Skip Navigation

This Article
Right arrow Abstract Freely available
Right arrow Print PDF (315K) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (22)
Right arrowRequest Permissions
Right arrow Commercial Re-use Guidelines
for Open Access NAR Content
Google Scholar
Right arrow Articles by Larijani, M.
Right arrow Articles by Wu, G. E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Larijani, M.
Right arrow Articles by Wu, G. E.
Social Bookmarking
Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Nucleic Acids Research Pages 2304-2309  

The role of components of recombination signal sequences in immunoglobulin gene segment usage: a V81x model
Introduction
Materials And Methods
   DDBJ/EMBL/GenBank accession numbers for V81x
   Germline V81x sequences
   Construction and assay of plasmid substrates
   Analysis of DNA populations
Results And Discussion
   V81x coding and RSS sequences are conserved in five strains of mice
   The V81x coding sequence does not contribute to its overusage
   Functional analysis of the V81x RSS heptamer and nonamer
   Functional analysis of the V81x RSS spacer
   Comparison of heptamer and nonamer variability
Acknowledgements
References

The role of components of recombination signal sequences in immunoglobulin gene segment usage: a V81x model

The role of components of recombination signal sequences in immunoglobulin gene segment usage: a V81x model

Mani Larijani*, Calvin C. K. Yu+, Rachel Golub, Queenie L. K. Lam and Gillian E. Wu

Department of Immunology and Ontario Cancer Institute, University of Toronto, Room 8-111, 610 University Avenue, Toronto, Ontario M5G 2M9, Canada

Received February 17, 1999; Revised and Accepted April 16, 1999

DDBJ/EMBL/GenBank accession nos AF035204-AF035206

ABSTRACT

It has long been appreciated that some immunoglobulin (and T-cell receptor) gene segments are used much more frequently than others. The VH segment V81x is a particularly striking case of overusage. Its usage varies with the stage of B-cell development and with the strain of mice, but it is always high in B cell progenitors. We have found that the coding sequence and the recombination signal sequences (RSS) are identical in five mouse strains, including CAST/Ei, a strain derived from the species Mus castaneus. Thus, the strain differences cannot be attributed to sequences within V81x itself. V81x RSS mediated recombination at rates significantly higher than another VH RSS. Although the V81x nonamer differs at one base pair from the consensus sequence, an RSS with this nonamer and a consensus heptamer recombines as well as the consensus RSS. When the V81x spacer is replaced by that of VA1, the frequency of recombination decreases by ~5-fold; thus, the contribution of variation in natural spacers to variability in VH usage in vivo is likely to be more than has been previously appreciated. Furthermore, the contribution of the heptamer and nonamer to differential VH usage in our assay is correlated inversely with their conservation throughout the VH locus.

INTRODUCTION

Over-expression of D-proximal VH gene segments has been well documented in neonatal and fetal mice (1-3). The most strikingly overused VH segment is V81x, which, depending on the mouse strain, is used in up to 50% of primary pre-B cells (4-12). BALB/c pre-B cells use V81x about twice as frequently as those from C57BL/6 (2,4,13). Its usage falls in mature B cells of all strains with only ~5% of adult spleen B cells using this VH gene segment (4,5). It has been suggested that the general inability of germline V81x heavy (H) chains to pair with [lambda]5 surrogate light (L) chains is at least partially responsible for this sharp decline of V81x usage as B cells progress towards maturity (14,15).

Despite the variation with mouse strain and with developmental state, V81x is clearly overused. The basis for this overuse is not only an interesting molecular biological puzzle, it is important for understanding how the primary repertoire-the collection of antibody V regions before antigenic selection-is shaped.

It was long presumed that the overusage of V81x was mainly a result of its proximity to the stretch of DNA bearing the D gene segments (2). This presumption has largely been replaced by a general belief that specific accessibility to recombination rather than proximity per se is more important for overusage (16-18). It has also been argued that the unusually large number of encoded basic amino acid residues may enable a V81x heavy chain to interact with special antigens, thereby giving this gene segment a unique and pivotal role in the immune system (19). That is, selection of the gene product would be partially responsible for its overusage. However, a V81x knockout strain has no deleterious lymphoid phenotype (18), and this result brings into question the importance of the V81x-encoded protein in the immune system.

Here we present studies directed at clarifying the roles of particular components of the V81x gene segment in its overusage. We demonstrate that the strain differences in V81x usage cannot be attributed to sequences within the gene segment itself, because the coding and the recombination signal sequences (RSS) are identical in five mouse strains, including CAST/Ei, a strain derived from the species Mus castaneus. We find that deletion of the entire V81x coding sequence from a microlocus vector does not affect the degree of its overusage. Thus, the RSS, shown by us and others to be an important determinant of the repertoire of Ig H and L chain V-gene segments in vivo (20-25), is the cis element that is largely responsible for the overusage of V81x. The RSS consists of a nonamer and a heptamer separated by a spacer, which for H-chain V segments is 23 (or 22) bp long. Aside from its role in enforcing the so-called 12/23 rule, which ensures that V recombines with D and not with J, the role of the spacer in determining recombination frequencies is not widely recognized. We previously reported a small (<20%) effect of changing 1 bp in a natural spacer (26), and others have reported larger effects with artificial spacer sequences (21,25,27). Here we find that the natural spacer of V81x is a major determinant of its overusage.

MATERIALS AND METHODS

DDBJ/EMBL/GenBank accession numbers for V81x

C57Bl/6, AF035203; C3H, AF035204; 129, AF035205; CAST/Ei, AF035206.

Germline V81x sequences

Mice were obtained from Jackson Laboratories (ME). DNA was purified by standard procedures and germline V81x was amplified with degenerate 5[prime] primer VHall (AGGTSMARCTGCAGSAGTCWGG), which hybridizes to VH codons 1-8 and back primer VH81x3[prime], which begins 55 bp downstream of the V81x RSS (ATTTCACAACTCTGTGTCTCTCCGC). After a hot start at 94°C for 2 min, 30 cycles of a 3-step PCR (94°C for 1 min, 60°C for 1 min, 72°C for 2 min) was followed by 72°C for 10 min. The PCR product of ~390 bp was cloned with the TA cloning kit (Invitrogen) and for each strain, two to five independent plasmids were sequenced with the T7 sequencing kit (Pharmacia). DNA was amplified and cloned on different days for each mouse strain.

Construction and assay of plasmid substrates

Plasmids were generated from pV81x-D-J microloci (16). The 5[prime] sense primers were:

V81xRSSGGATCCCACAATGAGCAAAAGTTACTGTGAG
VA1RSS GGATCCCACAGTGTTGTAACCACATGGTGAG
ML11GGATCCCACAGTGAGCAAAAGTTACTGTGAGCTCAAACAAAAACC
ML12GGATCCCACAATGAGCAAAAGTTACTGTGAGCTCAAACAAAACC
ML13GGATCCCACAGTGAGCAAAAGTTACTGTGA
ML14GGATCCCACAATGTTGTAACCACATCCTGAGTGTGTACTAAACCTCCGATCCTC

The 3[prime] antisense primer hybridized downstream of the JH1 segment in the polyoma region: CAACGAAGAGGTCCCTACT. After a hot start at 85°C for 5 min, 30 cycles of a 3-step PCR (94°C for 30 s, 55°C for 1 min and 72°C for 1 min + 5 s per cycle) was followed by 72°C for 10 min. The PCR products of 1.1 kb were cloned into the PCR II vector (Invitrogen TA cloning kit), mapped by restriction digests and sequenced from each end. The verified products were cloned into the backbone of pJC119 (22) via the flanking BamHI sites. The orientation of the inserts in the final constructs were determined by restriction digestion and sequencing.

The microlocus recombination assay in vitro has been described (28).

Analysis of DNA populations

Transfection of Abelson murine leukemia virus (A-MuLV) transformed pre-B cell line 1-8 was carried out as described previously (16). Briefly, 1 µg DNA was used to transfect 2 × 107 1-8 cells by the DEAE-Dextran method. DNA recovered from transfections was treated with DpnI to digest non-replicated plasmid DNA, then transfected into ElectroMax DH10B competent bacteria (Gibco-BRL) by electroporation with a GenePulser (Bio-Rad). Typically, we treated half the recovered DNA with DpnI, of which 1-10% was transformed into 25 µl competent bacteria. Transformants were amplified for 16 h in an additional 4 ml LB containing 100 µg/ml ampicillin. Plasmids were recovered by alkaline lysis and digested sequentially with NcoI and HindIII to release the insert from the vector. The resultant DNA fragments were fractionated by gel electrophoresis and analyzed on Southern blots with oligomer probes according to the manufacturer's suggestions (Hybond N, Amersham). The microlocus and its various rearrangement products differed sufficiently in size to identify all recombinants generated by deletion with probe 3[prime]J1CY complementary to JH1 (16). Bands were quantified on a PhosphorImager (Molecular Dynamics) with ImageQuant 3.3, a method we have quantitatively validated (16). In all experiments, the compared constructs contain the insert in the same orientation (arbitrarily designed `plus' and `minus') with respect to the substrate backbone.

RESULTS AND DISCUSSION

V81x coding and RSS sequences are conserved in five strains of mice


Figure 1. Nucleotide sequence of the V81x gene segment including the nine most 3[prime] nt of the VHall degenerate primer and the full V81x 3[prime] primer. Dots indicate identity with the previously published BALB/c sequence (2). The RSS is underlined. The heptamer is shown in red, the spacer in green and the nonamer in blue. The single nt difference in CAST/Ei is shown in red.

Figure 1 shows the germline V81x sequences amplified and cloned from five laboratory strains of mice: BALB/c, 129, C3H, C57BL/6 and CAST/Ei. Like most laboratory mice, the first four strains were derived from Mus musculus; CAST/Ei was derived from another species, M.castaneus. The sequence conservation is striking, the only difference being at nt 327, 6 nt 3[prime] of the RSS, where there is an A residue in the CAST/Ei sequence and a C in the other four strains. All other nucleotides are identical. We find in all strains a C at position 336 (15 bp downstream of the RSS) in place of the previously reported T (2). Confirming the report of Holmberg's group (6), we find that codon 15 encodes a glycine (GGA), rather than an arginine (AGA) residue, as was originally reported. We also confirm the conservation of the V81x coding sequences in C57BL/6 and NOD mice (7). Novel and relevant to the present context is the finding that the RSS are identical in all strains studied. That is, strain differences in V81x usage cannot be explained by RSS differences. Thus, the variable usage of a given gene segment among populations, a characteristic central for adaptive immunity, can be due to RSS-independent as well as RSS-dependent mechanisms. As an example of the latter, Feeney and her group have found that usage of the same V[kappa] gene in different human populations is correlated with variable RSS sequences (29).

The V81x coding sequence does not contribute to its overusage


Figure 2. (A) Diagram of the vector with the microlocus. (B) Relevant deletional products of V(D)J recombination at the microlocus. The microlocus is released from the vector by digestion with HindIII and NcoI.

We showed previously that the VA1 segment (a VHJ558 family member) recombined less frequently than V81x in microlocus plasmids containing V, D and J segments with full coding sequences and RSS (16). For all the experiments reported here, we constructed a set of `RSS microloci', all containing the full DFL16.1 and JH1 segments, but only VH RSS in place of the full VH segment (Fig. 2A). That is, the coding region of the VH gene segments have been removed and vector sequences now abut the RSS. These new coding flanks are identical in both the V81x and VA1 RSS plasmids and are the BamHI restriction site, GGATCC. Figure 2B shows the most abundant deletion products of V(D)J recombination of these substrates, analyzed in this study. Figure 3 shows a typical Southern blot analysis of recombinants. Each lane contains the products, either unrecombined or recombined, of a transfection of one microlocus substrate (see analysis of DNA populations, Materials and Methods). The VH RSS are the only variable sequence among the microloci. As the D and J sequences are identical in all microloci, the frequency of the DJ recombinants is equal in both plasmids and comparable with those found in our previous studies in which a full VH sequence was present (16). This constancy allows the frequency of the DJ recombinants to serve as an internal normalization factor for the degree of recombination. The ratio of VD to DJ recombinants which we refer to as the recombination quotient or Q value, thus, can be used as a measure of the relative recombinability of each VH RSS.


Figure 3. Southern blot analysis of recombinant VA1 and V81x microloci. Products of VRSSD and DJ recombination as well as unrecombined microloci are indicated. All microloci contain the DFL16.1 and JH1 coding sequences and RSS but vary at the VHRSS as detailed in Table 2. The analysis is shown in Table 1. Lane 1, pAAA; lane 2, p888; lane 3, pC88; lane 4, p88C; lane 5, pC8C. Products of VD and DJ recombination as well as unrecombined microloci are indicated.

The results from five independent transfection experiments in which the V81x and VA1 RSSs were compared are shown in lines 1 and 5 of Table 1. Lanes 1 and 2 of Figure 3 show recombinants from a representative transfection. On average, the V81x RSS was >6-fold more efficient than the VA1 RSS, a value comparable with results in previous work with VH segments containing entire coding sequences (16). Coding sequences immediately upstream of the heptamer of the RSS (the coding flanks) have been shown to affect frequency of recombination (25,30-34); however, as the overusage in this assay was mediated by the RSS and many germline VH segments have the V81x coding flank, CA, we conclude that the coding sequence of V81x cannot be an important contributor to initial V81x overuse.

Conservation of JH proximal VH segments among primates has been reported by Meek and colleagues (35). Schroeder and colleagues (36) have also reported conservation within RSS elements, comparing mouse VHJ558 and VH7183 with human VH1 and VH3 families, respectively. Moreover, neither the V81x knockout mice nor the V81x transgenic mice have adverse phenotypes (18,19), so the protein sequence encoded by V81x does not seem to be essential for B cell development. Our result described in the previous paragraph signifies that the V81x coding sequence does not play a role in the overuse of this segment.

Table 1. Recombination quotientsa (Q values) of the nonamer and heptamer variants
Source of RSS element Experiment
7mer Spacer 9mer Name #1 #2 #3 #4 #5 Average
V81x V81x V81x p888 10 4.1 5.3 9.2 5.6 6.8
V81x V81x cons. p88C - - 14 11 15 13
cons. V81x V81x pC88 - - 25 23 16 21
cons. V81x cons. pC8C - 13 17 13 26 17
VA1 VA1 VA1 pAAA 1.0 1.0 1.0 1.2 1.0 1.0
aBands corresponding to V(D)J recombination products on Southern blot gels were quantified with a PhosphorImager. The recombination quotient (Q value) is defined to be the ratio of VD to DJ products. As D and J are the same in all experiments, the Q value is a measure of the recombinability of a V element. The actual sequences for V81x, VA1 and consensus heptamers and nonamers, as well as V81x and VA1 spacers are given in Table 2. The relative orientation of all variant vectors are `minus'. cons., consensus; -, not done.

Functional analysis of the V81x RSS heptamer and nonamer

Of all known RSS sequences, the consensus is the most competent in reporter assays (27,37). As shown in Figure 1 and Table 2, the heptamer and nonamer of the V81x RSS each deviate from the consensus sequence by one nucleotide. In order to examine recombinational competence of the V81x RSS relative to the consensus RSS, we systematically made plasmids with all four combinations of V81x and consensus heptamers and nonamers, while maintaining the V81x 23 bp spacer. The sequence of the variant RSS in each microlocus is shown in Table 2. A summary of results from several independent transfection experiments with these plasmids is shown in Table 1. Figure 3 shows a representative Southern blot used in quantification. Changing either the heptamer or the nonamer of V81x to consensus improved the strength of the V81x RSS 2-3-fold (Table 1, lines 2 and 3). However, changing both residues back to consensus did not show an additive effect (Table 1, line 4). A microlocus with a consensus heptamer and a V81x nonamer yielded as many or more recombinants than one with consensus heptamer and nonamer (Table 1, lines 3 and 4,).


Table 2. RSS sequences in the microlocus plasmidsModifications from the V81x RSS are shown in red.

Previous analyses have examined in some detail the effect of non-consensus nucleotides on V(D)J recombination (24,27,29). When tested with either a 12 or 23 bp spacer, the recombination frequency decreased 15-27%, if the fifth nucleotide of the heptamer contained a non-consensus A, as in V81x (37). The V81x nonamer, in which the third nucleotide is a T instead of an A, has not been tested in any recombination assay. However, when Akamatsu et al. tested a G at that position in a 12 bp spacer RSS with a consensus heptamer, recombination was decreased by 57% (27). Thus the previous analyses did not foretell the recombination strength of the V81x RSS elements.

Functional analysis of the V81x RSS spacer

The puzzlingly high frequency of recombination (up to 20%) in the V81x RSS variant microloci led us to examine the only common element among these sequences: the V81x spacer. A microlocus containing the V81x heptamer and nonamer, but with the VA1 spacer, was constructed and assayed. A representative Southern blot is shown in Figure 4. As shown in Table 3, the RSS containing the VA1 spacer mediated recombination several-fold less frequently than the RSS containing the V81x spacer sequence. When spacers of actual gene segments are compared, this is, to our knowledge, the largest spacer effect on V(D)J recombination reported to date (21,25,26,38).


Figure 4. Southern blot analysis of recombinant microloci differing only in the spacer. Both microloci contain the same D and J as in Figure 3. Both contain the RSS nonamer and heptamer from V81x. The spacer is from the V segment indicated. Lane V81x is p888; lane VA1 is p8A8. The sequences are shown in Table 2, the analysis in Table 3. Products of VD and DJ recombination as well as unrecombined microloci are indicated.

Table 3. Q values of the spacer variants
Source of RSS element Experiment
7mer Spacer 9-mer Name #6 #7 #8 Average
V81x V81x V81x p888 21 8.2 9.1 13
V81x VA1 V81x p8A8 4.3 3.0 2.2 3.2
The description is the same as in Table 1. The relative orientation of both variant vectors are `plus'.


The spacer was once thought to be just that, a determinant of distance between the heptamer and nonamer, thereby maintaining the 12/23 rule. Nevertheless, spacer lengths can vary by one nucleotide (12 ± 1 or 23 ± 1 bp) and these variations significantly affect recombination frequencies (27,37). The spacer sequence shows limited conservation at some positions (39), but substitution studies aimed at determining the functional significance of this conservation found no specific effects in some cases (25,27,40), while in other cases specific effects were seen (21,26,38). Reports of studies where the spacer lengths were increased by multiples of the basic ~11 bp unit also concluded that the 12/23 pair were the most efficient.

Our finding that replacement of the V81x spacer with the VA1 spacer-two naturally occurring spacers-reduces recombination frequencies several-fold shows that the V81x spacer is an intriguingly strong component of the overall strength of the V81x RSS. Unique to the V81x spacer is a track of four As in its heptamer proximal half where one group reports of RAG protein contacts (41) . We also note that though comparable in their GC content, the V81x and VA1 spacers differ at their nonamer proximal residues, the position another group reports RAG1 may contact (42). Our data extend such biochemical observations to the level of functional differences in gene usage in vivo. We suggest that 23 bp spacers contribute to differences in VHRSS function as well as maintaining the order of rearrangement in the IgH locus through the 12/23 rule.

Comparison of heptamer and nonamer variability

Biochemical studies suggest that heptamer and nonamer may play distinct roles in V(D)J recombination. All reports suggest that the heptamer marks the precise position of the V(D)J cleavage sites by a RAG1/2 complex (41,43-48). While some reports suggest that the nonamer is a RAG1 recruiting and initial binding element (43,44,46), others indicate that when both RAG1 and RAG2 are present, the nonamer, spacer and spacer proximal nucleotides of the heptamer are all bound (41,47). We await elucidation as to what mechanism is in effect in vivo. Nevertheless, the lack of additivity of the effects of heptamer and nonamer is eminently compatible with the notion of their having distinct roles.

In this regard, it is interesting that there is more variation in the nonamer among VH segments than in the heptamer sequences. Previously, there had been no reported examples of a VH segment in mice with both consensus heptamer and nonamer sequences. We have isolated a VH gene segment with such a consensus VH RSS. This VH segment belongs to the VHQ52 family which is interspersed with the VH7183 family of VH genes.

Among a panel of 33 VH gene segments (Table 4) (39), the heptamers were consensus in all but three, including the V81x RSS (average of 0.09 non-consensus nt in each heptamer). Presumably the heptamer conservation is necessary to ensure precise cleavage sites for the recombination machinery (46). A precise heptamer would favor a given sequence at the VH border, which might be especially important in early fetal development when there is no N addition (49). On average, VH RSS nonamers differ from the consensus by 1.8 nt. Indeed the most common nt in position 4 for both mouse and human VH nonamers is G or C, not A. Thus, VH RSS nonamers are more variable than heptamers. In DH and JH, on the other hand, nonamer and heptamer variability is similar: 0.55 and 0.70 non-consensus nt per heptamer and nonamer element for DH and 1.3 and 1.3 nt for JH (Table 4). All DH spacers are 12 bp long. However, two of the four JH spacers and only 11 out of the 33 VH segments had a 23 bp spacer; the others had a less effective 22 bp spacer (27,37).

Table 4. Variationa of Ig H-chain RSS heptamers and nonamers
  VH D JH
Heptamer 0.090 0.55 1.3
Nonamer 1.8 0.70 1.3
aThe average number of differences in the RSS heptamer or nonamer of 33 VH and all known D and JH segments from the consensus heptamer or nonamer RSS (39). The values are the average number of nucleotide changes per element.

Compared with other VH segment RSS, the V81x RSS is unusual. All components of the V81x RSS influence the frequency at which it is used in recombination reporter constructs and thus probably contribute to the overusage of V81x in vivo. It is possible that the conserved V81x RSS has evolved to mediate a given initial rate of V81x to DJH joining most advantageous for B cell development. For instance, there may be advantages conferred by V81x to D deletional recombination, such as serving to activate or `open' the locus. Like the spacer, the nonamer can and does vary, and together these two elements generate most of the variability in RSS strength in our microlocus plasmids. Based on the RSS sequence analysis, we suggest that the nonamer and spacer are likely to be the primary determinants of recombination efficiency of VH segments in vivo.

ACKNOWLEDGEMENTS

We thank Drs Charley Steinberg, Chris Paige and Susanna Lewis for helpful discussions and help with the manuscript. This work was supported by grants from the National Cancer Institute of Canada, the Terry Fox Marathon of Hope and the Medical Research Council of Canada. M.L. holds an MRC studentship award and G.E.W. is an MRC Scientist.

REFERENCES

1. Perlmutter,R.M., Kearney,J.F., Chang,S.P. and Hood,L.E. (1985) Science, 227, 1596-1601.

2. Yancopoulos,G.D., Desiderio,S.V., Paskind,M., Kearney,J.F., Baltimore,D. and Alt,F.W. (1984) Nature, 311, 727-733. MEDLINE Abstract

3. Malynn,B.A., Yancopoulos,G.D., Barth,J.E., Bona,C.A. and Alt,F.W. (1990) J. Exp. Med., 171, 843-859. MEDLINE Abstract

4. Marshall,A.J., Wu,G.E. and Paige,C.J. (1996) J. Immunol., 156, 2077-2084. MEDLINE Abstract

5. Marshall,A.J., Paige,C.J. and Wu,G.E. (1997) J. Immunol., 158, 4282-4291. MEDLINE Abstract

6. Carlsson,L., Övermo,C. and Holmberg,D. (1992) Eur. J. Immunol., 22, 71-78. MEDLINE Abstract

7. Andersson,A., Ekstrand-Hammarstrom,B., Eriksson,B., Overmo,C. and Holmberg,D. (1994) Int. Immunol., 6, 623-630. MEDLINE Abstract

8. Hardy,R. (1992) Curr. Opin. Immunol., 4, 181-185. MEDLINE Abstract

9. Freitas,A., Andrade,L., Lembezat,M.-P. and Coutinho,A. (1990) Int. Immunol., 2, 15-23. MEDLINE Abstract

10. Huetz,F., Carlsson,L., Tornberg,U. and Holmberg,D. (1993) EMBO J., 12, 1819-1826. MEDLINE Abstract

11. Reth,M., Jackson,S. and Alt,F.W. (1986) EMBO J., 5, 2131-2138. MEDLINE Abstract

12. Viale,A.-C., Coutinho,A. and Freitas,A.A. (1992) J. Exp. Med., 175, 1449-1465. MEDLINE Abstract

13. Kearney,J., Bartels,J., Hamilton,A., Lehuen,A., Solvason,N. and Vakil,M. (1992) Int. Rev. Immunol., 8, 247-257. MEDLINE Abstract

14. ten Boekel,E., Melcher,F. and Rolink,A. (1997) Immunity, 7, 357-368. MEDLINE Abstract

15. Keyna,U., Beck-Engeser,G., Jongstra,J., Applequist,S. and Jack,H.-M. (1995) J. Immunol., 155, 5536-5542. MEDLINE Abstract

16. Yu,C.C., Larijani,M., Miljanic,I.N. and Wu,G.E. (1998) J. Immunol., 161, 3444-3454. MEDLINE Abstract

17. Alt,F., Yancopolous,G., Blackwell,T.K., Wood,C., Thomas,E., Boss,M., Coffman,R., Rosenberg,N., Tonegawa,S. and Baltimore,D. (1984) EMBO J., 3, 1209-1219. MEDLINE Abstract

18. Huetz,F., Tornberg,U., Malanchère,E., Roes,J., Carlsson,L., Coutinho,A., Holmberg,D. and Rajewsky,K. (1997) Eur. J. Immunol., 27, 307-314. MEDLINE Abstract

19. Martin,F., Chen,X. and Kearney,J.F. (1997) Int. Immunol., 9, 493-505. MEDLINE Abstract

20. Ramsden,D.A. and Wu,G.E. (1991) Proc. Natl Acad. Sci. USA,., 88, 10721-10725. MEDLINE Abstract

21. Nadel,B., Tang,A., Escuro,G., Lugo,G. and Feeney,A.J. (1998) J. Exp. Med., 187, 1495-1503. MEDLINE Abstract

22. Connor,A., Fanning,L., Celler,J., Hicks,L., Ramsden,D. and Wu,G. (1995) J. Immunol., 155, 5268-5272. MEDLINE Abstract

23. VanDyk,L.F., Wise,T.W., Moore,B.B. and Meek,K. (1996) J. Immunol., 157, 4005-4015. MEDLINE Abstract

24. Pan,P., Lieber,M. and Teale,J. (1997) Int. Immunol., 9, 515-522. MEDLINE Abstract

25. Wei,Z. and Lieber,M. (1993) J. Biol. Chem., 268, 3180-3183. MEDLINE Abstract

26. Fanning,L., Connor,A., Baetz,K., Ramsden,D. and Wu,G. (1996) Immunogenetics, 44, 146-150. MEDLINE Abstract

27. Akamatsu,Y., Tsurushita,N., Nagawa,F., Matsuoka,M., Okazaki,K., Imai,M. and Sakano,H. (1994) J. Immunol., 153, 4520-4529. MEDLINE Abstract

28. Connor,A., Fanning,L.J., Bentolila,L.A. and Wu,G.E. (1997) Immunol. Methods Manual, 4, 259-268.

29. Nadel,B., Tang,A., Lugo,G., Love,V., Escuro,G. and Feeney,A.J. (1998) J. Immunol., 161, 6068-6073. MEDLINE Abstract

30. Sadofsky,M., Hesse,J., van Gent,D. and Gellert,M. (1995) Genes Dev., 9, 2193-2199. MEDLINE Abstract

31. Gerstein,R. and Leiber,M. (1993) Genes Dev., 7, 1459-1469. MEDLINE Abstract

32. Ezekiel,U., Engler,P., Stern,D. and Storb,U. (1995) Immunity, 2, 381-389. MEDLINE Abstract

33. Chukwuocha,R. and Feeney,A. (1993) Mol. Immunol., 30, 1473-1480. MEDLINE Abstract

34. Nadel,B. and Feeney,A.J. (1995) J. Immunol., 155, 4322-4329. MEDLINE Abstract

35. Meek,K., Eversole,T. and Capra,J. (1991) J. Immunol., 146, 2434-2438. MEDLINE Abstract

36. Schroeder,H.W.,Jr, Hillson,J.L. and Perlmutter,R.M. (1989) Int. Immunol., 2, 41-50.

37. Hesse,J., Lieber,M., Mizzuuchi,K. and Gellert,M. (1989) Genes Dev., 3, 1953-1961.

38. Posnett,D.N., Vissinga,C.S., Pambuccian,C., Wei,S., Robinson,M.A., Kostyu,D. and Concannon,P. (1994) J. Exp. Med., 179, 1707-1711. MEDLINE Abstract

39. Ramsden,D.A., Baetz,K. and Wu,G.E. (1994) Nucleic Acids Res., 22, 1785-1796. MEDLINE Abstract

40. Akira,S., Okazaki,K. and Sakano,H. (1987) Science, 238, 1134-1138. MEDLINE Abstract

41. Swanson,P.C. and Desiderio,S. (1998) Immunity, 9, 115-125. MEDLINE Abstract

42. Nagawa,F., Ishiguro,K., Tsuboi,A., Yoshida,T., Ishikawa,A., Takemori,T., Otsuka,A.J. and Sakano,H. (1998) Mol. Cell. Biol., 18, 655-663. MEDLINE Abstract

43. Cuomo,C.A., Mundy,C.L. and Oettinger,M.A. (1996) Mol. Cell. Biol., 16, 5683-5690. MEDLINE Abstract

44. Difilippantonio,M.J., McMahan,C.J., Eastman,Q.M., Spanopoulou,E. and Schatz,D.G. (1996) Cell, 87, 253-262. MEDLINE Abstract

45. Spanopoulou,E., Zaitseva,F., Wang,F.H., Santagata,S., Baltimore,D. and Panayotou,G. (1996) Cell, 87, 263-276. MEDLINE Abstract

46. Ramsden,D., McBlane,J., van Gent,D. and Gellert,M. (1996) EMBO J., 15, 3197-3206. MEDLINE Abstract

47. Akamatsu,Y. and Oettinger,M.A. (1998) Mol. Cell. Biol., 18, 4670-4678. MEDLINE Abstract

48. Kim,D.R. and Oettinger,M.A. (1998) Mol. Cell. Biol., 18, 4679-4688. MEDLINE Abstract

49. Feeney,A.J. (1990) J. Exp. Med., 172, 1377-1390. MEDLINE Abstract

*To whom correspondence should be addressed. Tel: +1 416 946 4501; Fax: +1 416 946 2086; Email: manil@oci.utoronto.ca
+Present address: Hooper Foundation, HSW Room 1517, University of California, 513 Parnassus, San Francisco, CA 94143-0552, USA

This page is run by Oxford University Press, Great Clarendon Street, Oxford OX2 6DP, as part of the OUP Journals
Comments and feedback: jnl.info{at}oup.co.uk
Last modification: 14 May 1999
Copyright©Oxford University Press, 1999.
Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
 Int ImmunolHome page
Q. L. K. Lam, C. K. C. Lo, B.-J. Zheng, K.-H. Ko, D. G. Osmond, G. E. Wu, R. Rottapel, and L. Lu
Impaired V(D)J recombination and increased apoptosis among B cell precursors in the bone marrow of c-Abl-deficient mice
Int. Immunol., March 1, 2007; 19(3): 267 - 276.
[Abstract] [Full Text] [PDF]

Home page
 Nucleic Acids ResHome page
M. Larijani, A. Zaheen, D. Frieder, Y. Wang, G. E. Wu, W. Edelmann, and A. Martin
Lack of MSH2 involvement differentiates V(D)J recombination from other non-homologous end joining events
Nucleic Acids Res., November 27, 2005; 33(21): 6733 - 6742.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
D. J. Sawchuk, J. Mansilla-Soto, C. Alarcon, N. C. Singha, H. Langen, M. E. Bianchi, S. P. Lees-Miller, M. C. Nussenzweig, and P. Cortes
Ku70/Ku80 and DNA-dependent Protein Kinase Catalytic Subunit Modulate RAG-mediated Cleavage: IMPLICATIONS FOR THE ENFORCEMENT OF THE 12/23 RULE
J. Biol. Chem., July 9, 2004; 279(28): 29821 - 29831.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
M. M. Hughes, R. E. Tillman, T. D. Wehrly, J. M. White, and B. P. Sleckman
The B12/23 Restriction Is Critically Dependent on Recombination Signal Nonamer and Spacer Sequences
J. Immunol., December 15, 2003; 171(12): 6604 - 6610.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
A. Montalbano, K. M. Ogwaro, A. Tang, A. G. W. Matthews, M. Larijani, M. A. Oettinger, and A. J. Feeney
V(D)J Recombination Frequencies Can Be Profoundly Affected by Changes in the Spacer Sequence
J. Immunol., November 15, 2003; 171(10): 5296 - 5304.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
G. S. Williams, A. Martinez, A. Montalbano, A. Tang, A. Mauhar, K. M. Ogwaro, D. Merz, C. Chevillard, R. Riblet, and A. J. Feeney
Unequal VH Gene Rearrangement Frequency Within the Large VH7183 Gene Family Is Not Due to Recombination Signal Sequence Variation, and Mapping of the Genes Shows a Bias of Rearrangement Based on Chromosomal Location
J. Immunol., July 1, 2001; 167(1): 257 - 263.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
R. Golub, D. Martin, F. E. Bertrand, M. Cascalho, M. Wabl, and G. E. Wu
VH Gene Replacement in Thymocytes
J. Immunol., January 15, 2001; 166(2): 855 - 860.
[Abstract] [Full Text] [PDF]

Home page
 Proc. Natl. Acad. Sci. USAHome page
A. Hassanin, R. Golub, S. M. Lewis, and G. E. Wu
Evolution of the recombination signal sequences in the Ig heavy-chain variable region locus of mammals
PNAS, October 10, 2000; 97(21): 11415 - 11420.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Print PDF (315K) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (22)
Right arrowRequest Permissions
Right arrow Commercial Re-use Guidelines
for Open Access NAR Content
Google Scholar
Right arrow Articles by Larijani, M.
Right arrow Articles by Wu, G. E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Larijani, M.
Right arrow Articles by Wu, G. E.
Social Bookmarking
Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?