| Nucleic Acids Research | Pages |
Repair of apurinic/apyrimidinic sites by UV damage endonuclease; a repair protein for UV and oxidative damage
Introduction
Materials And Methods
Enzymes and chemicals
Escherichia coli strains
DNA substrates
Preparation of antibodies
Incision assay using synthetic oligonucleotides
Partial purification of S.pombe UVDE and incision assay
Determination of the incision termini
Expression plasmid and survival experiments
Results
UVDE introduces a nick at an AP site produced by uracil DNA glycosylase
Characterization of the nicked termini
3[prime]-Repair activity of UVDE for single-strand breaks at AP sites
Influence of the opposite base at an AP site on nicking by UVDE
UVDE complements the deficiency in AP endonuclease of E.coli host cells
AP endonuclease activity in S.pombe cell extracts
Nicking activity of UVDE on Dewar photoproducts
Discussion
AP endonuclease activity of UVDE
AP endonuclease in S.pombe
Damage recognition and repair initiated by UVDE
Origin of UVDE for repair of UV and oxidative DNA damage
Acknowledgements
References
Repair of apurinic/apyrimidinic sites by UV damage endonuclease; a repair protein for UV and oxidative damage
Received April 12, 1999; Revised June 1, 1999; Accepted June 8, 1999
ABSTRACT UV damage endonuclease (UVDE) initiates a novel form of excision repair by introducing a nick immediately 5[prime] to UV-induced cyclobutane pyrimidine dimers or 6-4 photoproducts. Here, we report that apurinic/apyrimidinic (AP) sites are also nicked by Neurospora crassa and Schizosaccharomyces pombe UVDE. UVDE introduces a nick immediately 5[prime] to the AP site leaving a 3[prime]-OH and a 5[prime]-phosphate AP. Apyrimidinic sites are more effectively nicked by UVDE than apurinic sites. UVDE also possesses 3[prime]-repair activities for AP sites nicked by AP lyase and for 3[prime]-phosphoglycolate produced by bleomycin. The Uvde gene introduced into Escherichia coli cells lacking two types of AP endonuclease, Exo III and Endo IV, gave the host cells resistance to methylmethane sulfonate and t-butyl hydroperoxide. We identified two AP endonuclease activities in S.pombe cell extracts. Besides cyclobutane pyrimidine dimers and 6-4 photoproducts, N.crassa UVDE also nicks Dewar photoproducts. Thus, UVDE is able to repair both of the major forms of DNA damage in living organisms: UV-induced DNA lesions and AP sites.
INTRODUCTION
More than 30 years ago, a model was postulated for excision repair of DNA damage in which a nick is first introduced 5[prime] to a lesion, followed by removal of the damaged nucleotide(s), repair synthesis and ligation (1). This was a simple and reasonable model to explain possible excision repair, because, once a 3[prime]-OH end is introduced by nicking 5[prime] to the damage, DNA polymerase can begin repair synthesis in a similar manner to its action in DNA replication. However, the process that was eventually elucidated was nucleotide excision repair (NER), in which dual nicks either side of the damaged site are introduced and repair synthesis completes the stretch between the nicks (for reviews see 2,3). In addition to NER, most organisms possess another excision repair mechanism known as base excision repair (BER). BER was defined as the repair process that is initiated by base excision by various DNA glycosylases, producing apurinic or apyrimidinic (AP) sites (for a review see 4). The AP site is further processed by AP endonuclease, creating a nick with a 3[prime]-OH, from which DNA polymerase [beta] or polymerase [delta] (or [epsiv]) starts to synthesize DNA. The AP site is removed by polymerase [beta] or FEN1 before completion of the repair process by ligation (5,6). The major substrate for NER is UV-induced DNA lesions, while base damage and AP sites produced by reactive oxygen species are the major substrates for BER.
We previously isolated a novel gene from the filamentous fungus Neurospora crassa which complements UV sensitivity of repair-deficient Escherichia coli and other organisms (7). Homologs of this gene were also found in the fission yeast Schizosaccharomyces pombe as well as in the bacterium Bacillus subtilis (8). The gene product UV damage endonuclease (UVDE) of N.crassa (NcUVDE) is an endonuclease, which is novel in several respects (7-10). First, it recognizes two structurally different UV lesions, cyclobutane pyrimidine dimers (CPD) and 6-4 photoproducts (6-4PP). Second, UVDE does not excise the damaged bases (therefore, it is not a DNA glycosylase), but introduces a nick immediately 5[prime] to each lesion leaving 3[prime]-OH and 5[prime]-phosphate CPD or 5[prime]-phosphate 6-4PP. Third, using various repair-deficient mutants of S.pombe as well as in vitro studies, we showed that the single nick introduced by S.pombe UVDE (SpUVDE) was processed by the RAD2 gene product, a S.pombe homolog of human FEN1, which nicks the 3[prime]-overhang (10,11). We designated this novel repair pathway UVER (UVDE-dependent excision repair). Interestingly, UVER resembles the old excision repair model and provides, in addition to NER and BER, a third category of excision repair in which a single nick, without base excision, initiates excision repair of UV-induced DNA damage (12).
UVDE has until now been thought to be an exclusively UV damage-specific DNA repair enzyme. However, in this report, we show that UVDE is also able to introduce a nick at AP sites and, furthermore, possesses 3[prime]-repair activity for single-strand breaks at AP sites, suggesting that UVDE can function as an AP endonuclease as well as a UV endonuclease.
MATERIALS AND METHODS
Enzymes and chemicals
Recombinant UVDEs derived from N.crassa and S.pombe were purified as described previously (7,8). In addition to the recombinant SpUVDE, a fusion protein, malE-SpUVDE, between SpUVDE and maltose-binding protein (MBP) was prepared. For this purpose, the S.pombe Uvde gene was introduced into a pMAL-c2X vector (New England BioLabs) and the fusion protein was purified by binding to an amylose column. Escherichia coli endonuclease III (Endo III) and terminal deoxynucleotidyl transferase (TdT) were purchased from Trevigen and Gibco BRL, respectively. T4 polynucleotide kinase and calf intestine phosphatase were obtained from Takara. Methylmethane sulfonate (MMS) and t-butyl hydroperoxide (t-BuO2H) were purchased from Sigma and Merck, respectively. Bleomycin was purchased from Wako Pure Chemical Industries.
Escherichia coli strains
Escherichia coli strain XL1-Blue (Stratagene) was used to produce recombinant proteins. Escherichia coli strain AB1157 was used as the wild-type strain. RPC501 [AB1157 nfo-1::Kan (Xth-pncA)90] lacking both Exo III and Endo IV AP endonuclease was originally derived by Dr R.P. Cunningham and obtained from Dr K. Yamamoto.
DNA substrates
Oligodeoxyribonucleotides (49mers) containing a CPD or a 6-4PP were synthesized on a Perkin-Elmer Applied Biosystems model 394 DNA/RNA synthesizer using dimer building blocks, as reported previously (13,14). The sequence of the lesion-containing strand was d(AGCTACCATGCCTGCAC-GAATTAAGCAATTCGTAATCATGGTCATAGCT) (the CPD or 6-4PP site is underlined). The nucleotide sequence of this oligomer is the same as that used before by another group (15). To obtain the Dewar photoisomer of the 6-4PP, an aliquot of 49mer (0.6 A260 units) containing a 6-4PP was dissolved in distilled water (1.0 ml) in a Pyrex Petri dish and irradiated on ice for 1 h with a 450 W high pressure mercury lamp covered with a Pyrex jacket. The product (Dewar 49mer) gave a single peak in HPLC analysis and had no UV absorption at 325 nm, which is characteristic of the 6-4PP.
To obtain an oligomeric substrate with an AP site, a synthetic 49mer duplex containing uracil instead of the 5[prime] thymine base of CPD in the above oligonucleotide was treated with 2 U of uracil DNA glycosylase for 30 min at 37°C and placed on ice before treating with UVDE or Endo III. For the preparation of 3[prime]-blocked AP sites a 49mer oligo duplex containing a single uracil was incubated with 2 U of uracil DNA glycosylase and 10 U of E.coli Endo III for 60 min at 37°C and the enzymes were heat denatured for 3 min at 65°C. The reaction product was directly used as a 3[prime]-blocked substrate. Another 3[prime]-blocked AP site, 3[prime]-phosphoglycolate (3[prime]-PG), was prepared as previously reported by another group (16) with slight modifications. Briefly, an oligonucleotide duplex with a 32P-5[prime]-labeled strand was treated with bleomycin (8 µg) in 40 µl of reaction buffer (25 mM HEPES-NaOH, pH 7.5, 50 µM FeCl3 and 1 mM H2O2) at 0°C for 2 h. From the duplex, 19mer single-strand DNA with the thus produced 3[prime]-PG was purified due to its higher migration rate in gel electrophoresis than the other products. The 19mer and an 18mer were then annealed, resulting in a 38mer duplex oligomer containing a single base gap with a 3[prime]-PG. We used the same sequence as that reported in the literature (15). Another oligonucleotide, a 30mer f-AP oligo containing an AP site analog [3-hydroxy-2-(hydroxylmethyl)-tetrahydrofuran], d(CTCGTCAGCATCT-AP-CATCATACA-GTCAGTG), was prepared using dSpacer phosphoamidite (Glen Research) and purified by the same method as described for the 49mers.
Preparation of antibodies
Rabbit polyclonal antibodies were raised against purified recombinant proteins of N.crassa and S.pombe UVDE. Antisera were affinity purified on columns containing the recombinant protein coupled to CNBr-activated Sepharose 4B (Pharmacia) according to the protocol described previously (17).
Incision assay using synthetic oligonucleotides
Incision of oligomers containing DNA lesions was assayed in all the experiments as follows. Oligonucleotides containing a CPD, a 6-4PP, a Dewar photoisomer or an abasic site were either 5[prime]-labeled with [[gamma]-32P]ATP by T4 polynucleotide kinase or 3[prime]-labeled with [[alpha]-32P]ddATP by TdT and immediately annealed to the complementary oligomer. Oligonucleotides (10 fmol of 5[prime]- or 3[prime]-labeled and annealed) were incubated with 50 pmol of UVDE in reaction buffer A (50 mM Tris-HCl, pH 7.5, 2 mM DTT, 10 mM MgCl2 and 0.1 M NaCl) for 15 min at 37°C. We used that amount of UVDE which cleaves 6-4PP substrates almost completely under the above conditions. Since UVDE is not stable, a considerable part of the enzyme used in the experiments may have lost its nicking activity. We, therefore, used an excess amount of UVDE over the substrates. The reaction was stopped by adding an equal volume of 90% formamide loading buffer, heated at 70°C for 3 min and analyzed on 15% denaturing (7 M urea) polyacrylamide gels. Migration patterns of DNA fragments were analyzed using a BAS 2000 Image Analyzer (Fuji Film). For the size marker, 5[prime]-end-labeled 19, 20, 21, 28, 29, 30 and 49mer oligonucleotides with the same sequence as the analyzed oligonucleotides were used. To inhibit the activities of UVDE in reaction mixtures, 1 µg of affinity-purified antibody against UVDE was pre-incubated with UVDE on ice for 30 min, then the nicking reaction was started by adding substrate. In some cases antibodies could inhibit the reaction only partially due to the short reaction time and the excess amount of the purified protein.
Partial purification of S.pombe UVDE and incision assay
Schizosaccharomyces pombe cells of strain Y4 (h+ ade6-M216 ura4-D18 leu1-32) were cultured in a complete medium to late log growth phase and harvested. Cells were resuspended in extraction buffer [50 mM Tris-HCl, pH 7.5, 0.3 M KCl, 0.1% NP-40, 2 mM DTT, protease inhibitor cocktail (Boehringer)] and disrupted by adding glass beads and vigorously agitating four times for 15 s using a vortex mixer. Cell extracts were collected from the supernatant obtained by centrifugation of the disrupted cells. After desalting the extracts on a G-50 column, the extracts were applied to a heparin-agarose column pre-equilibrated with buffer A (50 mM Tris-HCl, pH 7.5, 0.1% NP-40, 2 mM DTT). After washing the column with buffer A containing 0.1 M KCl, fractions eluted by buffer A containing 0.4 M KCl were concentrated, dialyzed against buffer A (0.1 M KCl) and further applied to SP-Sepharose. After elution with a KCl 0.1 M step gradient, the 0.4 M KCl fraction was used as the UVDE fraction of S.pombe. In the incision assay, oligonucleotides (50 fmol, 5[prime]-labeled and annealed) were incubated with fractionated S.pombe extracts (50 µg) in reaction buffer A for 90 min at 30°C followed by phenol extraction and ethanol precipitation before PAGE analysis.
Determination of the incision termini
To determine the chemical nature of the 3[prime]-termini in the UVDE-mediated cleavage products for the 49mer duplex containing a single AP site, 5[prime]-labeled substrate (10 fmol) was nicked with UVDE (50 pmol) and then treated with 4 U of TdT in the presence of ddTTP for 30 min at 37°C and analyzed by PAGE (7). To determine the presence of a 5[prime]-phosphoryl group, 3[prime]-labeled 49mer oligo (10 fmol) was nicked with UVDE (50 pmol) and then treated with 2 U of calf intestinal phosphatase (CIP) for 15 min at 37°C and analyzed by PAGE.
Expression plasmid and survival experiments
For expression in E.coli cells, the cDNA of the N.crassa Uvde gene was inserted behind a tac promotor in a modified pFLAG2 vector (Promega). Expression of the protein was confirmed by the antibody raised against NcUVDE. For determination of survival against MMS and t-BuO2H, exponentially growing E.coli cultures of strains AB1157 and RPC501 were exposed to the chemicals (MMS 0.2% v/v, t-BuO2H 10 µg/ml) for the times indicated at room temperature in LB medium. Serial dilutions were made in minimal medium prior to plating on LB agar. Colonies were counted after incubation at 30°C for up to 48 h. The survival experiments were repeated three times for each chemical treatment and the mean values were calculated.
RESULTS
UVDE introduces a nick at an AP site produced by uracil DNA glycosylase
We previously showed that both purified NcUVDE and SpUVDE introduce a nick immediately 5[prime] to UV-induced CPDs as well as 6-4PP, leaving a 3[prime]-OH and a 5[prime]-phosphate UV lesion (7,8). We have here analyzed whether UVDE is able to repair AP sites. A synthetic 49mer with a uracil at the center of the sequence (Fig. 1A, the opposite base to the uracil is adenine) was constructed. The uracil was converted to an AP site using uracil DNA glycosylase. We used purified recombinant NcUVDE and SpUVDE (Fig. 1C). The purified SpUVDE is very unstable and produces two degradation products (shown as two slower migrating bands under the main band in Fig. 1C) which possess no enzymatic activity. To our surprise, the oligonucleotide with an AP site is nicked by NcUVDE (Fig. 2A) as well as by SpUVDE (Fig. 2C). The 5[prime]-labeled DNA fragment migrates faster after treatment with NcUVDE than DNA fragments treated with two AP lyases of T4 UV DNA glycosylase (T4 pdg, Fig. 2A, lane 3) or E.coli Endo III (lane 4), suggesting that UVDE nicked more closely 5[prime] to the AP site than did the AP lyases. The nicking activity was inhibited by addition of anti-NcUVDE (Fig. 2B) and anti-SpUVDE (Fig. 2C), confirming that the nicks were introduced by the enzymatic activity of each UVDE and not by contaminants from the host cells. Since prepared recombinant SpUVDE is unstable and may contain contaminated AP lyase from the host cells, as judged by the presence of a shorter band above the nicked 20mer (Fig. 2C), which was not influenced by addition of anti-SpUVDE, we constructed and purified a fusion protein between MBP and SpUVDE, malE-SpUVDE, by affinity chromatography. To suppress the background AP lyase activity, we used, instead of the AP site produced by uracil DNA glycosylase, an analog of an AP site with a tetrahydrofuran derivative (f-AP), which is resistant to the nicking activity of AP lyase, in a 30mer oligo. malE-SpUVDE clearly nicks the AP site analog in the 30mer oligo (Fig. 2D). Thus, the AP site is a substrate for both UVDEs.
Figure 1. 49mer oligonucleotides containing DNA damage and recombinant UVDE. (A) A 49mer with a uracil in its center, which is converted to an AP site (ap) by uracil glycosylase. (B) A 49mer with CPD, 6-4PP or Dewar photoisomer at the TT sequence in the middle of the oligo. (C) Purified recombinant NcUVDE and SpUVDE on PAGE.
Figure 2. Nicking activity of UVDE at an AP site. (A) 5[prime]-End-labeled AP site substrate and DNA nicked by NcUVDE (lane 2), T4 CPD glycosylase (t4 pdg, lane 3) and E.coli Endo III (lane 4). (B) Inhibition of nicking activity of NcUVDE at AP sites by anti-NcUVDE. (C) Nicking by SpUVDE at AP sites and its inhibition by anti-SpUVDE. (D) Nicking of an f-AP site by malE-SpUVDE.
Characterization of the nicked termini
The nicked AP site produced by NcUVDE in the 49mer oligo was further analyzed by labeling the 5[prime]- or 3[prime]-end of the oligonucleotide. Because of the very unstable characteristic of SpUVDE, further analysis was performed with NcUVDE. The 5[prime]-labeled oligo was nicked with NcUVDE and incorporation of a ddTTP to the nicked 3[prime]-end by TdT was analyzed by PAGE. Figure 3A shows that the reaction provided the substrate with an additional nucleotide (lane 3), indicating that the 3[prime]-end of the nick had an OH-terminus. Next, the 3[prime]-end-labeled oligonucleotide was nicked with NcUVDE and treated with CIP. The migration rate of the oligonucleotides was delayed by the CIP treatment (Fig. 3B, lane 3), which indicates the presence of a phosphate at the nicked 5[prime]-end before CIP treatment. Thus, NcUVDE recognizes AP sites and introduces a nick leaving a 3[prime]-OH and a 5[prime]-phosphate, like other AP endonucleases.
Figure 3. Determination of UVDE nicked ends at an AP site. (A) Treatment of 5[prime]-labeled and NcUVDE-nicked 49mer with an AP site by ddTTP and TdT (lane 3). (B) Treatment of 3[prime]-labeled, NcUVDE-nicked 49mer with an AP site by CIP.
3[prime]-Repair activity of UVDE for single-strand breaks at AP sites
Many DNA glycosylases introduce a nick 3[prime] to an AP site by their concomitant AP lyase ([beta]-elimination) activity. Consequently, the resulting 3[prime]-end carries a phosphate of the 3[prime]-[alpha],[beta]-unsaturated aldehyde residue (Fig. 4A, upper), which should be repaired to create 3[prime]-OH for further repair synthesis. In the two types of AP endonucleases so far known in living cells, both Exo III and Endo IV have 3[prime]-repair (phosphodiesterase) activity for the blocked 3[prime]-terminus at an AP site. We looked at 3[prime]-repair activity in NcUVDE. Figure 4B (lane 3) shows that NcUVDE acts as a 3[prime]-phosphodiesterase against the 3[prime]-end produced by the AP lyase activity of E.coli Endo III. This activity of NcUVDE is also blocked by the addition of anti-NcUVDE (lane 4). Another biologically important single-strand break which is commonly produced by ionizing radiation or by the anticancer drug bleomycin is 3[prime]-PG (Fig. 4A, lower). We purified a single-strand oligonucleotide with 3[prime]-PG by PAGE after treatment of double-strand oligonucleotides with bleomycin and annealed the single-strand oligonucleotide to the complementary strand. The 3[prime]-PG thus prepared in the 38mer oligo is also removed by NcUVDE (Fig. 4C). It should be noted that an oligonucleotide with a 3[prime]-OH migrates slower than that with 3[prime]-PG due to its negative charge (16).
Figure 4. 3[prime]-Repair activity of NcUVDE. (A) Structures of two AP sites with a strand break, an [alpha],[beta]-unsaturated aldehyde and a 3[prime]-PG. (B) Repair of Endo III-treated AP site (lane 3) and its inhibition by anti-NcUVDE (lane 4). (C) Repair of 3[prime]-PG by NcUVDE (lane 2).
These data show that NcUVDE acts as an exonuclease at an AP site with a single-strand break to create a primer-template for repair synthesis. We could not detect a 3[prime]->5[prime] exonuclease activity in UVDE. This characteristic is similar to that of Endo IV-type AP endonuclease.
Influence of the opposite base at an AP site on nicking by UVDE
We next analyzed the influence of the base opposite the AP site on the nicking activity of UVDE. An oligonucleotide harboring an AP site was annealed with a complementary strand with different bases opposite the AP site (Fig. 5A). The oligonucleotides were then treated with a defined amount of NcUVDE and the amount of nicking at the AP site was determined by gel electrophoresis (Fig. 5B). As shown in Figure 5B and C, AP sites with adenine or guanine on the complementary strand are nicked three to four times more effectively by NcUVDE than those with thymine and cytosine opposite the AP site. Thus, the opposite base influences the nicking activity of NcUVDE at an AP site.
Figure 5. Dependence of nicking activity on bases opposite the AP site. (A) Substrate. (B) Nicking activity of NcUVDE at an AP site with a different opposite base. (C) Relative influence of the opposite base on nicking activity.
UVDE complements the deficiency in AP endonuclease of E.coli host cells
To see whether UVDE functions as a repair enzyme for AP sites in cells, we introduced the N.crassa Uvde gene into the E.coli mutant RPC501, which lacks two AP endonucleases, Exo III and Endo IV, encoded by the xth and nfo genes, respectively. The transformed cells were exposed to MMS or t-BuO2H and survival was compared with that of wild-type cells. Figure 6A and B clearly shows that this gene provided the AP endonuclease-defective cells with resistance to both chemicals. These data indicate that NcUVDE functions as a repair enzyme for oxidative DNA damage in vivo in the host cells.
Figure 6. Survival of E.coli cells of AP endonuclease-deficient strain RPC501 (xth nfo). Survival of RPC501 transformed with vector pFnd (closed triangles) or with pFnd/NcUVDE (closed squares) and wild-type cells of strain AB1157 (closed circles) is shown after treatment with (A) 0.2% MMS or (B) 10 µg/ml t-BuO2H.
AP endonuclease activity in S.pombe cell extracts
While we have here shown AP endonuclease activity in the recombinant SpUVDE, several groups have failed to detect AP endonuclease activity in S.pombe cell extracts (18). We therefore analyzed AP endonuclease activity in the fractionated samples from S.pombe cell extracts. Using 32P-labeled f-AP, we found a weak nicking activity in the total cell extract which could be concentrated in the heparin-agarose-binding fraction (Fig. 7A, lanes 1 and 2). The heparin-agarose-binding fraction was further applied to SP-Sepharose and a major nicking activity of f-AP was found in the fraction eluted by 0.1 M KCl (lane 3), while the fraction eluted by 0.3 M KCl (lane 5) contains a very weak nicking activity for f-AP. This fraction was concentrated and found to contain UVDE, which nicks CPD, 6-4PP and f-AP substrates (Fig. 7B, lanes 1-3). These data suggest that there are at least two AP endonuclease activities, of which the minor activity is derived from UVDE.
Figure 7. Nicking activity in fractionated S.pombe extracts (see text for explanation). (A) Fractionation of S.pombe extracts and nicking activity on f-AP. (B) Nicking activity of the concentrated fraction eluted from a SP-Sepharose column by 0.3 M KCl.
Nicking activity of UVDE on Dewar photoproducts
Since both NcUVDE and SpUVDE introduce a nick at UV-induced CPD and 6-4PP DNA damage, we asked whether Dewar isomers of 6-4PP are also substrates for UVDE. The Dewar-type UV damage is a photoisomer of 6-4PP created by absorption of UVB (around 320 nm) by 6-4PPs. Under natural conditions many of the UV-induced 6-4PPs are converted to Dewar photoisomers (19) and, therefore, Dewar photoisomers are an important form of UV damage in living organisms. Using a 49mer synthetic oligonucleotide with a CPD, 6-4PP or Dewar photoisomer in the center (Fig. 1B), nicking activity of UVDE against Dewar photoisomers was tested. Figure 8A and B shows that Dewar photoisomers are also nicked by Nc-UVDE. The nicked 5[prime]-labeled fragment has the same migration rate as the 20mer marker and other nicked UV damage, suggesting that the Dewar photoisomer is nicked immediately 5[prime] to the lesion, as are CPD and 6-4PP. Thus, NcUVDE can recognize and introduce a nick at all the three major UV photoproducts in DNA.
Figure 8. Nicking activity of UVDE at a Dewar photoproduct. (A) The Dewar photoisomer is nicked by NcUVDE. (B) The nicking activity is inhibited by anti-NcUVDE. (C) Recombinant SpUVDE fails to nick the Dewar photoisomer. (D) Partially purified S.pombe UVDE from yeast extracts fails to nick the Dewar photoisomer. (E) A malE-SpUVDE fusion protein nicks CPD, 6-4PP and Dewar photoisomers.
In contrast to NcUVDE, SpUVDE does not nick the Dewar oligomer (Fig. 8C). Since the cloned SpUVDE may contain a mutation(s) specifically inactivating its nicking activity on Dewar photoisomers, we used partially purified SpUVDE from S.pombe cell extracts (Fig. 7B). While 6-4PP are nicked by the partially purified SpUVDE, it does not nick the oligonucleotide with a Dewar photoisomer (Fig. 8D). However, malE-SpUVDE is able to nick the oligonucleotide with a Dewar photoisomer (Fig. 8E), suggesting a functional modification of SpUVDE by the N-terminal fusion.
DISCUSSION
AP endonuclease activity of UVDE
We previously showed that purified recombinant UVDE proteins derived from N.crassa and S.pombe are able to introduce a nick immediately 5[prime] to UV-induced CPD as well as 6-4PP and that the nicked DNA is processed by RAD2, a FEN1 (FLAP endonuclease) homolog in S.pombe (7,8,10). Though it was once reported that S.pombe UVDE did not show any AP endonuclease activity (9), we found that both UVDE possess AP endonuclease activity. As shown in Figures 2 and 3, UVDE introduces a nick at an AP site produced by uracil DNA glycosylase and leaves 3[prime]-OH and 5[prime]-phosphate ends for further repair synthesis. In addition, NcUVDE possesses 3[prime]-repair activity for an AP site containing a 3[prime]-phosphate created by 3[prime]-AP lyase or 3[prime]-PG produced by bleomycin and creates a 3[prime]-OH for further repair synthesis (Fig. 4). Since these activities were inhibited completely or almost completely by pre-incubation of the proteins with antibodies raised against each UVDE, the nicking activities were derived from the recombinant proteins. UVDE, like an Endo IV-type AP endonuclease, does not show 3[prime]->5[prime] exonuclease activity. Expression of the N.crassa Uvde gene in an E.coli xth and nfo double mutant provided the host cells with a small but definite increase in resistance to MMS and t-BuO2H (Fig. 6), chemicals known to produce alkylated bases leading to strand breaks or various AP sites. These results show unequivocally that UVDE can function as an AP endonuclease. The partial complementation in E.coli host cells may be explained by the fact that UVDE prefers apyrimidinic sites and apurinic sites may not be efficiently repaired in the cells, as shown in Figure 5. Furthermore, because of the reported toxicity of UVDE to E.coli host cells (8), it is likely that only transformants with a very low expression of UVDE have been selected. Previously, a similar result was reported, as expression of the human HAP1 gene (encoding an Exo III-type AP endonuclease) achieved only a marginal complementation effect on t-BuO2H sensitivity in an E.coli RPC501 strain (20). There may also be another reason(s) for the incomplete complementation by foreign AP endonucleases in E.coli host cells.
AP endonuclease in S.pombe
Though genes encoding the homologs of E.coli Exo III and Endo IV have been identified in the S.pombe genome database, the enzymatic activity of the gene products has not yet been identified. Nor has an AP endonuclease activity been detected in cell extracts of S.pombe (18). We found, however, at least two AP endonuclease activities in fractions of S.pombe cell extracts. The nicking activity of UVDE on UV damage and AP sites in the cell extracts is very low and can only be detected by concentration of the fraction eluted with 0.3 M KCl from a SP-Sepharose column. While Uvde deletion mutants of N.crassa and S.pombe do not show any significant MMS sensitivity (21; S.Yasuhira and A.Yasui, unpublished data), UV sensitivity of Uvde deletion mutants of N.crassa and S.pombe has been reported (10,21). We think that there is a very efficient alternative repair pathway(s) for AP sites in these organisms and that it masks repair by UVDE. In the case of UV damage, NER activity may be limited in these organisms (21) and the activity of UVDE contributes to the survival increase after UV irradiation. Therefore, the biological meaning of the AP endonuclease activity of UVDE remains to be elucidated.
Damage recognition and repair initiated by UVDE
A unique characteristic of UVDE as an AP endonuclease is its preference for an apyrimidinic site (Fig. 5B). A purine as the opposite base may increase the recognition and/or incision of AP sites by UVDE. Neither human AP endonuclease nor bacterial Exo III and Endo IV show any preference regarding the opposite base (22,23). This preference shown by the AP endonuclease activity of UVDE may reflect the mechanisms by which UVDE recognizes UV damage at dipyrimidine sites. A `flip-out' mechanism of the opposite base may be involved in the recognition process, as was shown for T4 DNA glycosylase in its recognition of CPD (24). In contrast to AP sites, UVDE does not introduce nicks at oligonucleotides harboring base modifications like thymine glycol or 8-oxoguanine (not shown), suggesting that among various UV lesions and AP sites there may be a common structural abnormality which can be detected by UVDE.
We showed that as well as CPD and 6-4PP, Dewar-type photoproducts are also nicked by NcUVDE (Fig. 8A). Our preliminary data show that 6-4PP are the best substrate for NcUVDE, while CPD, Dewar photoisomers and AP sites are nicked with almost equal efficiency (not shown). In contrast to NcUVDE, recombinant as well as partially purified endogenous SpUVDE are unable to introduce nicks in the oligonucleotide harboring a Dewar photoisomer in our assay (Fig. 8B and C). However, a malE-SpUVDE fusion protein is able to introduce a nick at a Dewar photoisomer (Fig. 8D) as well as a mismatched DNA with a one base loop, which is not a substrate for UVDE without the N-terminal fusion (not shown). We think that the N-terminal sequence of SpUVDE, which differs from that of NcUVDE, may inhibit the specific binding or the nicking activity of UVDE at Dewar photoisomers. Modification of the N-terminus of UVDE may change its substrate specificity. This is interesting and useful information in understanding the structural basis of the repair activity of UVDE.
Origin of UVDE for repair of UV and oxidative DNA damage
We have here identified AP endonuclease activity in UVDE, which may be a novel third AP endonuclease besides the Exo III and Endo IV types distributed from bacteria to humans. Very recently, by employing secondary structure-based modeling, a possible structural similarity between UVDE and Endo IV-type AP endonuclease was proposed (25). Four of the seven histidine residues conserved in all the UVDE proteins may build a TIM barrel structural fold with a binding center to deoxyribose. This finding suggests the possibility that UVDE and its UV damage repair activity may have evolved from an Endo IV-type AP endonuclease by adding a domain(s) necessary for recognition of UV damage. Our finding that UVDE has an AP endonuclease activity which is, with respect to the absence of exonuclease activity, similar to that of Endo IV, may support the above model for the origin of UVDE. UVDE may initiate excision repair of various types of DNA damage by a modified AP endonuclease activity. However, since the amino acid sequence similarity between Endo IV-type AP endonuclease and UVDE is very low, it cannot be excluded that the structural similarity between Endo IV and UVDE is a result of evolutionary convergence and that AP sites are an accidental minor substrate of UVDE. To understand the molecular mechanisms of the activity as well as the evolutionary origin of UVDE, identification of the sequences responsible for the activities as well as the determination of the crystal structure of UVDE is now an important priority.
ACKNOWLEDGEMENTS
We thank Dr S. McCready for reading the text and for valuable comments. We thank Mr Y. Inoue and Mr H. Sasaki for making antibodies. This work was supported by grants (08280101 and JSPS-RFTF 97L00501) to A.Y.
REFERENCES
*To whom correspondence should be addressed. Tel: +81 22 717 8465; Fax: +81 22 717 8470; Email: ayasui{at}idac.tohoku.ac.jp
This page is run by Oxford University Press, Great Clarendon Street, Oxford OX2 6DP, as part of the OUP Journals
Comments and feedback: jnl.info{at}oup.co.uk
Last modification:
Copyright© Oxford University Press, 1999.
This article has been cited by other articles:
![]() |
A. Besaratinia, S.-i. Kim, and G. P. Pfeifer Rapid repair of UVA-induced oxidized purines and persistence of UVB-induced dipyrimidine lesions determine the mutagenicity of sunlight in mouse cells FASEB J, July 1, 2008; 22(7): 2379 - 2392. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. Alseth, H. Korvald, F. Osman, E. Seeberg, and M. Bjoras A general role of the DNA glycosylase Nth1 in the abasic sites cleavage step of base excision repair in Schizosaccharomyces pombe Nucleic Acids Res., September 27, 2004; 32(17): 5119 - 5125. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Ribar, T. Izumi, and S. Mitra The major role of human AP-endonuclease homolog Apn2 in repair of abasic sites in Schizosaccharomyces pombe Nucleic Acids Res., January 2, 2004; 32(1): 115 - 126. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Okano, L. Lan, K. W. Caldecott, T. Mori, and A. Yasui Spatial and Temporal Cellular Responses to Single-Strand Breaks in Human Cells Mol. Cell. Biol., June 1, 2003; 23(11): 3974 - 3981. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. M. Earl, S. K. Rankin, K.-P. Kim, O. N. Lamendola, and J. R. Battista Genetic Evidence that the uvsE Gene Product of Deinococcus radiodurans R1 Is a UV Damage Endonuclease J. Bacteriol., February 15, 2002; 184(4): 1003 - 1009. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Meijer, F. Karimi-Busheri, T. Y. Huang, M. Weinfeld, and D. Young Pnk1, a DNA Kinase/Phosphatase Required for Normal Response to DNA Damage by gamma -Radiation or Camptothecin in Schizosaccharomyces pombe J. Biol. Chem., February 1, 2002; 277(6): 4050 - 4055. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. L. Alleva and P. W. Doetsch The nature of the 5'-terminus is a major determinant for DNA processing by Schizosaccharomyces pombe Rad2p, a FEN-1 family nuclease Nucleic Acids Res., August 1, 2000; 28(15): 2893 - 2901. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Memisoglu and L. Samson Contribution of Base Excision Repair, Nucleotide Excision Repair, and DNA Recombination to Alkylation Resistance of the Fission Yeast Schizosaccharomyces pombe J. Bacteriol., April 15, 2000; 182(8): 2104 - 2112. [Abstract] [Full Text] |
||||
![]() |
S. Yasuhira and A. Yasui Alternative Excision Repair Pathway of UV-damaged DNA in Schizosaccharomyces pombe Operates Both in Nucleus and in Mitochondria J. Biol. Chem., April 14, 2000; 275(16): 11824 - 11828. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Okano, S.-i. Kanno, S. Nakajima, and A. Yasui Cellular Responses and Repair of Single-strand Breaks Introduced by UV Damage Endonuclease in Mammalian Cells J. Biol. Chem., October 13, 2000; 275(42): 32635 - 32641. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||












