| Nucleic Acids Research | Pages |
The role of Schizosaccharomyces pombe Rad32, the Mre11 homologue, and other DNA damage response proteins in non-homologous end joining and telomere length maintenance
Introduction
Materials And Methods
Yeast strains, plasmids and media
Plasmid repair assays
Results
Establishment of a plasmid repair assay for use in S.pombe
Plasmid repair in wild-type cells occurs mainly by the formation of deletions
Repair of plasmids with cohesive 5[prime]-termini is altered in the rad32 null allele
Analysis of repair of plasmids with cohesive or blunt 3[prime]-termini in the rad32 null allele
Mutations in the phosphoesterase motifs in Rad32 do not affect NHEJ
Plasmid repair is also affected in other recombination and DNA damage-tolerant mutants
Relationship between Rad22, Rqh1 and Rhp9
Telomere length is reduced in the rad32, rhp9 and rqh1 null alleles
Discussion
Acknowledgements
References
The role of Schizosaccharomyces pombe Rad32, the Mre11 homologue, and other DNA damage response proteins in non-homologous end joining and telomere length maintenance
Received March 24, 1999; Revised and Accepted May 14, 1999
ABSTRACT The Schizosaccharomyces pombehomologue of Mre11, Rad32, is required for repair of UV- and ionising radiation-induced DNA damage and meiotic recombination. In this study we have investigated the role of Rad32 and other DNA damage response proteins in non-homologous end joining (NHEJ) and telomere length maintenance in S.pombe. We show that NHEJ in S.pombeoccurs by an error-prone mechanism, incontrast to the accurate repair observed in Saccharomyces cerevisiae. Deletion of the rad32 gene results in a modest reduction in NHEJ activity and the remaining repair events that occur are accurate. Mutations in two of the phosphoesterase motifs in Rad32 have no effect on the efficiency or accuracy of end joining, suggesting that the role of Rad32 protein may be to recruit another nuclease(s) for processing during the end joining reaction. We also analysed NHEJ in other DNA damage response mutants and showed that the checkpoint mutant rad3-d and two recombination mutants defective in rhp51 and rhp54(homologues of S.cerevisiae RAD51 and RAD54, respectively) are not affected. However disruption of rad22, rqh1 and rhp9/crb2 (homologues of the S.cerevisiae RAD52, SGS1 and RAD9 genes) resulted in increased NHEJ activity. Telomere lengths in the rad32, rhp9 and rqh1 null alleles were reduced to varying extents intermediate between the lengths observed in wild-type and rad3 null cells.
INTRODUCTION
DNA double-strand breaks (DSBs) can arise following exposure to ionising radiation or as intermediates in various cellular processes such as replication or recombination. They constitute a serious threat to cell viability and must be repaired if cells are to survive and retain an intact genome. Organisms have therefore evolved a number of mechanisms for the repair of DSBs. The two major mechanisms for this are homologous recombination, where the break is repaired by recombination between homologous sequences (e.g. between homologous chromosomes or sister chromatids) and non-homologous end joining (NHEJ), also called illegitimate recombination, where little or no homology is required to join the ends of the DNA. Several mechanisms for NHEJ have been identified and these include one involving accurate repair of DSBs which results in no loss of sequence information and two error-prone processes, one of which involves single-strand annealing (SSA) requiring a minimum of 60-90 bp homology at the junction (1,2), while the other involves the creation of deletions or insertions through a process involving microhomologies at the junction (3-5).
In the budding yeast, Saccharomyces cerevisiae, repair of DSBs by homologous recombination is much more frequent than repair by NHEJ (reviewed in 6). In this organism, homologous recombination has been shown to require the products of the RAD52 epistasis group of genes, while NHEJ involves only a subset of this group. Thus, NHEJ requires RAD50, MRE11 and XRS2 (7,8) as well as the YKU70/HDF1 and YKU80 genes (9-12) and LIG4 (which encodes DNA ligase IV; 13) but not RAD51 and RAD52 (7,14). The YKU70/HDF1 and YKU80 genes, the S.cerevisiae homologues of the mammalian ku70 and ku80 genes, are required for the precise joining of complementary DNA ends (10-12). However, in strains deleted for the RAD50 and MRE11 genes the repair of complementary 5[prime]-overhanging DNA ends that does occur is accurate, though the overall level of DSB repair is reduced substantially (8).
In vertebrates, in contrast to the situation in S.cerevisiae, the predominant mechanism for repairing DSBs is that of NHEJ. It has been shown both by introduction of linear DNA into cells and by the use of cell-free extracts that, as in S.cerevisiae, complementary DNA ends are generally repaired accurately with no loss of sequence information and that non-complementary ends may also be rejoined accurately, by filling-in and blunt end ligation (15,16) or through a mechanism involving annealing at regions of microhomology (17). Some of the proteins required for NHEJ in mammals have been identified through the analysis of mutants sensitive to ionising radiation, which comprise four complementation groups (XRCC4-7). The proteins defective in these mutant cell lines are the XRCC4 protein, which interacts with DNA ligase IV (18,19), and the components of DNA-dependent protein kinase (DNA-PK), i.e. the catalytic subunit DNA-PKcs and a DNA-binding component consisting of Ku70 and Ku80 (reviewed in 20,21). Additionally, DNA ligase IV has also been shown to be required in vitro(18). Human homologues of Mre11, Rad50 and Xrs2 (the hMre11, hRad50 and the NBS1 gene products, respectively) have also been identified and shown to act together in a complex (22). This complex is proposed to have a role not only in the repair of DSBs, but also in linking repair to the cellular DNA damage response via cell cycle checkpoint functions (22,23). The importance of the complex is attested to by the fact that mutation of the NBS1 gene is responsible for the chromosomal instability syndrome Nijmegen breakage syndrome (22,23).
The fission yeast, Schizosaccharomyces pombe, provides a good model system in which to study NHEJ as it has more illegitimate recombination than does S.cerevisiae and may therefore be closer to the mammalian system. A number of recombination-defective mutants have been identified in the fission yeast but these have not been characterised as extensively as the S.cerevisiaemutants. Cloning of S.pombe recombination genes either by complementation of mutant phenotypes or by homology to S.cerevisiae sequences has led to the identification of several genes with high sequence identity to recombination genes in S.cerevisiaeand other organisms. These include the S.pombe rad22, rad32, rhp51 and rhp54 genes, which are structurally related to S.cerevisiae RAD52, MRE11, RAD51 and RAD54, respectively (24-27). Despite the structural similarities there are noticeable differences in the functions of some of these proteins. For example, rad22, rad32, rhp51 and rhp54mutants are sensitive to both UV and ionising radiation, unlike their S.cerevisiae counterparts, which are sensitive solely to ionising radiation (6), reflecting the fact that in S.pombe the genes, as well as being required for repair of damage due to ionising radiation, are required for DNA damage responses to UV light (28-30). Other differences between the functions of these genes in S.pombe and S.cerevisiae have been detected from analysis of homologous recombination in rhp51, rhp54 and rad22 mutants. These studies have suggested that the functions of Rhp51 and Rhp54 in damage repair and recombination resemble the roles of Rad51 and Rad54 in S.cerevisiae, but that compared with S.cerevisiae Rad52, Rad22 has a much less prominent role in the recombinational repair pathway in S.pombe (31,32).
Several proteins required for NHEJ, in particular Yku70, Yku80, Rad50, Mre11 and Xrs2, have been shown to have a role in telomere length maintenance (8,11,33). Deletion of any of these genes in S.cerevisiae results in telomere shortening and in some cases senescence (8,33). Telomeres protect chromosome ends from degradation and from recombination with other chromosomes as well as allowing their complete replication without loss of sequence information. Failure to maintain telomeres can result in cell senescence and cell death.
We have previously shown that the S.pombe homologue of Mre11, the Rad32 protein, is required for meiotic recombination and the repair of UV- and ionising radiation-induced DNA damage (27). The Rad32 protein is phosphorylated in a cell cycle-dependent manner and contains phosphoesterase motifs essential for response to DNA damage (34). Here we describe an analysis of the function of the Rad32 protein in NHEJ and telomere length maintenance and compare its role with those of other DNA damage response proteins in the same processes.
MATERIALS AND METHODS
Yeast strains, plasmids and media
The S.pombe strains used in this study are detailed in Table 1. Procedures for routine growth and maintenance of S.pombe strains were as reported in our previous work (35). The telomere-containing probe was excised as a 1.9 kb ApaI fragment from the plasmid pEN42 (40).
Table 1. Strains used in this study
| Strain | Genotype | Reference |
| sp.011 | ade6-704, leu1-32, ura4-D18, h- | 35 |
| sp.054 | rad22-67, h- | 36 |
| sp.188 | rad8::ura4, ade6-704, leu1-32, h+ | 37 |
| sp.276 | rad32::ura4, ade6-704, leu1-32, h+ | 27 |
| sp.379 | rad3::ura4, ade6-704, leu1-32, h- | 38 |
| sp.391 | rhp9::ura4, ade6-704, leu1-32, h+ | 39 |
| sp.424 | rad22::ura4, ade6-704, leu1-32, h+ | 24 |
| sp.432 | rhp51::ura4, ade6-704, leu1-32, h+ | 25 |
| sp.433 | rhp54::ura4, ade6-704, leu1-32, h+ | 26 |
| sp.441 | rad32-D135N, ade6-704, leu1-32, ura4-D18, h- | 34 |
| sp.443 | rad32-D25N, ade6-704, leu1-32, ura4-D18, h- | 34 |
| sp.473 | rqh1::ura4, ade6-704, leu1-32, h+ | 30 |
Plasmid repair assays
The plasmid used for the NHEJ assays, pAL19, is based on pUC19 and contains a multiple cloning site within the Escherichia coli lacz gene and was a gift from A. Carr (41). pAL19 was digested with the appropriate enzyme and the linear fragment extracted from a 0.8% low melting point gel to ensure that it was free from contamination by supercoiled or open circle DNA. Uncut DNA for use as a control was also gel purified in this manner to allow comparison of the transformation frequencies. The DNA was then used in parallel transformations using a modification of the lithium acetate transformation procedure for S.cerevisiae (42). Plasmids were recovered from S.pombe transformants using the method described by Moreno et al. (43) followed by purification on Wizard miniprep columns according to the manufacturer's instructions and used to transform the E.coli strain DH5[alpha]. At least two different plasmid preparations were used for the analysis of transformation efficiencies and junction sequence determination.
RESULTS
Establishment of a plasmid repair assay for use in S.pombe
In vivoplasmid repair assays have been used successfully in S.cerevisiaeto investigate NHEJ mechanisms for the repair of DNA DSBs and to identify the proteins involved. To investigate the requirements for NHEJ in S.pombewe first needed to establish a plasmid repair assay for use in this organism. We employed pAL19, a S.pombe/E.colishuttle vector based on pUC19 (41), which contains a multiple cloning site within the E.coli lacz gene and which provides suitable restriction enzyme sites within a region with no homology to S.pombe chromosomal sequences. We initially analysed the effect of different types of DNA ends on the transformation frequency of wild-type cells using this assay. Table 2 indicates that linear DNA is generally as efficient at transforming wild-type S.pombe cells as is the uncut DNA and is similar to what has previously been reported by Goedecke et al. (44). Interestingly, there is only a slight reduction in transformation efficiency with blunt-ended DNA, in contrast to the low transformation efficiencies with blunt-ended DNA that are observed in S.cerevisiae (11). These results suggest that the two yeasts may have different mechanisms for repairing or protecting blunt ends of DNA.
Table 2. Relative transformation efficiencies of wild-type cells with linearised DNAcompared to uncut control
| DNA ends | Relative efficiency |
| Uncut | 1 |
| EcoRI | 0.98 0.05 |
| PstI | 0.97 0.11 |
| SmaI | 0.71 0.27 |
Plasmid repair in wild-type cells occurs mainly by the formation of deletions
We wished to determine how the DNA ends were being rejoined. Plasmids were therefore extracted from S.pombe transformants obtained using pAL19 containing 5[prime]-overhanging termini (produced by digestion with EcoRI) and amplified in the E.coli strain DH5[alpha]. The DNA was then analysed for ability to be digested by EcoRI and HindIII and by DNA sequencing (Tables 3 and 4). Of the 13 plasmids analysed, none was digested by EcoRI, while all were digested by HindIII, indicating loss of the EcoRI site in all 13 plasmids. When sequenced these plasmids were found to contain deletions of 2-22 nt (Tables 3 and 4).
Table 3. Summary of plasmids rescued from S.pombe strains following transformation with linear DNA
| Strain | EcoRI | PstI | SmaI | ||||||
| No. | Cut | Junction | No. | Cut | Junction | No. | Cut | Junction | |
| sp.011 | 13 | 0 | 2-22 | 9 | 0 | 4-6 | 7 | 1 | +1-8 |
| rad32-d | 18 | 18 | 0 | 8 | 1 | 0-11 | 7 | 7 | 0 |
| rad22-d | 14 | 0 | 3-26 | 7 | 0 | 3-16 | 6 | 2 | 0-2 |
| rqh1-d | 12 | 1 | 0-36 | 7 | 1 | 0-4 | 6 | 1 | +1-7 |
Table 4. Sequences of junctions created by end joining of EcoRI-digested DNA in wild-type cells
| Plasmid | Sequence | Deletion |
| Parent | GGTACCGAGCTCGAATTCACTGGCCGTC | |
| 11-2 | GGTACCGAGCTCGAGGCCGTC | -7 |
| 11-3 | GGGCCGTC | -20 |
| 11-4 | GGTACCGAGCTCGCTGGCCGTC | -6 |
| 11-5 | GGTACCGAGCTCTGGCCGTC | -8 |
| 11-6 | GGTACCGAGCTCGAATGGCCGTC | -5 |
| 11-7 | GGTACCGACTGGCCGTC | -11 |
| 11-8 | GGTACCGAGCTCGACACTGGCCGTC | -3 |
| 11-9 | GGTACCGAGCTCGAACACTGGCCGTC | -2 |
| 11-B | GGTACCGAGCTGGCCGTC | -10 |
| 11-D | GGTACCGAGCTCACTGGCCGTC | -6 |
| 11-I | GGTACCGAGCTCGACTGGCCGTCTT | -5 |
| 11-J | GGTACCGAGCTCACTGCGGTGAGTTTT | a |
Repair of plasmids with cohesive 5[prime]-termini is altered in the rad32 null allele
Among the genes identified as having a role in the repair of linear plasmids in S.cerevisiae is MRE11, which is the homologue of the S.pombe rad32 gene (27,45). We have previously shown that rad32 is required for repair of DNA strand breaks following exposure to ionising radiation (27) and were interested to determine whether it also has a role in repair of linear plasmids or illegitimate recombination. As shown in Table 5, the rad32 null allele displays a moderate reduction (to ~35% of the wild-type level) in ability to repair EcoRI-digested plasmid. All plasmids rescued from rad32-d transformants obtained with EcoRI-digested DNA were digested by both EcoRI and HindIII to produce a single DNA fragment of the size expected for a linear monomer (Table 3). Further analysis by DNA sequencing of the junction sequences indicated no change in the sequence surrounding the EcoRI site (Table 3). These results indicate that repair of DNA bearing cohesive 5[prime]-termini in rad32-d cells involves no loss of DNA sequence at the break, in marked contrast to the deletions observed in wild-type cells.
Table 5. Relative transformation efficiencies of S.pombe strains with EcoRI-digested DNA
| Strain | Relative efficiency |
| Wild-type (sp.011) | 1.0 |
| rad32-d | 0.35 0.05 (6) |
| rad32-D25N | 1.6 0.39 (3) |
| rad32-D135N | 1.1 0.06 (3) |
| rad3-d | 0.81 0.16 (8) |
| rad8-d | 0.94 0.20 (6) |
| rad22-d | 3.4 0.90 (6) |
| rhp51-d | 1.1 0.17 (4) |
| rhp54-d | 1.1 0.29 (4) |
| rhp9-d | 2.8 0.69 (3) |
| rqh1-d | 3.8 1.1 (7) |
Analysis of repair of plasmids with cohesive or blunt 3[prime]-termini in the rad32 null allele
To determine whether the accuracy of repair shown by the rad32 null allele is restricted to 5[prime]-overhangs, we compared the abilities of wild-type and rad32-d cells to repair 3[prime]-overhangs (generated by PstI) and blunt ends (generated by SmaI). As was seen with EcoRI-digested DNA, there were reductions in the transformation efficiencies of the rad32-d strain with both PstI- and SmaI-digested DNA compared to wild-type levels (data not shown). Analysis of junction sequences indicates that in wild-type cells repair of both 3[prime]-overhangs and blunt ends results in deletions (Table 3). In rad32-d cells, repair of 3[prime]-overhangs also results in deletions, however, analysis of the repair of blunt ends indicated that in all cases there was no end processing and religation was error free (Table 3).
Mutations in the phosphoesterase motifs in Rad32 do not affect NHEJ
We have previously shown that Rad32 contains phosphoesterase motifs which are required for the repair of DSBs following exposure to ionising radiation and for the response to UV (34). We therefore investigated whether these motifs are required for NHEJ, through the analysis of rad32-D25N and rad32-D135N, which contain mutations in phosphoesterase motifs I and III, respectively (34). Transformation efficiencies of the two mutants with EcoRI-digested DNA were similar to those observed in wild-type cells (Table 5). In all cases, plasmids rescued from the phosphoesterase mutants displayed inaccurate repair as in wild-type cells, but in contrast to the accurate repair observed in the rad32 null allele (data not shown).
Plasmid repair is also affected in other recombination and DNA damage-tolerant mutants
To determine whether the effects seen in the rad32-d null allele were observed in other S.pombe mutants defective in recombination, the DNA structure-dependent checkpoint or other aspects of the DNA damage response we analysed plasmid repair in a range of other mutants. Mutants deleted for rad3 (required for the DNA structure-dependent checkpoint; 38) and rad8 (a member of the SNF2 gene family; 37) were not affected in the ability to rejoin 5[prime]-overhanging ends as measured by relative transformation efficiencies with EcoRI-digested DNA (Table 5) and by sequence analysis of junctions (data not shown).
We next analysed NHEJ in the recombination mutants rhp51-d, rhp54-d and rad22-d. rhp51-d and rhp54-d have no defect, while rad22-d cells display an increased ability to repair 5[prime]-overhanging ends (Table 5). We extended these studies to include rhp9-d (defective in the DNA damage checkpoint and recovery from S phase arrest; 39,46) and rqh1-d (defective in DNA damage tolerance; 30) and observed that both null alleles, like rad22-d, have increased ability to carry out NHEJ.
To further investigate NHEJ in rad22-d and rqh1-d, we studied the effect of different types of DNA ends. Both strains also have increased transformation efficiencies with PstI- and SmaI-digested DNA (data not shown). Gel electrophoresis and DNA sequence analysis of plasmids rescued from the rad22-d and rqh1-d alleles transformed with PstI- or SmaI-digested DNA indicated that the majority of plasmids had deletions (Table 3).
Relationship between Rad22, Rqh1 and Rhp9
The fact that rad22-d, rqh1-d and rhp9-d have similar phenotypes with respect to NHEJ may suggest that they are epistatic. In order to investigate this we set up three crosses to investigate the phenotypes of double mutants. The rhp9,rqh1 double mutant is more sensitive to both UV and ionising radiation than either of the single mutants (data not shown). The rqh1,rad22 double mutant germinated but had a severe growth defect and was unable to grow in liquid medium and the rhp9,rad22 double mutant germinated but did not grow further than the 8-16 cell stage. These results imply that the three genes function in different pathways.
Telomere length is reduced in the rad32, rhp9 and rqh1 null alleles
In S.cerevisiae telomere length has been shown to be reduced in mutants defective in NHEJ (8,47). We therefore wished to determine whether the rad32-d, rhp9-d, rqh1-d and rad22-d alleles affect telomere length. This was investigated by Southern analysis of DNA from several different S.pombe mutant strains. As controls we used sp.011 (Fig. 1, lanes 1 and 11) and the checkpoint null allele of rad3(Fig. 1, lanes 2 and 10), which has previously been shown to have short telomeres (48). The length of the telomeres in the rad32 null allele (lane 3) is intermediate between those of the wild-type and rad3-d strains. Analysis of other mutants indicates that shorter telomeres are also present in rhp9-d and, to a somewhat lesser extent, in rhp51-d and rqh1-d. Telomere length was unaffected in rhp54-d and rad22-67. Despite several attempts we were unable to detect telomere-containing ApaI fragments in the 300-1000 bp region in rad22-d (see for example Fig. 1, lane 6), suggesting that either the ApaI site has been lost in this mutant or that the fragments are too small or too dispersed to be detected by Southern analysis. Analysis of telomeres in the rad32 mutants with point mutations in the phosphoesterase motifs, rad32-D25N and rad32-D125N, indicated that in both cases, telomere length is similar to that observed in the wild-type control (data not shown).
Figure 1. Telomere length is reduced in rad32-d, rhp51, rqh1-d and rhp9-d. ApaI-digested DNA was analysed by Southern blotting using a 32P-labelled 1.9 kb ApaI telomere-containing fragment as probe. Lanes 1 and 11, wild-type (sp.011); lanes 2 and 10, rad3-d; lane 3, rad32-d;lane 4, rhp51-d; lane 5, rhp54-d; lane 6, rad22-d; lane 7, rad22-62; lane 8, rqh1-d; lane 9, rhp9-d.
DISCUSSION
Repair of complementary DNA ends has been shown to occur by an accurate, error-free mechanism in S.cerevisiae and vertebrates (see for example 11,15). Our results presented here indicate that in S.pombe the major mechanism for the repair of complementary DNA ends is via an error-prone mechanism which results in deletion of 1-22 nt at the junction. Error-prone end joining events have been shown in other organisms to occur via SSA (involving regions of homology of at least 60-90 nt) or through annealing of DNA sequences containing microhomologies (1-5 nt) resulting in additions or deletions. Analysis of the junction sequences produced in wild-type S.pombe cells indicates deletion of sequence in the majority of cases and that addition of nucleotides occurs very rarely. As expected, we do not see joining via a SSA mechanism, since the plasmid does not contain sufficiently long stretches of repeated sequence. In 8/12 of the junctions shown in Table 4 joining has occurred at sites where there are one to two identical nucleotides at the ends of the DNA being joined, suggesting that joining may be occurring via annealing at sites of microhomology. However, with EcoRI- and PstI-digested DNA there are already regions of microhomology in the form of the complementary DNA ends which are not used in the repair process, perhaps suggesting that the major DNA end joining mechanism in this organism requires a nucleolytic processing event.
We also find that in wild-type cells the repair of blunt ends occurs almost as efficiently as the repair of complementary ends, which contrasts with observations in S.cerevisiae. This may again reflect the need for nucleolytic processing prior to end joining, since this would convert the blunt ends to overhanging ends. Consequently, the repair efficiency would be similar to that observed following transformation with DNA with 5[prime]- or 3[prime]-overhanging ends.
The rad32 null allele has reduced ability to repair all types of ends, as demonstrated by reduced transformation efficiencies and strikingly, unlike wild-type cells, repair of 5[prime]-overhanging and blunt ends does not result in deletions. The accurate end joining in the rad32 deletion strain does not represent a subset of the events occurring in wild-type cells, since accurate repair is not observed, even at this reduced frequency, in wild-type cells. Two possible explanations may account for this phenomenon. The first is that wild-type cells contain two alternative end joining processes, one accurate and one inaccurate. In wild-type cells the inaccurate process requiring Rad32 would predominate over the accurate process which is uncovered in the rad32 null allele. The second, more likely, explanation is that the loss of Rad32 in the null allele results in an alteration in the normal end joining activity due to the absence of a nuclease activity. Thus at least two roles for the Rad32 protein in DNA end joining are suggested, one being required for the efficiency of joining while the other is required to process 5[prime]-overhanging and blunt termini. The Mre11 proteins of S.cerevisiae and humans and the E.coli homologue SbcD have been shown to have 5[prime]->3[prime] exonuclease activity in vivo (49-53). Site-directed mutagenesis of the conserved phosphoesterase motifs in S.cerevisiae Mre11 has shown that these motifs are required for this nuclease activity (51,52). The high level of homology between Mre11 proteins and Rad32, particularly in the phosphoesterase motifs, suggests that Rad32 may also have 5[prime]->3[prime] exonuclease activity, although this has not yet been demonstrated. The lack of processing of 5[prime]-overhanging and blunt termini may therefore be due to the loss of the Rad32 nuclease activity. However, our results obtained with the rad32-D25N and rad32-D135N mutants indicate that the phosphoesterase motifs are not required for DNA end processing, suggesting that for DNA end joining, the Rad32 protein may have a structural role as part of a complex which recruits other nucleases and does not itself act as a nuclease. A similar observation has been made recently with a phosphoesterase mutant of mre11, which is not affected in NHEJ activity (52).
In contrast to rad32-d, the rad22-d, rhp9-d and rqh1-d alleles demonstrated increased transformation frequencies with linear plasmids, suggesting that one of the functions of these proteins may be to suppress NHEJ. Analysis of the three double mutants, rqh1,rad22, rqh1,rhp9 and rad22,rhp9, with respect to radiation sensitivity and growth characteristics indicates that in all cases the double mutants have a more severe phenotype than the single mutants, particularly in the case of double mutants containing rad22-d. This suggests that the gene products act in different processes.
rqh1, the S.pombe homologue of the E.coli RecQ helicase, is required for DNA damage tolerance, a process which links replication to recombination to bypass DNA damage (30). The rqh1-d null allele has been shown to undergo increased homologous recombination after S phase arrest (54). Mutations in related genes in S.cerevisiae and humans (SGS1 and BLM, respectively) also show increased levels of recombination (55,56), however, deletion of the SGS1 gene had little effect on NHEJ in S.cerevisiae (8). The rhp9/crb2 gene, which is related to the S.cerevisiae RAD9 gene and contains two BRCT domains, is required for the chk1-dependent DNA damage checkpoint (39,46). Although the function of the protein is unknown, we have shown that it is also required for an event associated with recovery from S phase arrest (39).
Saccharomyces cerevisiae mutants with altered ability to undergo NHEJ are also defective in telomere length maintenance. We show here that rad32-d, rqh1-d, rad22-d and rhp9-d all have reduced telomeres. The correlation between reduced NHEJ activity and telomere length in rad32-d is similar to that observed with the S.cerevisiae mre11 null allele (8). The reason for our inability to detect telomere sequences in rad22-d is not clear. Recent studies on telomerase mutants have shown that S.pombe chromosomes can circularise so that cells retain viability (57). It is possible that this is what is happening in the rad22-d disruption allele, due to increased illegitimate recombination.
We have shown here that telomere length in rqh1-d is very slightly shorter than in wild-type cells. Interestingly, cells from Werner's syndrome patients (defective in WRN, another member of this helicase family) but not BLM cells (from Bloom's syndrome patients) also show shortened telomeres (58). In rhp9-d cells, telomere length is reduced to a size intermediate between rqh1-d and rad3-d. In this respect it is interesting to note that only a subset of the DNA structure-dependent checkpoint mutants (rad1, rad3, rad17 andrad26, but not hus1, chk1 and cds1) are defective in telomere length maintenance (48). This suggests that the role of rhp9/crb2 in telomere length maintenance is independent of chk1 and may be the same as the rhp9/crb2 function that is required for recovery from S phase arrest.
In conclusion, deletion or disruption of any of the rad32, rad22, rqh1 or rhp9/crb2 genes affects both NHEJ and telomere length in S.pombe. The phenotypes of single and double mutants suggest that these proteins are required in different processes, perhaps providing several alternative methods for the cell to deal with DSBs. Further work on the individual proteins will be required to establish the role of each protein and the relationship of the processes in which they are involved.
ACKNOWLEDGEMENTS
The authors would like to thank Jo Murray and Chris Ford for helpful discussions during preparation of the manuscript. The work was supported in part by CRC grants SP2212/0101 and SP2212/0102. S.W. and D.T. were supported by BBSRC research committee studentships. N.W. was supported by an MRC quota studentship. F.Z.W. thanks the Royal Society and the Wellcome Trust for travel grants.
REFERENCES
*To whom correspondence should be addressed. Tel: +44 1273 678257; Fax: +44 1273 678433; Email: f.z.watts{at}sussex.ac.uk
This page is run by Oxford University Press, Great Clarendon Street, Oxford OX2 6DP, as part of the OUP Journals
Comments and feedback: jnl.info{at}oup.co.uk
Last modification:
Copyright© Oxford University Press, 1999.
This article has been cited by other articles:
![]() |
M. E. Porter-Goff and N. Rhind The Role of MRN in the S-Phase DNA Damage Checkpoint Is Independent of Its Ctp1-dependent Roles in Double-Strand Break Repair and Checkpoint Signaling Mol. Biol. Cell, April 1, 2009; 20(7): 2096 - 2107. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. R. Lieber, S. C. Raghavan, and K. Yu Mechanistic Aspects of Lymphoid Chromosomal Translocations J Natl Cancer Inst Monographs, July 1, 2008; 2008(39): 8 - 11. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Akamatsu, Y. Murayama, T. Yamada, T. Nakazaki, Y. Tsutsui, K. Ohta, and H. Iwasaki Molecular Characterization of the Role of the Schizosaccharomyces pombe nip1+/ctp1+ Gene in DNA Double-Strand Break Repair in Association with the Mre11-Rad50-Nbs1 Complex Mol. Cell. Biol., June 1, 2008; 28(11): 3639 - 3651. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Baker, K. J. Rohleder, L. A. Hanakahi, and G. Ketner Adenovirus E4 34k and E1b 55k Oncoproteins Target Host DNA Ligase IV for Proteasomal Degradation J. Virol., July 1, 2007; 81(13): 7034 - 7040. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. C. Hope, S. M. Mense, M. Jalakas, J. Mitsumoto, and G. A. Freyer Rqh1 blocks recombination between sister chromatids during double strand break repair, independent of its helicase activity PNAS, April 11, 2006; 103(15): 5875 - 5880. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Kegel, P. Martinez, S. D. Carter, and S. U. Astrom Genome wide distribution of illegitimate recombination events in Kluyveromyces lactis Nucleic Acids Res., March 20, 2006; 34(5): 1633 - 1645. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Mochida and M. Yanagida Distinct modes of DNA damage response in S. pombe G0 and vegetative cells Genes Cells, January 1, 2006; 11(1): 13 - 27. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Decottignies Capture of Extranuclear DNA at Fission Yeast Double-Strand Breaks Genetics, December 1, 2005; 171(4): 1535 - 1548. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. B. Gomez, J. M. Espinosa, and S. L. Forsburg Schizosaccharomyces pombe mst2+ Encodes a MYST Family Histone Acetyltransferase That Negatively Regulates Telomere Silencing Mol. Cell. Biol., October 15, 2005; 25(20): 8887 - 8903. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. C. Hope, M. Maftahi, and G. A. Freyer A Postsynaptic Role for Rhp55/57 That Is Responsible for Cell Death in {Delta}rqh1 Mutants Following Replication Arrest in Schizosaccharomyces pombe Genetics, June 1, 2005; 170(2): 519 - 531. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. d'Adda di Fagagna, S.-H. Teo, and S. P. Jackson Functional links between telomeres and proteins of the DNA-damage response Genes & Dev., August 1, 2004; 18(15): 1781 - 1799. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. M. Nakamura, L.-L. Du, C. Redon, and P. Russell Histone H2A Phosphorylation Controls Crb2 Recruitment at DNA Breaks, Maintains Checkpoint Arrest, and Influences DNA Repair in Fission Yeast Mol. Cell. Biol., July 15, 2004; 24(14): 6215 - 6230. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Ono, K. Tomita, A. Matsuura, T. Nakagawa, H. Masukata, M. Uritani, T. Ushimaru, and M. Ueno A novel allele of fission yeast rad11 that causes defects in DNA repair and telomere length regulation Nucleic Acids Res., December 15, 2003; 31(24): 7141 - 7149. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Lydall Hiding at the ends of yeast chromosomes: telomeres, nucleases and checkpoint pathways J. Cell Sci., October 15, 2003; 116(20): 4057 - 4065. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Ueno, T. Nakazaki, Y. Akamatsu, K. Watanabe, K. Tomita, H. D. Lindsay, H. Shinagawa, and H. Iwasaki Molecular Characterization of the Schizosaccharomyces pombe nbs1+ Gene Involved in DNA Repair and Telomere Maintenance Mol. Cell. Biol., September 15, 2003; 23(18): 6553 - 6563. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Kibe, K. Tomita, A. Matsuura, D. Izawa, T. Kodaira, T. Ushimaru, M. Uritani, and M. Ueno Fission yeast Rhp51 is required for the maintenance of telomere structure in the absence of the Ku heterodimer Nucleic Acids Res., September 1, 2003; 31(17): 5054 - 5063. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Tomita, A. Matsuura, T. Caspari, A. M. Carr, Y. Akamatsu, H. Iwasaki, K.-i. Mizuno, K. Ohta, M. Uritani, T. Ushimaru, et al. Competition between the Rad50 Complex and the Ku Heterodimer Reveals a Role for Exo1 in Processing Double-Strand Breaks but Not Telomeres Mol. Cell. Biol., August 1, 2003; 23(15): 5186 - 5197. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Miyoshi, M. Sadaie, J. Kanoh, and F. Ishikawa Telomeric DNA Ends Are Essential for the Localization of Ku at Telomeres in Fission Yeast J. Biol. Chem., January 10, 2003; 278(3): 1924 - 1931. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. S. Symington Role of RAD52 Epistasis Group Genes in Homologous Recombination and Double-Strand Break Repair Microbiol. Mol. Biol. Rev., December 1, 2002; 66(4): 630 - 670. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Bundock and P. Hooykaas Severe Developmental Defects, Hypersensitivity to DNA-Damaging Agents, and Lengthened Telomeres in Arabidopsis MRE11 Mutants PLANT CELL, October 1, 2002; 14(10): 2451 - 2462. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. M. Nakamura, B. A. Moser, and P. Russell Telomere Binding of Checkpoint Sensor and DNA Repair Proteins Contributes to Maintenance of Functional Fission Yeast Telomeres Genetics, August 1, 2002; 161(4): 1437 - 1452. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. P. Robinson, R. McCulloch, C. Conway, A. Browitt, and J. D. Barry Inactivation of Mre11 Does Not Affect VSG Gene Duplication Mediated by Homologous Recombination in Trypanosoma brucei J. Biol. Chem., July 12, 2002; 277(29): 26185 - 26193. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. A. Marchetti, S. Kumar, E. Hartsuiker, M. Maftahi, A. M. Carr, G. A. Freyer, W. C. Burhans, and J. A. Huberman A single unbranched S-phase DNA damage and replication fork blockage checkpoint pathway PNAS, May 28, 2002; 99(11): 7472 - 7477. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Frank-Vaillant and S. Marcand NHEJ regulation by mating type is exercised through a novel protein, Lif2p, essential to the Ligase IV pathway Genes & Dev., November 15, 2001; 15(22): 3005 - 3012. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Bucholc, Y. Park, and A. J. Lustig Intrachromatid Excision of Telomeric DNA as a Mechanism for Telomere Size Control in Saccharomyces cerevisiae Mol. Cell. Biol., October 1, 2001; 21(19): 6559 - 6573. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Sonoda, M. Takata, Y. M. Yamashita, C. Morrison, and S. Takeda Homologous DNA recombination in vertebrate cells PNAS, July 17, 2001; 98(15): 8388 - 8394. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. de Jager, M. L. G. Dronkert, M. Modesti, C. E. M. T. Beerens, R. Kanaar, and D. C. van Gent DNA-binding and strand-annealing activities of human Mre11: implications for its roles in DNA double-strand break repair pathways Nucleic Acids Res., March 15, 2001; 29(6): 1317 - 1325. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Perego, G. S. Jimenez, L. Gatti, S. B. Howell, and F. Zunino Yeast Mutants As a Model System for Identification of Determinants of Chemosensitivity Pharmacol. Rev., December 1, 2000; 52(4): 477 - 492. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. E. Gerecke and M. E. Zolan An mre11 Mutant of Coprinus cinereus Has Defects in Meiotic Chromosome Pairing, Condensation and Synapsis Genetics, March 1, 2000; 154(3): 1125 - 1139. [Abstract] [Full Text] |
||||
![]() |
W. J. Kim, S. Lee, M. S. Park, Y. K. Jang, J. B. Kim, and S. D. Park Rad22 Protein, a Rad52 Homologue in Schizosaccharomyces pombe, Binds to DNA Double-strand Breaks J. Biol. Chem., November 3, 2000; 275(45): 35607 - 35611. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. L. Limoli, E. Giedzinski, W. F. Morgan, and J. E. Cleaver Inaugural Article: Polymerase eta deficiency in the xeroderma pigmentosum variant uncovers an overlap between the S phase checkpoint and double-strand break repair PNAS, July 5, 2000; 97(14): 7939 - 7946. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||














