta]-galactosidase assays were as described earlier (9). Except where otherwise noted, average values for three experiments are shown and bars indicate the SEM.
Preparation of nuclear extracts
Nuclear extracts were prepared from hamster primary hepatocytes isolated by the above procedure except that the cells were seeded onto 100 mm diameter plastic tissue culture dishes at a density of 2.3 × 106 cells/dish (6 dishes/experimental group). The total amount of DNA transfected per dish was 20 µg. On day 3, one dish from each experimental group was harvested for luciferase and [beta]-galactosidase activities to check transfection efficiency and fold regulation and the rest were used for preparation of nuclear extracts, essentially by the method of Sadowski and Gilman (27). Briefly, cells were first rinsed with ice-cold PBS containing 1 mM Na3VO4 and 5 mM NaF and then with hypotonic buffer [20 mM HEPES, pH 7.9, 20 mM NaF, 1 mM Na3VO4, 1 mM Na4P2O7, 1 mM EDTA, 1 mM EGTA, 1 mM dithiothreitol (DTT), 0.5 mM phenylmethylsulphonyl fluoride (PMSF), 1 µg/ml each leupeptin, aprotinin and pepstatin]. Ice-cold hypotonic buffer containing 0.2% Nonidet P-40 (0.5 ml) was then added directly to the dishes to lyse cells. Lysates were scraped into microfuge tubes, mixed and the nuclei pelletted (16 000 g, 4°C, 20 s). The nuclear pellets from each dish were resuspended in 25 µl high salt buffer (hypotonic buffer containing 320 mM NaCl, 100 mM KCl and 20% glycerol), pooled and gently rocked (4°C, 30 min). Extracted nuclear proteins were then separated from residual nuclei by spinning in an airfuge (30 p.s.i., 4°C, 5 min) and collecting the supernatants.
Experimental animals
Golden Syrian hamsters (Charles River Laboratories) were maintained on a 12 h light/12 h dark cycle, fed regular laboratory chow and killed in the middle of the dark cycle. Liver nuclear extracts were prepared by the Schibler method (28). All animal experiments were conducted in accordance with the principles and procedures of the National Institutes of Health Guide for the Care and Use of Laboratory Animals.
Gel mobility shift analysis
Gel mobility shift analysis was performed as described previously (29) using the following probes: CYPGHRE (CYP3A10/6[beta]-hydroxylase GH regulatory element), containing nt -101 to -78 from the CYP3A10/6[beta]-hydroxylase promoter (GTTACCCAAGTTCCTGGAAGCGTG); CYPNFY (CYP3A10/6[beta]-hydroxylase NF-Y element), containing nt -77 to -53 from the CYP3A10/6[beta]-hydroxylase promoter (CAAGAGGCCCTTCTACTGGCTGCAG). For the supershift experiments affinity-purified anti-STAT 5 antibody was purchased from Santa Cruz Biotechnology Inc. (Santa Cruz, CA) raised against a peptide corresponding to amino acids 765-781 of mouse STAT 5b. Anti-NF-YA (monoclonal [alpha]YAMab7) and anti-NF-YB (polyclonal) antibodies (30) were a gift from R.Mantovani.
RESULTS
STAT 5 provides GH-mediated transactivation of the CYP3A10/6[beta]-hydroxylase promoter
Figure
Figure 1. Schematic representation of the CYP3A10/6[beta]-hydroxylase promoter. The two DNA elements within the CYP3A10/6[beta]-hydroxylase promoter, the GAS element and the inverted CCAAT box, that bind the characterized trans-acting factors are indicated, with the nucleotide sequence (upper strand) underneath and the binding sites in bold. The initiator element (INR) and the transcription initiation site (TIS) are also indicated. The DNA probes used for the gel shift experiments are indicated under the sequence. Based on the above results and with the availability of two murine STAT 5 cDNAs, STAT 5a and STAT 5b (31), we were interested to see whether GH-dependent activation of the CYP3A10/6[beta]-hydroxylase promoter could indeed be mediated by STAT 5. We co-transfected hamster primary hepatocytes with expression plasmids for STAT 5a (pCMV-STAT 5a) or STAT 5b (pCMV-STAT 5b) and the growth hormone receptor (pCMV-RGHR), together with a luciferase reporter construct containing the CYP3A10/6[beta]-hydroxylase promoter, pLuc6[beta]-821 and pCMVGal (to normalize for transfection efficiency). pCMV5 served as the negative control. Cells were co-transfected with different amounts of STAT 5b and treated with or without GH (500 ng/ml medium) (Fig. Figure 2. Overexpression of STAT 5a or STAT 5b enhances GH-mediated activation of the CYP3A10/6[beta]-hydroxylase promoter. (A) Female hamster primary hepatocytes were co-transfected with pLuc6[beta]-821, the indicated amounts of pCMV-STAT 5b, pCMV-RGHR and pCMV-Gal, as described in Materials and Methods. Transfected cells were incubated with or without GH (500 ng/ml medium) and harvested after 48 h. (B) Female hamster primary hepatocytes were co-transfected with pLuc6[beta]-821, pCMV-STAT 5a, pCMV-STAT 5b or pCMV (as control), pCMV-RGHR and pCMV-Gal, as described in Materials and Methods. Transfected cells were then treated with the indicated concentrations of GH for 48 h and harvested for luciferase and [beta]-galactosidase assays. Relative activities were determined by normalizing luciferase activity to [beta]-galactosidase activity. Average values for three experiments relative to the values for cells grown in the absence of GH are shown. Bars indicate the standard errors of the means. Having shown that STAT 5 does mediate GH-dependent activation of the CYP3A10/6[beta]-hydroxylase promoter, we wanted to see if this was reflected in binding of STAT 5 to the CYPGHRE. Hamster primary hepatocytes were co-transfected with pLuc6[beta]-821, pCMV-STAT 5b, pCMV-RGHR and pCMV-Gal, treated with or without GH (500 ng/ml medium) and then harvested for preparation of nuclear extracts. Gel mobility supershift assays (Fig. Figure 3. Antibodies to STAT 5 supershift the GAS-nuclear protein complex in extracts made from GH-treated primary hepatocytes co-transfected with pCMV-STAT 5. Female hamster primary hepatocytes were co-transfected with pLuc6[beta]-821, pCMV-STAT 5b, pCMV-RGHR and pCMV-Gal, as described in Materials and Methods. Transfected cells were incubated with (lanes 7-12) or without (lanes 1-6) GH (500 ng/ml medium) for 48 h and harvested for preparation of nuclear extracts. Increasing amounts (1, 2 and 4 µg protein) of nuclear extract were used in a gel shift experiment, performed as described in Materials and Methods, in the presence (lanes 2, 4, 6, 8, 10 and 12) or absence (lanes 1, 3, 5, 7, 9 and 11) of 0.2 µg anti-STAT 5 antibodies. The -101 to -78 fragment from the CYP3A10/6[beta]-hydroxylase promoter was used as probe. Arrows indicate the shifted (S) and supershifted (SS) complexes and the free probe (F). Figure 4. Mutation of the NF-Y binding site in the CYP3A10/6[beta]-hydroxylase promoter inhibits transcription while enhancing GH-mediated induction of promoter activity. (A) The wild-type sequence with the GAS and NF-Y sites and the mutated NF-Y site are indicated. The wild-type (pLuc6[beta]-821) and mutant (pLuc6[beta]-821 Mut -58/-57) plasmids were independently transfected into female hamster primary hepatocytes and incubated with or without GH (500 ng/ml medium), as described in Materials and Methods. The data were then normalized to the activity produced by the wild-type in cells grown in the absence of GH and represent the average of n experiments ± SEM. (B) Hamster primary hepatocytes transfected with the wild-type CYP3A10/6[beta]-hydroxylase promoter construct (pLuc6[beta]-821) or NF-Y mutant (pLuc6[beta]-821 Mut -58/-57) were incubated with the indicated concentrations of GH for 48 h and promoter activities quantified as described.
NF-Y is a positive transcription factor for the CYP3A10/6[beta]-hydroxylase promoter and modulates GH-mediated regulation by STAT 5
Our previous experiments with 5[prime]-deletion constructs (9) and specific mutants indicated that a DNA element important for CYP3A10/6[beta]-hydroxylase promoter activity was located between nt -186 and -62 of the promoter. DNase I footprint analysis and homology searches with DNA elements known to bind trans-acting factors indicated the presence of a putative site between nt -63 and -58 of the promoter (ACTGGC) which resembled an inverted CCAAT box with the potential to bind the transcription factor NF-Y (32). Given the proximity of the already localized CYPGHRE to this potential NF-Y binding site we wanted to see if NF-Y plays any role in expression and/or GH-mediated regulation of the CYP3A10/6[beta]-hydroxylase gene. A mutant construct (pLuc6[beta]-821 Mut -58/-57) was made where nt -58 and -57 (GG), which are in the core of the putative NF-Y binding site, were mutated (Figs
To prove that the NF-Y protein in fact binds to nt -63 to -58, we performed gel mobility supershift assays using the CYPNFY probe and two different antibodies raised against two of the subunits of NF-Y, NF-YA and NF-YB (Fig.
Figure 5. Anti-NF-Y antibodies supershift the CYPNFY-nuclear protein complex. Gel shift experiments were performed as described in Materials and Methods, using 3 µg male hamster liver nuclear protein in the absence of any antibody (lane 1) or in the presence of increasing amounts (0.04, 0.2 and 0.4 µg) of anti-NF-YA or increasing amounts (0.02, 0.1 and 0.2 µg) of anti-NF-YB. The -77 to -53 fragment from the CYP3A10/6[beta]-hydroxylase promoter was used as a probe. Arrows indicate the shifted (S) and the supershifted (SS) complexes and the free probe (F). To further explore the role of NF-Y in expression and GH-mediated regulation of CYP3A10 promoter activity, we overexpressed a dominant negative mutant of NF-YA, named NF-YA29, in our tissue culture system (26). Figure 
DISCUSSION
We have previously reported that the CYP3A10/6[beta]-hydroxylase gene is expressed at 50-fold higher levels in male than in female hamsters (21) This sex-specific expression was shown to be mediated by the differential pattern of GH secretion and, based on DNA-protein binding experiments, we suggested that the factor involved in GH-mediated induction of CYP3A10/6[beta]-hydroxylase transcription was related to STAT 5 (9). In this report we demonstrate for the first time a direct effect of a STAT factor on the promoter of a GH-regulated gene and show that both STAT 5a and STAT 5b are indeed involved in this regulation. We also show that NF-Y, a factor that has been shown to interact with other regulatory factors, such as SREBP (18) and the T3 receptor (33), and is thus involved in maintaining high levels of transcription of many genes, is involved in transcription of the CYP3A10/6[beta]-hydroxylase gene and also modulates GH-mediated regulation of its transcription.
Figure 6. Overexpression of NF-YA29, a dominant negative mutant of NF-YA, suppresses activity of the CYP3A10/6[beta]-hydroxylase promoter. Female hamster primary hepatocytes were co-transfected with pLuc6[beta]-821, pCMV-NF-YA29, pCMV-RGHR and pCMV-Gal, as described in Materials and Methods. Transfected cells were then treated with 500 ng GH/ml medium for 48 h and harvested. Relative transcription was determined by normalizing luciferase activity to [beta]-galactosidase activity. Average values for three experiments relative to the values for cells with no pNF-YA29 transfected and in the absence of GH are shown. The direct effect of STAT 5a and STAT 5b was shown by co-transfection of expression vectors containing the cDNAs for murine STAT 5a and STAT 5b. Both factors greatly enhanced GH-mediated induction of CYP3A10/6[beta]-hydroxylase promoter activity as compared with control experiments where the vector alone was co-transfected (Fig. The presence of an inverted CCAAT box just 3[prime] of the STAT binding site (Fig. The role of NF-Y in the activity and regulation of the CYP3A10/6[beta]-hydroxylase promoter was further demonstrated by co-transfection experiments with pNF-YA29 (Fig. In conclusion, GH-mediated sex-specific expression of the CYP3A10/6[beta]-hydroxylase promoter is mediated by both STAT 5a and STAT 5b. NF-Y is a crucial factor involved both in positive transcription and in GH-mediated regulation and seems to function by controlling the level of potential occupancy of the STAT 5 binding site. Further experimentation should clarify the role played by NF-Y in this regulation.
ACKNOWLEDGEMENTS
We are grateful to Nouy Wang for excellent technical assistance. This research was supported in part by an American Heart Association Grant-in-Aid (no. 94006320).
REFERENCES
This article has been cited by other articles:
This page is run by Oxford University Press, Great Clarendon Street, Oxford OX2 6DP, as part of the OUP Journals
Comments and feedback: www-admin{at}oup.co.uk
Last modification: 17 Apr 1998
Copyright©Oxford University Press, 1998.
CiteULike 
Connotea 
Del.icio.us What's this?
E. V. Laz, M. G. Holloway, C.-S. Chen, and D. J. Waxman
Characterization of Three Growth Hormone-Responsive Transcription Factors Preferentially Expressed in Adult Female Liver
Endocrinology,
July 1, 2007;
148(7):
3327 - 3337.
[Abstract]
[Full Text]
[PDF]
D. J. Waxman and C. O'Connor
Growth Hormone Regulation of Sex-Dependent Liver Gene Expression
Mol. Endocrinol.,
November 1, 2006;
20(11):
2613 - 2629.
[Abstract]
[Full Text]
[PDF]
M. G. Holloway, E. V. Laz, and D. J. Waxman
Codependence of Growth Hormone-Responsive, Sexually Dimorphic Hepatic Gene Expression on Signal Transducer and Activator of Transcription 5b and Hepatic Nuclear Factor 4{alpha}
Mol. Endocrinol.,
March 1, 2006;
20(3):
647 - 660.
[Abstract]
[Full Text]
[PDF]
A. S. Verma, R. N. Dhir, and B. H. Shapiro
Inadequacy of the Janus Kinase 2/Signal Transducer and Activator of Transcription Signal Transduction Pathway to Mediate Episodic Growth Hormone-Dependent Regulation of Hepatic CYP2C11
Mol. Pharmacol.,
March 1, 2005;
67(3):
891 - 901.
[Abstract]
[Full Text]
[PDF]
C. A. Wiwi and D. J. Waxman
Role of Hepatocyte Nuclear Factors in Transcriptional Regulation of Male-specific CYP2A2
J. Biol. Chem.,
February 4, 2005;
280(5):
3259 - 3268.
[Abstract]
[Full Text]
[PDF]
D. J. Waxman and J. L. Celenza
Sexual dimorphism of hepatic gene expression: novel biological role of KRAB zinc finger repressors revealed
Genes & Dev.,
November 1, 2003;
17(21):
2607 - 2613.
[Full Text]
[PDF]
C. A. Jaffe, D. K. Turgeon, K. Lown, R. Demott-Friberg, and P. B. Watkins
Growth hormone secretion pattern is an independent regulator of growth hormone actions in humans
Am J Physiol Endocrinol Metab,
November 1, 2002;
283(5):
E1008 - E1015.
[Abstract]
[Full Text]
[PDF]
Y. E. Timsit and D. S. Riddick
Stimulation of Hepatic Signal Transducer and Activator of Transcription 5b by GH Is Not Altered by 3-Methylcholanthrene
Endocrinology,
September 1, 2002;
143(9):
3284 - 3294.
[Abstract]
[Full Text]
[PDF]
S.-H. Park and D. J. Waxman
Inhibitory Cross-talk between STAT5b and Liver Nuclear Factor HNF3beta . IMPACT ON THE REGULATION OF GROWTH HORMONE PULSE-STIMULATED, MALE-SPECIFIC LIVER CYTOCHROME P-450 GENE EXPRESSION
J. Biol. Chem.,
November 9, 2001;
276(46):
43031 - 43039.
[Abstract]
[Full Text]
[PDF]
L. N. N. Shoba, M. Newman, W. Liu, and W. L. Lowe Jr.
LY 294002, an Inhibitor of Phosphatidylinositol 3-Kinase, Inhibits GH-Mediated Expression of the IGF-I Gene in Rat Hepatocytes
Endocrinology,
September 1, 2001;
142(9):
3980 - 3986.
[Abstract]
[Full Text]
[PDF]
H. W. Davey, S.-H. Park, D. R. Grattan, M. J. McLachlan, and D. J. Waxman
STAT5b-deficient Mice Are Growth Hormone Pulse-resistant. ROLE OF STAT5b IN SEX-SPECIFIC LIVER P450 EXPRESSION
J. Biol. Chem.,
December 10, 1999;
274(50):
35331 - 35336.
[Abstract]
[Full Text]
[PDF]
H. K. Choi and D. J. Waxman
Growth Hormone, but Not Prolactin, Maintains Low-Level Activation of STAT5a and STAT5b in Female Rat Liver
Endocrinology,
November 1, 1999;
140(11):
5126 - 5135.
[Abstract]
[Full Text]
T. Sueyoshi, N. Yokomori, K. S. Korach, and M. Negishi
Developmental Action of Estrogen Receptor-alpha Feminizes the Growth Hormone-Stat5b Pathway and Expression of Cyp2a4 and Cyp2d9 Genes in Mouse Liver
Mol. Pharmacol.,
September 1, 1999;
56(3):
473 - 477.
[Abstract]
[Full Text]
A. M. Watson, S. M. Poloyac, G. Howard, and R. A. Blouin
Effect of Leptin on Cytochrome P-450, Conjugation, and Antioxidant Enzymes in the ob/ob Mouse
Drug Metab. Dispos.,
June 1, 1999;
27(6):
695 - 700.
[Abstract]
[Full Text]
S.-H. Park, X. Liu, L. Hennighausen, H. W. Davey, and D. J. Waxman
Distinctive Roles of STAT5a and STAT5b in Sexual Dimorphism of Hepatic P450 Gene Expression. IMPACT OF Stat5a GENE DISRUPTION
J. Biol. Chem.,
March 12, 1999;
274(11):
7421 - 7430.
[Abstract]
[Full Text]
[PDF]
C. A. Gebert, S.-H. Park, and D. J. Waxman
Termination of Growth Hormone Pulse-Induced STAT5b Signaling
Mol. Endocrinol.,
January 1, 1999;
13(1):
38 - 56.
[Abstract]
[Full Text]
G. B. Ehret, P. Reichenbach, U. Schindler, C. M. Horvath, S. Fritz, M. Nabholz, and P. Bucher
DNA Binding Specificity of Different STAT Proteins. COMPARISON OF IN VITRO SPECIFICITY WITH NATURAL TARGET SITES
J. Biol. Chem.,
February 23, 2001;
276(9):
6675 - 6688.
[Abstract]
[Full Text]
[PDF]
N. Delesque-Touchard, S.-H. Park, and D. J. Waxman
Synergistic Action of Hepatocyte Nuclear Factors 3 and 6 on CYP2C12 Gene Expression and Suppression by Growth Hormone-activated STAT5b. PROPOSED MODEL FOR FEMALE-SPECIFIC EXPRESSION OF CYP2C12 IN ADULT RAT LIVER
J. Biol. Chem.,
October 27, 2000;
275(44):
34173 - 34182.
[Abstract]
[Full Text]
[PDF]
This Article 
Abstract
Print PDF (120K)
Alert me when this article is cited
Alert me if a correction is posted
Services
Email this article to a friend
Similar articles in this journal
Similar articles in ISI Web of Science
Similar articles in PubMed
Alert me to new issues of the journal
Add to My Personal Archive
Download to citation manager
Search for citing articles in:
ISI Web of Science (30)
Request Permissions
Commercial Re-use Guidelines
for Open Access NAR Content
Google Scholar
Articles by Subramanian, A.
Articles by Gil, G.
Search for Related Content
PubMed
PubMed Citation
Articles by Subramanian, A.
Articles by Gil, G.
Social Bookmarking
What's this?