| Nucleic Acids Research | Pages |
Recognition of exonic splicing enhancer sequences by the Drosophila splicing repressor RSF1
Introduction
Materials And Methods
Oligonucleotides
SELEX
Plasmid constructs for in vitro transcription
Electrophoretic mobility shift assays, UV cross-linking and in vitro splicing
Transfection and RT-PCR
Results
Discussion
Acknowledgements
References
Recognition of exonic splicing enhancer sequences by the Drosophila splicing repressor RSF1
ABSTRACT
INTRODUCTION
The accurate excision of intervening sequences from RNA polymerase II transcripts is crucial for the expression of most metazoan genes. Recently, progress has been made in the identification of both cis-acting elements required for regulation and trans-acting factors that interact with such elements (1,2). The trans-acting pre-mRNA splicing factors include the U1, U2, U4/U6 and U5 small ribonucleoprotein particles (snRNPs) and non-snRNP proteins. These components assemble onto the pre-mRNA in a dynamic fashion to form a large ribonucleoprotein complex, the so-called spliceosome, where intron excision occurs by two transesterification reactions (3). The earliest detectable metazoan pre-spliceosome complex (E) is formed in an ATP-independent manner (4). It contains the non-snRNP splicing factor U2AF (U2 snRNP auxiliary factor) which comprises two subunits (U2AF 35 kDa and 65 kDa), U1 snRNP and several other proteins (5,6). The assembly of this complex is a major control point for the initial recognition and pairing of splice sites (7) and is therefore thought to be an important step in the regulation of alternative splicing (6). Among the proteins that contribute to the formation of the E complex, there are members of the serine/arginine-rich (SR) protein family that are known to influence the splice site choice (8-11). These proteins also bind a class of purine-rich splicing enhancers known as exon splicing elements (ESEs), that have been demonstrated to play a role in both alternative and constitutive splice site selection in several experimental systems (12-22).
SR proteins share characteristic structural features with several metazoan splicing factors involved in splice site selection. They all contain RNA recognition and arginine-serine (RS)-rich sequence motifs (8-10) that are essential for their function as splicing factors (23-25). The RS domain is responsible for specific protein-protein interactions between RS domain-containing proteins (26-28), interactions which are thought to constitute a bridge between 5[prime] and 3[prime] splice sites during splice site selection (26-28). Such interactions promote the binding of U1 snRNP to the 5[prime] splice site and U2 snRNP auxiliary factor (U2AF65) to the 3[prime] splice site at the earliest stages of the spliceosome assembly (6,11). The SR protein family now includes nine identified members: SRp20 (X16 or RBP1), SRp30a, SRp30b, SRp30c, 9G8, SRp40, SRp54, SRp55 (B52) and SRp75.
Recently, we provided evidence that the ability of SR proteins to promote early splicing complexes and U1 snRNP binding to the 5[prime] splice site can be selectively counteracted by a splicing repressor called RSF1 (29). Like SR proteins, RSF1 has a modular structure consisting of a single N-terminal RNA recognition motif (RRM) domain and a C-terminal domain enriched for glycine, arginine and serine residues (GRS domain) (30). The GRS domain mediates specific interactions with itself and with members of the SR protein family (29), whereas the RRM domain is required for RNA binding. In this article, we show that RSF1 cognate sequences selected from a pool of randomized sequences have ESE properties, suggesting that RSF1 suppresses pre-mRNA splicing by interfering with normal bridging and recruitment activities of SR proteins.
MATERIALS AND METHODS
Oligonucleotides
The sequences of the synthetic oligonucleotides (Isoprim SA, Toulouse) used in this study as cloning adaptors or PCR primers are (name, sequence is given 5[prime]->3[prime]):
HB4T1, CTACCCTTGGACCCAGAGGTTCTTTGAGTCCTTTGG; HB4T2, GATCCCAAAGGACTCAAAGAACCTCTGGGTCCAAGGGT; HB2T1, GATCCCGTCGTTGTCGTCGTTGTCGTCGTTGCAAGGGT; HB2T2, CTACCCTTGCAACGACGACAACGACGACAACGACGG; HB1T1, GATCCGCGCGTTTCGCGCGTTTCGCGCGTTTCAAGGGT; HB1T2, CTACCCTTGAAACGCGCGAAACGCGCGAAACGCGCG; 2SF5, CTACCCTTGAGAAGAACAAGAAGAACAAGAAGAACG; 2SF6, GATCCGTTCTTCTTGTTCTTCTTGTTCTTCTCAAGGGT; 5GLO, CACTAGCAACCTCAAACAGAC; GLOM5, GATACCAACCTGCCAGATCTCTCACCACCAAC; GLOM4, GTTGGTGAGAGATCTGGCAGGTTGGTATC; 3GLO2, CCACCACTTTCTGATAGGCAG; GLOM1, CAAGGGTAGACCGTAGACAGCCTAAGGGTG; GLOM2, CACCCTTAGGCTGTCTACGGTCTACCCTTG; GLOS, GCTTCTGACACAACTGTGTTCACTAGC; GLOA, ACGTGCAGCTTGTCACAGTGCAGCTCA; GAPDHS, ACAGTCCATGCCATCACTGCC; GAPDHA, GCCTGCTTCACCACCTTCTTG; copiaS, GGGCTCTTTTAGCCGAGCAAG; copiaA, CGCAGCGCCAGTTGCGACG.
SELEX
In vitro genetic selection of RSF1 RNA ligands was performed with immobilized GST-RSF1 as described (31) with minor modifications. The random oligonucleotide pool was a gift from Philippe Bouvet (32). Binding of the randomized RNA pool to immobilized protein was carried out in the following buffer: 20 mM Tris-HCl pH 8, 0.5 mM dithiothreitol, 50 µg/ml bovine serum albumin (New England Biolabs), 5% glycerol, 0.3 M KCl, 100 µg/ml tRNA (Sigma), 1 mM MgCl2 and 0.5% Triton X-100. After five cycles of amplification, PCR products were cloned as XbaI-HindIII fragments into pSP64polyA (Pharmacia) and sequenced on both strands by using specific primers with a Sequenase kit (Amersham).
Plasmid constructs for in vitro transcription
All the constructs are derived from pSP64 (Promega) or pSP64H[beta][Delta]6 (33). The single-intron human [beta]-globin constructs pSPH[beta]-T, pSPH[beta]-3A, pSPH[beta]-3B and pSPH[beta]-3S were derived from pSP64H[beta][Delta]6 by inserting the HB4T1/HB4T2, HB2T1/HB2T2, HB1T1/HB1T2 and 2SF5/2SF6 AccI-BamHI adaptors, respectively, between the AccI (in the second exon) and BamHI (from pSP64) sites. The [beta]-globin constructs with duplicated first introns and 51-bp internal exons were derived from pSP64H[beta][Delta]6 by performing PCR amplifications to introduce proper restriction sites next to splice junctions. First, a BglII site was introduced 11 nt upstream of the 5[prime] splice site of the first [beta]-globin intron by performing two concomitant PCR amplifications with the 5GLO/GLOM5 and GLOM4/3GLO2 oligonucleotide pairs, as described (34). The 1410-bp fragment yielded by the second round of PCR amplification (with 5GLO and 3GLO2 oligonucleotides) was digested with NcoI and EcoRI, gel-purified and inserted into pSP64H[beta][Delta]6 between the NcoI and EcoRI (from pSP64) sites, to yield the pSPH[beta]M plasmid. The entire PCR product was sequenced to verify that only intended point mutations were introduced. To introduce an AccI site (7 nt upstream of the natural one found 11 nt downstream of the 3[prime] splice junction of the first [beta]-globin intron) into pSP64H[beta][Delta]6, another mutagenic PCR cloning was concomitantly performed as described above by using the 5GLO/GLOM1 and GLOM2/3GLO2 oligonucleotide pairs. The 1410-bp second round PCR amplification was processed as above to yield the pSPH[beta]m plasmid. Next, the final pDUP51 T, pDUP51 3A, pDUP51 3B and pDUP51 3S constructs were generated by three-way ligations, using the pSPH[beta]m plasmid backbone cut with AccI and EcoRI to concomitantly insert the proper AccI-BamHI adaptors (i.e., HB4T1/HB4T2, HB2T1/HB2T2, HB1T1/HB1T2 and 2SF5/2SF6, respectively) and a 1.2-kb BglII-EcoRI fragment obtained from pSPH[beta]M. The constructs pSPT, pSP3A, pSP3B and pSP3S, which were used to generate the RNA probes for in vitro RNA-binding studies, were derived from the pSPH[beta] T, pSPH[beta] 3A, pSPH[beta] 3B and pSPH[beta] 3S plasmids cut with HindIII and AccI, treated with Klenow to fill the cohesive ends and self-ligated to eliminate the [beta]-globin sequences.
Radiolabeled RNAs were synthesized by in vitro transcription in the presence of 20 U SP6 RNA polymerase (Boehringer), 1 µg of the suitable linearized plasmids (EcoRI for pSPH[beta] constructs or BamHI for the others) and 5 µM [[alpha]-32P]UTP (400 Ci/mmol) in 25 µl reactions according to the manufacturer's recommended conditions. Cold competitor RNAs were synthesized in 100 µl reaction mixtures containing 60 U SP6 RNA polymerase and 5 µg linearized DNA. All in vitro transcripts were purified by denaturing polyacrylamide-urea gels and quantitated by either Cerenkov counting or UV absorbance determination.
Electrophoretic mobility shift assays, UV cross-linking and in vitro splicing
Binding of recombinant purified proteins (0.5, 2 or 8 pmol) to radiolabeled RNAs (20 fmol) was performed in 10 µl of the following buffer: 20 mM HEPES pH 7.6, 5% glycerol, 100 mM KCl, 0.2 mM EDTA and 1.5 mM MgCl2 for 15 min on ice. Complexes were resolved at 4°C on 8% non-denaturing polyacrylamide gels using 0.25× TBE buffer for 2.5 h at 14 V/cm, and revealed by autoradiography.
For UV cross-linking experiments, recombinant proteins, purified SR proteins or HeLa nuclear extract were incubated for 10 min at 30°C with 100 fmol of the radiolabeled RNA indicated in 20 µl of buffer D (35) under splicing conditions but without polyvinyl alcohol. Mixture reactions were then irradiated for 20 min on ice with UV light (254 nm) at a distance of 5 cm. Ten microlitres of 3× SDS gel loading buffer were added in each sample and cross-linked proteins were separated on 10% SDS-PAGE and revealed by autoradiography. Digestion of cross-linked samples with proteinase K was performed with 2 µg of proteinase K and 0.1% SDS for 30 min at 42°C.
The splicing reactions were done under standard conditions for 1.5 h in a total volume of 20 µl containing 50 fmol labeled pre-mRNA, 6 µl of HeLa nuclear extract (35) complemented with buffer D. In Figure
Transfection and RT-PCR
HindIII-BamHI fragments from pDUP51 T, 3A, 3B and 3S were subcloned between HindIII and BamHI sites of pJ6[Omega] (36) to obtain pJ6DUP51 T, 3A, 3B and 3S expression vectors. Monolayer Drosophila S2 cells or HeLa cells were grown on 3 cm diameter dishes (Nunc) to 70-80% confluence and transfected, respectively, with either 2 µg of the indicated plasmids according to the manufaturer's procedure (Kit DES[trade] Invitrogen) or 600 ng of the indicated plasmids using Lipofectamine reagent (Gibco-BRL). Twenty-four hours post-transfection, total RNAs (~30 µg) were purified with 800 µl of TRIzol reagent (Gibco-BRL), subsequently treated with 2 U RQ1 DNase (Promega) for 15 min at 34°C and quantitated by UV absorbance determination. Reverse transcriptions were carried out with 400 U M-MLV reverse transcriptase (Gibco-BRL), 2 µg of total RNAs and 350 ng of poly(dT)15 primer in a final volume of 50 µl. PCR amplications were performed with 1 or 5 µl of the RT reactions, 10 pmol of each primer (GLOS and GLOA for [beta]-globin pre-mRNA and its splicing products, GAPDHS and GAPDHA for human GAPDH mRNA, copiaS and copiaA for the Drosophila retrotransposon copia), 100 µM dNTP, 1 mM MgCl2, 2.5 U Taq DNA polymerase (Gibco-BRL) and 2 µCi [[alpha]-32P]dCTP in a final volume of 50 µl. After 20 cycles of PCR (30 s at 60°C, 1 min at 72°C, 30 s at 95°C), 2 µl of each PCR reaction were boiled for 3 min, loaded onto a 5% denaturing polyacrylamide gel and amplified fragments were revealed by autoradiography.
RESULTS
In order to study the RNA-binding specificity of RSF1, we performed an iterative in vitro genetic selection (SELEX) from a pool of random sequences (37,38). Full-length RSF1 protein (Fig.
Figure 1. Recombinant proteins used in this study. (A) Schematic representation of GST fusion proteins: RNA recognition motifs (grey), GRS domains (white) and hexahistidine tags (black) are boxed. (B) GST fusion proteins were expressed and purified as described (29) and ~1 µg of each purified protein was analyzed on a 12% SDS-polyacrylamide gel subsequently stained with Coomassie Blue. M, molecular weight markers. Figure 2. In vitro selection-amplification of high-affinity RNA target sequences for GST-RSF1. (A) The sequences of individual clones after five cycles are shown distributed among two sets according to the presence of one or two motifs resembling the nonamer YAWCGACRR (R = A or G, W = A or T, Y = C or T) or the related nonamer AAWCGCGYR. These motifs are referred to as A or B nonamers, respectively, and are represented in bold type characters. Nucleotides shown in lower case characters belong to the flanking constant regions. Numbers between brackets behind the name of each clone indicate the number of mismatches (up to three were allowed) between the nonamer motifs present in these sequences and the deduced consensus (in which each indicated nucleotide was found in at least half of the A- or B-type nonamers). (B) RSF1 and a selected range of SR proteins share highly related RRM. The RRM domain of RSF1 is compared with homologous domains of human SRp20 (DDBJ/EMBL/GenBank accession no. 338484), human 9G8 (DDBJ/EMBL/GenBank accession no. 3929380), human SRp30a/SF2/ASF (DDBJ/EMBL/GenBank accession no. 730773), human SRp30c (DDBJ/EMBL/GenBank accession no. 3929377), human SRp55 (DDBJ/EMBL/GenBank accession no. 3929379), human SRp75 (DDBJ/EMBL/GenBank accession no. 730826), human SRp40 (DDBJ/EMBL/GenBank accession no. 3929378) and human SRp30b/SC35 (DDBJ/EMBL/GenBank accession no. 266992). The amino acid sequences of the RRMs of RSF1 and SR proteins are aligned using BESTFIT program. Identical maches are boxed in reverse type and functionally related mashes are boxed in grey. Gaps are introduced in the amino acid sequences in order to obtain an optimal alignment and are shown with horizontal bars. Pairwise percent amino acid identities versus similarities to RSF1 are indicated between brackets in the right-hand column. Sequence alignment allowed us to design best-guessed high-affinity RSF1 binding sites: CAACGACGA for A-type sequences and AAACGCGCG for B-type sequences. To assess the affinities and specificities of binding of these `winner' sequences to RSF1, we developed a band shift assay. Radiolabeled 47 nt RNA probes, containing three tandemly-repeated A- or B-type nonamers (termed 3A and 3B, respectively), were mixed with increasing amounts of purified GST-RSF1 (Fig. Figure 3. RSF1 specifically interacts through its RRM domain with 3A and 3B purine-rich sequences. (A) Mobility shift assay of GST-RSF1. Radiolabeled RNA containing three copies of the winner A- or B-type RSF1 high-affinity binding sequence (3A and 3B RNA, panels I and II, respectively) was incubated with increasing amounts (0.5, 2 or 8 pmol) of the recombinant purified protein indicated. Complexes were separated from the free probe on a 8% non-denaturing polyacrylamide gel. No shift was observed with a control probe (T RNA) derived from [beta]-globin exon 2 pre-mRNA (panel III). A rough estimate of the affinity of the binding of GST-RSF1 to 3B or 3A RNA by measuring the percentage of complexed probes gives a calculated equilibrium dissociation constant (Kd) of ~10-8 M. (B) Competition assay with 2 pmol of GST-RSF1 and 3A RNA as radiolabeled probe. Each competitor RNA (T, 3A or 3B) was used at 20- (lanes 2, 4 and 6) or 100-fold (lanes 3, 5 and 7) molar excess over the probe. Figure 4. Splicing of [beta]-globin pre-mRNA in vitro is inhibited by competing amounts of 3A but not 3B RNA. (A) Aliquots of 50 fmol of 32P-labeled [beta]-globin pre-mRNA (lane CTL) were incubated in HeLa nuclear extract under splicing conditions without (lane 1) or with 0.01, 0.05, 0.1, 0.5, 1 or 5 pmol of cold 3A or 3B competitor RNA (lanes 2-7 and 8-13, respectively). Splicing products (shown on the right of the panel) were analyzed on a 6% denaturing polyacrylamide gel. (B) UV cross-linking of SR proteins to 3A and 3B RNAs. Four micrograms of SR proteins purified from HeLa cells (lane 1), 0.5 µg of GST-RSF1[Delta]N (lane 2), 0.5 µg of GST-RSF1 (lane 3), 100 µg of total proteins from HeLa nuclear extract (lanes 4-8) supplemented with 4 µg of SR proteins (lane 6), 2 µg of GST-RSF1[Delta]N (lane 7) or 2 µg of GST-RSF1 (lane 8) were incubated for 10 min under splicing conditions but without polyvinyl alcohol, in the absence of any probe (panel I) or with 100 fmol of radiolabeled 3A or 3B RNA (panels II and III, respectively). After irradiation with UV light, reaction mixtures analyzed on a 10% SDS-polyacrylamide gel without prior treatment with RNase, were either stained with Coomassie Blue (panel I) or dried and autoradiographed (panels II and III) to reveal cross-linked proteins. Total SR proteins from HeLa cells were purified according to Zahler et al. (8). (C) Competition assay with 3A RNA as radiolabeled probe. UV cross-linking experiments were performed as in Figure 4B with 100 µg of total proteins from HeLa nuclear extract. Each competitor RNA (3S, 3A or 3B) was used at 10- (lanes 2, 4 and 6) or 50-fold (lanes 3, 5 and 7) molar excess over the probe. Only cross-linked SRp30 is shown. Figure 5. 3A and 3B sequences act as ESEs in vitro. (A) Nucleotide sequences of T, 3A, 3B and 3S RNAs. (B) Schematic representation of the model wild-type human [beta]-globin pre-mRNA and its derivatives containing the T, 3A, 3B or 3S sequence. Sequences derived from [beta]-globin exon 1 or exon 2 are boxed in white and grey, respectively, and black boxes represent non-[beta]-globin sequences (3A, 3B and 3S). Numbers on top indicate the length of the corresponding exonic and intronic regions and the angled lines represent the splicing events. (C) 3A and 3B sequences enhance splicing of a [beta]-globin intron in vitro. Splicing reactions were performed under standard conditions with 30% HeLa nuclear extract and 50 fmol of the radiolabeled pre-mRNA indicated. Splicing products (depicted on either side of the panel) were analyzed on a 7% denaturing polyacrylamide gel and revealed by autoradiography. (D) 3A and 3B sequences promote exon inclusion in vitro. Reactions were performed as in Figure 5C with the indicated model three-exons [beta]-globin pre-mRNAs. Splicing intermediates and products are depicted on either side of the panel. Given that RSF1 has a modular structure with an N-terminal RRM domain and C-terminal GRS domain, both of which are capable of binding homopolymers (data not shown), we decided to determine the contribution of individual domains for the binding of RSF1 to cognate RNAs. RSF1-RNA interaction probably involves the RRM domain of RSF1, because a truncated version of RSF1 in which the RRM domain was selectively removed (GST-RSF1[Delta]N, Fig. The similarity of RSF1 binding sites with purine-rich ESEs, the fact that RSF1 and a range of SR proteins share closely related RRM domain at their N-terminal ends (Fig. To identify the factor(s) that interact(s) with GST-RSF1 target sequences, we used UV cross-linking assays. Radiolabeled probes corresponding to the 3A or 3B RNA were cross-linked in the presence of HeLa nuclear extract, and labeled proteins were analyzed by electrophoresis on SDS-polyacrylamide gels and visualized by autoradiography. The 3A RNA transferred label predominantly to protein species with apparent molecular weights of ~20, 30, 40, 55, 75 and 130 kDa (Fig. Although 3B RNA was efficiently cross-linked to purified individual SR proteins (Fig. Purine-rich sequences that bind SR proteins have been shown to act as cis-acting regulatory elements for splicing (13,14,40,41). To better understand the meaning of the binding of SR proteins to the 3A RNA, we asked whether this site could function as a splicing enhancer. We used a [beta]-globin derivative with a short second exon (Fig. To determine whether the GST-RSF1 winner sequences might be required for the regulation of alternative splicing, we used model pre-mRNAs containing two introns and three exons, derived from the human [beta]-globin gene. These substrates have been successfully used to demonstrate ESE-dependent inclusion of a small internal exon (42). Therefore, four nucleotides of the first exon adjacent to the 5[prime] splice site, the first intron and the second exon of [beta]-globin were inserted downstream of [beta]-T, [beta]-3A, [beta]-3B or [beta]-3S, generating four constructs each containing a 51-nt middle exon flanked by two identical introns, termed DUP51 T, DUP51 3A, DUP51 3B and DUP51 3S, respectively (Fig. Very strong enhancement of in vitro splicing efficiency was observed when the internal exon contained either 3A or 3S sequence (Fig. Figure 6. 3A and 3B sequences are functional ESEs in human and Drosophila living cells. (A) HeLa cells were transfected with the plasmid construct coding for either DUP51 3S, T, 3B or 3A [beta]-globin pre-mRNA (lanes 3-10) or with the empty plasmid (lanes 1 and 2). The splicing products were detected by RT-PCR using total RNAs prepared from transfected cells and primers specific to upstream and downstream [beta]-globin exon sequences. For each experiment, 1/10 or 1/50 of the RT reactions were used for 20 cycles of PCR amplification in the presence of 2 µCi [[alpha]-32P]dCTP. Amplified fragments were separated on a 5% denaturing polyacrylamide gel and revealed by autoradiography. As an internal control, PCR reactions were performed in the presence of two additional primers designed against human GAPDH mRNA. The DNA bands corresponding to unspliced pre-mRNA (651 bp), spliced mRNA (391 bp), skipped mRNA (340 bp) or GAPDH mRNA (228 bp) are marked on the right. (B) Same experiments using total RNA purified from transfected Drosophila S2 cells. As a control, PCR with two oligonucleotides specific for copia mRNA are also shown for each experiment. The DNA bands corresponding to [beta]-globin pre-mRNA, its splicing products and copia mRNA are marked on the right. Patterns of splicing in vitro and in vivo may differ significantly and splice site selection in vitro may be affected by the concentration of the nuclear splicing factors in the extract. We therefore performed in vivo studies in cultured cells to ascertain the splicing pattern of the tested pre-mRNAs. The various DUP51 constructs, inserted within a suitable expression vector, were transfected in HeLa cells or Drosophila S2 cells and total RNAs were prepared 24 h post-transfection to avoid reduction of mRNA levels owing to cell death. The mRNA products of each transfected construct were examined by RT-PCR and normalized to GAPDH mRNA in HeLa cells or to copia retrotransposon mRNA in S2 cells. As shown in Figure
DISCUSSION
In this paper we have presented several lines of evidence suggesting that representative RSF1 RNA ligands could serve as exon recognition signals that promote exon inclusion. Two purine-rich sequences, A and B, were identified from a random sequence pool as high-affinity binding sites for RSF1. Mobility shift data obtained with full-length and truncated versions of recombinant RSF1 were consistent with the results of the SELEX experiment and demonstrated that its RRM domain was essential and sufficient to mediate specific interaction with these sequences. The finding that RSF1 bound much less efficiently SF2/ASF-selected sequences (data not shown), which were also purine-rich (14), makes it unlikely that RSF1 binds any polypurine-rich sequences but in fact recognizes short distinct sequences. However, there are differences in the behavior of RSF1-selected sequences. Three copies of the A-type sequence display specific cross-linking to SR proteins in HeLa nuclear extract, efficiently stimulate splicing of reporter pre-mRNAs and promote exon inclusion. Significantly, both in vitro and in transfected cells the reiterated A-type sequence acts in a manner indistinguishable from similarly arranged SF2/ASF high-affinity binding sites when similarly positioned within a model pre-mRNA. In sharp contrast three copies of the B-type sequence only had slight effects on these splicing events. Since purified SR proteins do bind the B-type sequence, we assume that in HeLa nuclear extract there are factors that bind the B-type sequence with higher affinity than SR proteins and thereby antagonize the function of SR proteins. These factors could be related to RSF1 because complementing HeLa nuclear extract with purified RSF1 displaces the binding of SR proteins to A-type sequences and impedes splicing of reporter pre-mRNAs (29). Experiments are currently underway to identify the human homolog of RSF1 in HeLa cell nuclear extract depleted of SR proteins, which could specifically interact with 3A or 3B targets.
Although additional work is needed to establish whether the sequences described here occur naturally in pre-mRNAs subject to alternative splicing, it is striking that several splicing silencer sequences (SSEs), including HIV regulatory sequences, contain motifs closely related to those selected by GST-RSF1 (43,44). Interestingly, in some cases the SSE sequences were found to be juxtaposed to ESEs, forming bipartite splicing regulatory elements that may control the overall efficiency of proximal splice site usage (18,45,46). Therefore, the binding of RSF1 to ESEs shown here could be a way to mediate splicing repression to prevent activation of cryptic splice sites within exonic sequences. In agreement with this hypothesis, it has recently been shown that RSFc, a protein in the dipteran Chironomus tentans, highly homologous to RSF1, binds extensively to newly transcribed BR1 and BR2 pre-mRNAs, which contain a huge exon 4 of 30-35 kb but much less to the BR3 pre-mRNA, which largely consists of intron sequences (L. Wieslander, personal communication). Thus, while ESE elements are required to assure that constitutive splicing does take place, an appropriate balance of splicing repressors and splicing activators, expected to bind these sequences, controls splice site usage of suboptimal splicing signals.
How might RSF1 mediate splicing repression? Binding of this protein may interfere directly with the binding of SR proteins and/or their interactions with constitutive splicing factors. Several lines of evidence support a model for initial splice-site recognition in which multiple protein-RNA and protein-protein interactions between SR proteins bound to the exon and the 5[prime] and 3[prime] splice sites led to the formation of a stable complex (6,26-28). SR proteins have been shown to enhance interactions between the U1 snRNP and the 5[prime] splice site (27,47,48), interactions between U2AF and the 3[prime] splice site as well as bridging the 5[prime] and 3[prime] splice sites (27,28). They are also expected to bind ESE sequences to stimulate splicing of the upstream intron or inclusion of an internal exon (5,12,13,40,49-51). Accordingly, ESE sequences have been found in many cellular and viral pre-mRNAs which are subject to alternative splicing (13,15-21) as well as constitutively spliced pre-mRNAs (22,50,51). The finding that one such sequence also serves as a high-affinity binding site for RSF1, a splicing repressor, provides a framework for understanding the mechanism by which splicing repression can be mediated. The binding of RSF1 to ESEs will prevent recruitment of constitutive splicing factors (U1 snRNP and U2AF) to splice sites, and as a result will abrogate the formation of stable enhancer complexes. This view is consistent with the finding that RSF1 induces a dose-sensitive inhibition of splicing for several reporter pre-mRNAs, an inhibition that occurs at the level of early splicing complexes formation (29). The results of UV cross-linking assays with HeLa nuclear extracts (Fig.
In vitro splicing studies revealed that complementation of HeLa nuclear extract with recombinant GST-RSF1 inhibits splicing of reporter pre-mRNAs, whether they contain the A-type sequences or not (29), indicating that RSF1 inhibition of splicing does not require high-affinity RSF1 binding sites. Therefore, it is possible that, in vitro, RSF1 might act either by binding RNA with low affinity and/or by binding free SR proteins. In keeping with this possibility, recent studies employing in vitro selection for functional splicing enhancers that bind specific SR proteins (12,52) revealed that both SELEX-isolated high-affinity consensus binding sites (10,14,39) and more degenerate (and possibly lower-affinity) binding sites (12,52) can function as exonic splicing enhancers. Thus, some reporter pre-mRNAs, used for in vitro splicing studies, might contain potential targets for RSF1 which have escaped our notice, because the iterative protocol is designed to yield the highest affinity sequences for purified RSF1, but not target sequences involving interaction of RSF1 with other splicing components. These potential targets could also be enhancer sequences, since it has been demonstrated recently that the second exon of [beta]-globin pre-mRNA, a constituvely spliced pre-mRNA, harbors multiple distinct splicing enhancers (22).
Numerous studies contributed to the view that SR proteins can modulate splice site selection in a concentration-dependent manner (9,10). One imaginable consequence of this is that a wide-variety of pre-mRNAs can be controlled by a small set of evolutionarily conserved antagonistic sequence-specific splicing factors. Consistent with this view, targeted expression in Drosophila of transgenes encoding either the SR protein B52 (SRp55) or RSF1 led to pronounced deleterious effects on development (29,53). However, when both proteins were overexpressed together in the same tissue, partial or complete rescue of normal phenotypes were observed (29), implying that RSF1 primarily functions as a SR protein antagonist. According to our model RSF1 and B52 may affect splicing of several pre-mRNAs in a given tissue; it is, therefore, not surprising that overexpression of either factor would be detrimental for the correct development of this tissue. For instance, cryptic splice sites may be activated if the level of B52 is high; conversely, weak splice sites will not be activated if the level of RSF1 is high and in either case this will lead to a default of splicing. Given that RSF1 (Labourier et al., unpublished data) and SR proteins co-localized with transcriptionally active sites of RNA polymerase II on polytene chromosomes, it is tempting to propose that a recruiting mechanism may exist to regulate the local concentrations of splicing activators and splicing repressors at the sites of transcription in the cell nucleus. The elucidation of this mechanism will be important in understanding the general principles that underline gene regulation by alternative splicing.
ACKNOWLEDGEMENTS
We thank A. Krainer for providing pSP64H[beta][Delta]6 construct, H. Land for pJ6[Omega] plasmid and P. Bouvet for the random oligonucleotide pool. H.-M.B. acknowledges F. Amalric and A. Vincent for their interest and logistical support in the initial part of this work. We thank D. Cribbs for support, scientific interest and critical review of the manuscript. A special thanks to A.-M. Duprat for her constant support. We also thank Y. De Preval for synthesizing a number of oligonucleotides. This work was supported by an ATIPE grant from the CNRS (to H.-M.B) and a grant from the CNRS and the ARC (to J.T.). E.L., E.A. and S.B. were supported by graduate fellowships from the Ministère de l'Enseignement Supérieur et de la Recherche (MESR); E.L. and S.B. also benefited from graduate training fellowships from the ARC.
REFERENCES
This article has been cited by other articles:
This page is run by Oxford University Press, Great Clarendon Street, Oxford OX2 6DP, as part of the OUP Journals
Comments and feedback: jnl.info{at}oup.co.uk
Last modification: 14 May 1999
Copyright©Oxford University Press, 1999.
![]()
CiteULike
Connotea
Del.icio.us What's this?
![]()
![]()

![]()
![]()
![]()
T. Warnecke and L. D. Hurst
Evidence for a Trade-Off between Translational Efficiency and Splicing Regulation in Determining Synonymous Codon Usage in Drosophila melanogaster
Mol. Biol. Evol.,
December 1, 2007;
24(12):
2755 - 2762.
[Abstract]
[Full Text]
[PDF]
![]()
![]()
![]()

![]()
![]()
![]()
M. Gabut, J. Dejardin, J. Tazi, and J. Soret
The SR Family Proteins B52 and dASF/SF2 Modulate Development of the Drosophila Visual System by Regulating Specific RNA Targets
Mol. Cell. Biol.,
April 15, 2007;
27(8):
3087 - 3097.
[Abstract]
[Full Text]
[PDF]
![]()
![]()
![]()

![]()
![]()
![]()
P. Bjork, I. Wetterberg-Strandh, G. Bauren, and L. Wieslander
Chironomus tentans-Repressor Splicing Factor Represses SR Protein Function Locally on Pre-mRNA Exons and Is Displaced at Correct Splice Sites
Mol. Biol. Cell,
January 1, 2006;
17(1):
32 - 42.
[Abstract]
[Full Text]
[PDF]
![]()
![]()
![]()

![]()
![]()
![]()
J. Soret, N. Bakkour, S. Maire, S. Durand, L. Zekri, M. Gabut, W. Fic, G. Divita, C. Rivalle, D. Dauzonne, et al.
Selective modification of alternative splicing by indole derivatives that target serine-arginine-rich protein splicing factors
PNAS,
June 14, 2005;
102(24):
8764 - 8769.
[Abstract]
[Full Text]
[PDF]
![]()
![]()
![]()

![]()
![]()
![]()
M. Gabut, M. Mine, C. Marsac, M. Brivet, J. Tazi, and J. Soret
The SR Protein SC35 Is Responsible for Aberrant Splicing of the E1{alpha} Pyruvate Dehydrogenase mRNA in a Case of Mental Retardation with Lactic Acidosis
Mol. Cell. Biol.,
April 15, 2005;
25(8):
3286 - 3294.
[Abstract]
[Full Text]
[PDF]
![]()
![]()
![]()

![]()
![]()
![]()
J. Tazi, N. Bakkour, J. Soret, L. Zekri, B. Hazra, W. Laine, B. Baldeyrou, A. Lansiaux, and C. Bailly
Selective Inhibition of Topoisomerase I and Various Steps of Spliceosome Assembly by Diospyrin Derivatives
Mol. Pharmacol.,
April 1, 2005;
67(4):
1186 - 1194.
[Abstract]
[Full Text]
[PDF]
![]()
![]()
![]()

![]()
![]()
![]()
J. Soret, M. Gabut, C. Dupon, G. Kohlhagen, J. Stevenin, Y. Pommier, and J. Tazi
Altered Serine/Arginine-Rich Protein Phosphorylation and Exonic Enhancer-Dependent Splicing in Mammalian Cells Lacking Topoisomerase I
Cancer Res.,
December 1, 2003;
63(23):
8203 - 8211.
[Abstract]
[Full Text]
[PDF]
![]()
![]()
![]()

![]()
![]()
![]()
E. Allemand, S. Dokudovskaya, R. Bordonne, and J. Tazi
A Conserved Drosophila Transportin-Serine/Arginine-rich (SR) Protein Permits Nuclear Import of Drosophila SR Protein Splicing Factors and Their Antagonist Repressor Splicing Factor 1
Mol. Biol. Cell,
July 1, 2002;
13(7):
2436 - 2447.
[Abstract]
[Full Text]
[PDF]
![]()
![]()
![]()

![]()
![]()
![]()
B. Pilch, E. Allemand, M. Facompre, C. Bailly, J.-F. Riou, J. Soret, and J. Tazi
Specific Inhibition of Serine- and Arginine-rich Splicing Factors Phosphorylation, Spliceosome Assembly, and Splicing by the Antitumor Drug NB-506
Cancer Res.,
September 1, 2001;
61(18):
6876 - 6884.
[Abstract]
[Full Text]
[PDF]
![]()
![]()
![]()

![]()
![]()
![]()
D. M. Standiford, W. T. Sun, M. B. Davis, and C. P. Emerson , Jr.
Positive and Negative Intronic Regulatory Elements Control Muscle-Specific Alternative Exon Splicing of Drosophila Myosin Heavy Chain Transcripts
Genetics,
January 1, 2001;
157(1):
259 - 271.
[Abstract]
[Full Text]
![]()
![]()
![]()

![]()
![]()
![]()
M. Gama-Carvalho, M. P. Carvalho, A. Kehlenbach, J. Valcarcel, and M. Carmo-Fonseca
Nucleocytoplasmic Shuttling of Heterodimeric Splicing Factor U2AF
J. Biol. Chem.,
April 13, 2001;
276(16):
13104 - 13112.
[Abstract]
[Full Text]
[PDF]
![]()
This Article ![]()
![]()
Abstract
![]()
Print PDF (540K)
![]()
Alert me when this article is cited
![]()
Alert me if a correction is posted
![]()
Services ![]()
![]()
Email this article to a friend
![]()
Similar articles in this journal
![]()
Similar articles in ISI Web of Science
![]()
Similar articles in PubMed
![]()
Alert me to new issues of the journal
![]()
Add to My Personal Archive
![]()
Download to citation manager
![]()
Search for citing articles in:
ISI Web of Science (15)
![]()
Request Permissions ![]()
Commercial Re-use Guidelines
for Open Access NAR Content
![]()
Google Scholar ![]()
![]()
Articles by Labourier, E.
![]()
Articles by Bourbon, H. M.
![]()
Search for Related Content
![]()
PubMed ![]()
![]()
PubMed Citation
![]()
Articles by Labourier, E.
![]()
Articles by Bourbon, H. M.
![]()
Social Bookmarking ![]()
![]()
What's this?