Skip Navigation

This Article
Right arrow Abstract Freely available
Right arrow Print PDF (252K) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (28)
Right arrowRequest Permissions
Right arrow Commercial Re-use Guidelines
for Open Access NAR Content
Google Scholar
Right arrow Articles by Takahashi, Y.
Right arrow Articles by Yamaguchi, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Takahashi, Y.
Right arrow Articles by Yamaguchi, M.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Nucleic Acids Research Pages 510-516  


Identification of three conserved regions in the DREF transcription factors from Drosophila melanogaster and Drosophila virilis
Introduction
Materials And Methods
   Southern blot hybridization analysis
   Isolation of D.virilis total RNA
   Isolation of genomic clones for D.virilis and D.melanogaster DREFs
   Determination of the nucleotide sequences of the D.virilis and D.melanogaster DREF genes
   Oligonucleotides
   Plasmid constructions
   Establishment of transgenic flies
   Scanning electron microscopy
   5-bromo-2[prime]-deoxyuridine (BrdU) labeling
Results
   Southern blot hybridization analysis and molecular cloning of D.virilis and D.melanogaster DREF genes
   Comparison of the amino acid sequence of D.virilis DREF with that of D.melanogaster DREF
   Expression of CR1 or CR3 of D.melanogaster DREF in the eye imaginal disc disrupts normal eye development
   Expression of CR1 and CR3 in the eye imaginal disc can inhibit cell cycle progression during eye development
Discussion
Acknowledgements
References


Identification of three conserved regions in the DREF transcription factors from Drosophila melanogaster and Drosophila virilis

Identification of three conserved regions in the DREF transcription factors from Drosophila melanogaster and Drosophila virilis

Yasuhiko Takahashi1,2,+, Fumiko Hirose1, Akio Matsukage1 and Masamitsu Yamaguchi1,*

1Laboratory of Cell Biology, Aichi Cancer Center Research Institute, Chikusa-ku, Nagoya, Aichi 464-8681, Japan and 2Laboratory of Molecular Bioengineering, Faculty of Engineering, Mie University, 1515 Kamihama-cho, Tsu, Mie 514, Japan

Received September 29, 1998; Revised and Accepted November 25, 1998

DDBJ/EMBL/GenBank accession nos AB010823, AB019510 and AB019511

ABSTRACT

The genes for a DNA replication-related element-binding factor (DREF) were isolated from Drosophila melanogaster and Drosophila virilis, and their nucleotide sequences were determined. Drosophila virilis DREF consists of 742 amino acid residues, which is 33 amino acids longer than D.melanogaster DREF. Comparison of the amino acid sequences revealed that D.virilis DREF is 71% identical to its D.melanogaster homolog. Three highly conserved regions were identified at amino acid positions 14-182 (CR1), 432-568 (CR2) and 636-730 (CR3) of the D.virilis DREF, with 86.4, 86.1 and 83.3% identities, respectively. Transgenic flies in which expression of three conserved regions of D.melanogaster DREF was targeted to the eye imaginal disc were established. Expression of CR1 in the developing eye imaginal discs resulted in a severe rough eye phenotype in adult flies. Expression of CR3 also caused a rough eye phenotype, while that of CR2 had no apparent effect on eye morphology. Expression of either CR1 or CR3 in eye imaginal disc cells inhibited cell cycle progression and reduced incorporation of 5-bromo-2[prime]-deoxyuridine into the S-phase zone (the second mitotic wave) behind the morphogenetic furrow. The results indicate that both CR1 and CR3 are important for DREF functions.

INTRODUCTION

It is well known that the Drosophila melanogaster proliferation-related genes such as those for DNA polymerase [alpha] 180 and 73 kDa subunits, PCNA, cyclin A and D-raf are under a common transcriptional regulatory mechanism (1-4). Promoter regions of these genes contain a DNA replication-related element (DRE), and the requirement of this DRE for promoter activity has been confirmed in both cultured cells (1-4) and transgenic flies (5). Moreover, a specific DRE-binding factor (DREF) has been identified as an 80 kDa protein (1) and its cDNA has been cloned (6). An important role of the DRE/DREF regulatory system has been indicated by the finding that DRE/DREF is a target of some differentiation signals. The zerknüllt (zen) gene encoding a homeodomain-containing protein which is expressed in the dorsal region of the early embryo at the cellular blastoderm stage is involved in differentiation of the amnioserosa and the optic lobe (7-9). Zen expression in cultured cells results in repression of DNA replication-related genes by reducing the DREF activity (10,11). Thus, the DRE/DREF system may occupy a cross-roads position in growth and differentiation signaling pathways. Furthermore, we have found multiple DRE sequences in the regulatory region of the gene for D.melanogaster E2F, an important transcriptional regulator of cell cycle-related genes. Extensive analyses in vitro and in vivo have revealed that the DRE/DREF system activates transcription of the E2F gene (12). It, in fact, appears to function as a master regulatory system for transcription of DNA replication-related genes.

In spite of its obvious importance, the DRE/DREF system has only been found in D.melanogaster, although the existence of a similar system was suggested by investigation of regulation of the Bombyx mori PCNA gene (13). Since functional domains of proteins are highly conserved among various organisms, it is important to identify and analyze conserved regions in order to gain more insight into their function. From D.melanogaster and Drosophila virilis, a number of genes and cDNAs for transcription factors have been cloned and their structures compared. In fact, functionally important domains such as a homeodomain (14,15) and a zinc-finger domain (16) have been found to be highly conserved among proteins from these two distantly related species (estimated divergence time 60 × 106 years) (17) of the Drosophila genus.

In the present study, we isolated the DREF genes from D.melanogaster and D.virilis. Comparison of deduced amino acid sequences of DREFs from both species allowed us to identify three highly conserved regions, CR1, CR2 and CR3. One of them, CR1, was noted to correspond to the domain required for DRE-binding and dimer formation (6). To examine function of conserved regions, they were expressed in the eye imaginal discs of living flies, and their effects on cell cycle progression and eye morphology were examined. The results indicate that both CR1 and CR3 play important roles in DREF functions.

MATERIALS AND METHODS

Southern blot hybridization analysis

DNAs were extracted from adult flies of D.melanogaster, Drosophila simulans, Drosophila mauritiana, Drosophila ananasse, Drosophila hydei and D.virilis, members of the Drosophila genus, as described previously (18). These DNAs were digested with restriction enzymes, separated by agarose gel electrophoresis, and blotted onto GeneScreen Plus membranes (New England Nuclear) using a VacuGene blotting apparatus (LKB). The membranes were hybridized with a 32P-labeled probe containing the D.melanogaster DREF cDNA under high stringency hybridization conditions.

Isolation of D.virilis total RNA

Total cellular RNA was isolated from D.virilis embryos byan acid-guanidinium thiocyanate-phenol-chloroform extraction method as described previously (19).

Isolation of genomic clones for D.virilis and D.melanogaster DREFs

In the Southern blot hybridization analysis of D.virilis genomic DNA digested with EcoRI and XhoI, a single 8 kb band was detected with the D.melanogaster DREF cDNA probe (data not shown). From the gel region containing ~8 kb DNA fragments of D.virilis genome digested with EcoRI and XhoI, DNA was eluted and cloned into the EcoRI and XhoI sites of the [lambda]Zap vector to make a D.virilis genomic DNA library. Six genomic clones were isolated by screening the library with the D.melanogaster DREF cDNA probe under high stringency hybridization conditions.

Genomic clones for D.melanogaster DREF were isolated by screening the [lambda]EMBLE3 library constructed from the D.melanogaster Oregon-R DNA with a D.melanogaster DREF cDNA probe under high stringency hybridization conditions (20).

Determination of the nucleotide sequences of the D.virilis and D.melanogaster DREF genes

Isolated genomic clones for D.virilis were subjected to in vivo excision and cloned into the pBluescript II vector. A series of unidirectional deletion derivatives were constructed using the Erase-a-Base system (Promega). The nucleotide sequence of each clone was determined with an ABI 373A autosequencer using T3 or T7 primers. Where necessary, oligonucleotides were chemically synthesized and employed as sequencing primers. To determine the cDNA sequence, chemically synthesized oligonucleotides with sequences derived from the gene were used as reverse transcriptase mediated polymerase chain reaction (RT-PCR) primers, and then nucleotide sequences of PCR products were determined.

DNA fragments from D.melanogaster genomic clones were cloned into the pBluescript II vector. The nucleotide sequence was determined with an ABI 373A autosequencer using the various primers described below.

Oligonucleotides

For nucleotide sequencing of genomic clones for D.melanogaster DREF, the following primers were synthesized: DCG1, CAAACGCAAAGTGGCCA; DCG2, GAGAAGCCCTTCTCTCT; DCG3, CGTGTGTTTGAGATCGA; DCG4, CACTTCAAAGATTCTTA; DCG5, GAACCAAGAGTAGTGGA; DCG6, CAAGCGATTCATGCTCA; DCG7, GGACACCTTGGAGGCAA; DCG8, GTCCAGAAAGTGATGGA; DCGa, TTGTGACACTTAATCCA; 242R, GAATTCACCAAAACCGGCATC; 126, CCGGTTATTAATGAACTCCA; 72, AACACCACCAATTTGCGT.

To obtain DNA fragments containing various regions of the D.melanogaster DREF cDNA, the following PCR primers were synthesized: CR1BAM, ACAGGATCCAAGATGAGCGAAGGGGTACCA; CR1XHO, GTTCTCGAGCTACTCCAGTTTGACCCGCCG; CR2BAM, AACCGGATCCATGCCCACGTACAACGAGCACTTC; CR2XHO, ACGGCTCGAGTTAGTTATACTTATGGGTCAGCAT; CR3BAM, CCGTGGATCCATGCTGAAACTGCTGTTTGACAGTAA; CR3XHO, ACGCTCGAGTTACAAAAAGAGGATGGCGTCGAT.

Plasmid constructions

To construct the plasmid pUAS-CR1 containing the CR1 domain (amino acids 1-125) of the D.melanogaster DREF, PCR was performed using the plasmid containing a full length D.melanogaster DREF cDNA as a template and primers CR1BAM and CR1XHO in combination. The PCR product was digested with BamHI and XhoI, and then placed between BglII and XhoI sites of the plasmid pUAST (21).

The plasmid pUAS-CR2 containing the CR2 domain (amino acids 428-564) of the D.melanogaster DREF was constructed in the same way except that CR2BAM and CR2XHO were used as primers. Similarly, the plasmid pUAS-CR3 containing the CR3 domain (amino acids 604-704) of the D.melanogaster DREF was constructed by using CR3BAM and CR3XHO as primers.

The GAL4-coding sequence was isolated using PCR with the primers ATCGAATTCGGTACCAGATGAAGCTACTGTCTTCTATCGA, ATAAGATCTGCGGCCGCTTACTCTTTTTTTGGGTTTGGTG and the pGaTB plasmid (21) as a template. Products were gel-purified, cut with EcoRI and BglII, and then cloned into EcoRI-BglII sites of the pGMR vector (22) to create pGMR-GAL4.

Establishment of transgenic flies

Fly stocks were maintained at 25°C on standard food. The Canton S fly was used as the wild-type strain. P element-mediated germ line transformation was carried out as described earlier (23). F1 transformants were selected on the basis of white eye color rescue (24). Four independent lines were established for the pGMR-GAL4 construct. Three of these lines exhibited a mild rough eye phenotype probably due to extremely high expression of GAL4 in the eye imaginal disc, and the other one (line number 16) showed an apparently normal eye morphology. Therefore, we used this line 16 carrying pGMR-GAL4 on the X chromosome in the following studies. Four, two and three independent lines were established for pUAS-CR1, pUAS-CR2 and pUAS-CR3, respectively.

Scanning electron microscopy

Adult flies were anesthetized, mounted on stages and observed under a Hitachi S-100 scanning electron microscope in the low vacuum mode.

5-bromo-2[prime]-deoxyuridine (BrdU) labeling

Detection of cells in S phase was performed by a BrdU-labeling method as described previously with minor modifications (25). Third instar larvae cultured at 25°C were dissected in Grace's insect medium, and then incubated in the presence of 20 µg/ml BrdU (Boehringer Mannheim) for 30 min. The samples were fixed in Carnoy's fixative (ethanol/acetic acid/chloroform, 6:3:1) for 15 min at 25°C, and further fixed in 80% ethanol/50 mM glycine buffer, pH 2.0 at -20°C for 2 h. Incorporated BrdU was visualized using an anti-BrdU antibody and an alkaline phosphatase detection kit (Boehringer). The time of color development with alkaline phosphatase was identical for all samples.

RESULTS

Southern blot hybridization analysis and molecular cloning of D.virilis and D.melanogaster DREF genes

A 0.7 kb cDNA fragment coding for the N-terminal domain of D.melanogaster DREF required for DNA-binding and dimer formation was used as a probe for Southern blot hybridization analysis of genomic DNAs from the various Drosophila species. Single bands were detected in all examined Drosophila species in the blots of DNA digested with EcoRI or XhoI (Fig. 1). The results indicate that the DREF gene exists as a single copy per haploid genome in Drosophila species. The strength of the signals roughly correlated with the known evolutional distances between D.melanogaster and the other species. The 0.7 kb DNA fragment was used as a probe to screen the D.virilis genomic library. Six positive clones were isolated. A restriction map of the genomic region determined by analysis of these clones is shown in the upper part of Figure 2.


Figure 1. Southern blot hybridization analysis of DNAs from various Drosophila species. Genomic DNAs from adult D.melanogaster, D.simulans, D.mauritiana, D.ananasse, D.hydei and D.virilis flies were digested with EcoRI and XhoI. The 0.7 kb fragment of D.melanogaster DREF cDNA was used as a probe.


Figure 2. Restriction maps for genomic clones and structures of genes for D.virilis and D.melanogaster DREFs. Restriction maps for the genomic clone [lambda]ZapDvDREF and [lambda]EMBLDmDREF are shown. Structures of the D.virilis (accession no. AB019511) and D.melanogaster (accession no. AB019510) DREF genes are indicated. The coding regions are indicated by closed boxes. The 5[prime] and 3[prime] untranslated regions are indicated by shaded boxes. Nucleotide position +1 denotes the translation initiation site for the DREF protein.

The complete nucleotide sequence of the region spanning 3 kb genomic DNA was determined. In comparison with the nucleotide sequence of the D.melanogaster DREF cDNA (accession no. AB010823), the coding sequence for D.virilis DREF appeared to be interrupted by three introns that could be spliced out at the consensus splice donor and acceptor junctions. To determine the exact splicing sites, RT-PCR was carried out, and cDNA sequences in and around the putative splicing junctions were determined. The determined exon-intron structure of the D.virilis DREF gene is illustrated in Figure 2. The sequences of all splicing junctions match the consensus sequence for eukaryotic splice donor and acceptor junctions.

A clone spanning the D.melanogaster DREF gene was isolated and a restriction map was determined (Fig. 2, lower part). The nucleotide sequence of the clone was also determined and compared with the previously determined nucleotide sequence of the D.melanogaster DREF cDNA. The coding sequence for D.melanogaster DREF was interrupted by three introns that could be spliced out at the consensus splice donor and acceptor junctions. It is of interest that the splicing sites are at the same nucleotide positions coding for the corresponding amino acid sequences in both D.melanogaster and D.virilis DREF genes, although the lengths of the introns differ significantly (Figs 2 and 3A).


Figure 3. (A) The amino acid sequence alignment of D.virilis and D.melanogaster DREFs. Identical amino acid residues are indicated by *. Three conserved regions, CR1, CR2 and CR3, are boxed. Arrowheads indicate exon-intron boundaries. (B) Schematic structures of DREFs. Three conserved regions are indicated by stippled boxes. The CR1, CR2 and CR3 showed 86.4, 86.1 and 83.3% identities, respectively. The N-terminal regions in each domain showed highest conservation with % identities shown in the brackets. Leucine, valine and isoleucine residues in a leucine-zipper like structure are emphasized.

Comparison of the amino acid sequence of D.virilis DREF with that of D.melanogaster DREF

The amino acid sequence of D.virilis DREF was deduced from its nucleotide sequence and compared with that of D.melanogaster DREF (Fig. 3A). Drosophila virilis DREF consists of 742 amino acid residues which is 33 amino acids longer than the D.melanogaster DREF. The total amino acid identity was determined to be 71% D.melanogaster DREF. The conservation, however, was not found to be uniform over the sequence and the protein could be divided into conserved and non-conserved regions (Fig. 3B). Non-conservative amino acid changes occur in clusters and a number of extra amino acids were observed in non-conserved regions of the DREF protein. CR1, spanning from positions 14 to 182 of the D.virilis DREF amino acid sequence shows 86.4% identity with that of D.melanogaster DREF (Fig. 3B). Similarly, CR2, spanning from positions 432 to 568, and CR3, spanning from positions 636 to 730 of the D.virilis DREF show 86.1 and 83.3% identities with those of D.melanogaster DREF, respectively (Fig. 3B). A leucine-zipper like structure was found from positions 453 to 497 of the D.virilis DREF, and critical amino acid residues for this structure were all conserved between the two species (Fig. 3A) (26). A database search did not uncover any other significant homology with reported conserved motifs. CR1 is rich in basic amino acids and has been noted to be a domain required for DNA-binding and dimer formation (6), while functions of other two conserved regions are unknown.

Expression of CR1 or CR3 of D.melanogaster DREF in the eye imaginal disc disrupts normal eye development

To gain more insight into functions of the three conserved regions, we utilized the GAL4-UAS targeted expression system (21) to provide ectopic expression of conserved regions of D.melanogaster DREF in the eye imaginal disc cells. Since the promoter carrying transcription factor Glass-binding sites (22) was used for the expression of GAL4, the transgene should be expressed in the region within and posterior to the morphogenetic furrow. Under the scanning electron microscope, the eyes of flies carrying a single copy of the GMR-GAL4 transgene appeared normal (Fig. 4A).


Figure 4. Scanning electron micrographs of adult compound eyes. (A) GMR-GAL4/Y; +, (B) GMR-GAL4/Y; UAS-CR1/CyO, (C) GMR-GAL4/Y; UAS-CR1/UAS-CR1, (D) GMR-GAL4/UAS-CR2; +, (E) GMR-GAL4/Y; UAS-CR3/CyO, (F) GMR-GAL4/Y; UAS-CR3/UAS-CR3. The rough eye phenotype is evident in (B, C, E and F). Scale bars for 200 µm (left panels) and 50 µm (right panels) are shown.

The flies carrying one copy of GMR-GAL4 and one copy of UAS-CR1 had abnormal eyes which were rough in appearance. The ommatidia lacked their regular hexagonal shape and either additional or missing bristles were apparent (Fig. 4B). When the copy number of UAS-CR1 was increased to two, the abnormality became more extensive, many ommatidia appearing to be fused (Fig. 4C). Four independent lines were established for pUAS-CR1 and no phenotypic difference was observed among these lines.

The flies carrying one copy of GMR-GAL4 and one copy of UAS-CR3 also exhibited a rough eye phenotype and increasing the copy number of UAS-CR3 resulted in more pronounced rough eyes (Fig. 4E and F). The abnormality was apparently dependent on production of CR3, since the eyes of flies carrying UAS-CR3 alone demonstrated no apparent abnormality (data not shown). The abnormality appeared more severe with expression of CR1 than CR3. In contrast to the results with flies carrying UAS-CR1 or UAS-CR3, the eyes of flies carrying one copy of GMR-GAL4 and one copy of UAS-CR2 were normal (Fig. 4D), although we could not examine the effect of two copies of UAS-CR2, since the transgenes were on the X-chromosome in the established transgenic lines.

Expression of CR1 and CR3 in the eye imaginal disc can inhibit cell cycle progression during eye development

In eye imaginal discs of third instar larvae, cells divide asynchronously anterior to the morphogenetic furrow. As they enter the furrow, they are synchronously arrested in G0/G1 phase, and differentiation is initiated. Cells that are recruited into five-cell preclusters do not divide again, but all remaining cells undergo DNA replication and divide once. This last round of division occurs relatively synchronously and appears as a clear stripe (second mitotic wave) on discs stained with BrdU. Thus, the Drosophila eye imaginal disc provides an ideal system to examine effects of ectopic expression of biologically important proteins on cell cycle progression. To determine the effect of expression of conserved domains of DREF on the pattern of DNA synthesis posterior to the furrow, third instar eye imaginal discs were labeled with BrdU and stained with an anti-BrdU antibody.

In eye discs of flies expressing GAL4 alone, BrdU incorporation was seen anterior to the morphogenetic furrow and in a stripe just posterior to the furrow (Fig. 5B), indistinguishable from the pattern in wild type fly discs (Fig. 5A). In discs of flies carrying one copy each of GMR-GAL4 and UAS-CR1, incorporation of BrdU in the S-phase zone corresponding to the second mitotic wave was reduced (Fig. 5C). Similar findings were obtained for discs of flies carrying one copy each of GMR-GAL4 and UAS-CR3 (Fig. 5E). However, labeled nuclei were still observed anterior to the morphogenetic furrow, a region where the transgene was not expressed. Expression of CR2 showed no significant effect on the BrdU incorporation (Fig. 5D).


Figure 5. Patterns of BrdU incorporation in eye imaginal discs. (A) Canton S, (B) GMR-GAL4/X or Y; +, (C) GMR-GAL4/X or Y; UAS-CR1/CyO, (D) GMR-GAL4/UAS-CR2; +, (E) GMR-GAL4/X or Y; UAS-CR3/CyO. The eye discs were stained with an anti-BrdU antibody. Arrows indicate the position of the S-phase zone behind the morphogenetic furrow. The anterior of the discs is on the left.

DISCUSSION

Regulation of cell proliferation is essential for accurate generation of body structures in multicellular organisms. Switching between the non-proliferation and proliferation states is closely associated with a coordinated shift in transcription of proliferation-related genes. DNA replication is clearly of prime importance for this process and there is much evidence that expression of the involved genes is finely regulated in accordance with progression of differentiation during development (27,28). In D.melanogaster, promoter regions of genes for the DNA polymerase [alpha] 180 kDa catalytic subunit (29), the 73 kDa regulatory subunit (2) and PCNA (20) contain DRE and multiple E2F-binding sites in common. Our previous studies performed in vitro and in vivo suggested that E2F-binding sites and DRE function synergistically to activate promoters of the PCNA and DNA polymerase [alpha] 180 kDa subunit genes (30). More recently, we have found the existence of multiple DRE sequences in the regulatory region of the D.melanogaster E2F gene and analyses in vitro and in vivo have revealed that the DRE/DREF system activates transcription of the E2F gene (12). Thus, the DRE/DREF system appears to function as a master regulatory system for transcription of DNA replication-related genes.

In the present study, we have isolated the genes for D.virilis and D.melanogaster DREFs and determined their nucleotide sequences. Comparison of the DREFs between two distantly related Drosophila species, D.melanogaster and D.virilis, revealed the presence of three highly conserved regions. In some known transcriptional regulators, different functions such as DNA-binding, hormone-binding and activation of transcription have been localized to distinct regions of the protein (31). The high conservation may similarly indicate the localization of crucial functions. In fact, functionally important regions of several transcription factors that play important roles during development are highly conserved between D.melanogaster and D.virilis (15,16,32). One of the conserved regions of DREF, CR1, was recognized to be a domain required for DNA-binding and homodimer formation (6). The leucine-zipper like structure found in CR2 suggests that this domain also plays a role in stabilizing the homodimer structure.

In order to examine functions in vivo, we overexpressed each of these domains in the eye imaginal disc of living flies. Expression of CR1 prevented the G0/G1-arrested cells posterior to the morphogenetic furrow from entering S phase and resulted in a severe rough eye phenotype in adult flies. Since CR1 corresponds to the DNA-binding and dimer formation domain, this influence on cell cycle progression and eye morphology is likely to be caused by its dominant negative effect against endogenous DREF, suggesting an important role for DREF in cell cycle progression. Similar dominant negative effects were further observed when CR1 was overexpressed in salivary gland cells (to be published elsewhere). Expression of CR3 also inhibited cell cycle progression and caused a rough eye phenotype. Since CR3 shows no apparent DNA-binding and dimer formation activity (data not shown), this domain may play a role in interacting with other elements like so-called coactivator proteins. Titrating out of coactivator proteins by overexpression of CR3 may inhibit transcription activity of the endogenous DREF. Further analysis is necessary to address this point.

In addition, it should be noted that the transgenic lines expressing CR1 and CR3 in the eye imaginal discs exhibit a rough eye phenotype but normal viability and fertility. They, therefore, can be used as a genetic screen to identify mutations that enhance or suppress the rough eye phenotype. The transgenic flies established in the present study thus provide useful tools for identification of factors interacting with DREF in Drosophila.

ACKNOWLEDGEMENTS

We are grateful to Drs S. Hayashi and Y. Nishida for fly stocks, G. Rubin for pGMR, N. Perrimon for pUAST and pGaTB, and M. Moore for critical reading of the manuscript. This work was supported in part by grants-in-aid from the Ministry of Education, Science, Sports and Culture of Japan.

REFERENCES

1. Hirose,F., Yamaguchi,M., Handa,H., Inomata,Y. and Matsukage,A. (1993) J. Biol. Chem., 268, 2092-2099. MEDLINE Abstract

2. Takahashi,Y., Yamaguchi,M., Hirose,F., Cotterill,S., Kobayashi,J., Miyajima,S. and Matsukage,A. (1996) J. Biol. Chem., 271, 14541-14547. MEDLINE Abstract

3. Ohno,K., Hirose,F., Sakaguchi,K., Nishida,Y. and Matsukage,A. (1996) Nucleic Acids Res., 24, 3942-3946. MEDLINE Abstract

4. Ryu,J.-R., Choi,T.-Y., Kwon,E.-J., Lee,W.-H., Nishida,Y., Hayashi,Y., Matsukage,A., Yamaguchi,M. and Yoo,M.-A. (1997) Nucleic Acids Res., 25, 794-799. MEDLINE Abstract

5. Yamaguchi,M., Hayashi,Y. and Matsukage,A. (1995) J. Biol. Chem., 270, 15808-15814. MEDLINE Abstract

6. Hirose,F., Yamaguchi,M., Kuroda,K., Omori,A., Hachiya,T., Ikeda,M., Nishimoto,Y. and Matsukage,A. (1996) J. Biol. Chem., 271, 3930-3937. MEDLINE Abstract

7. Foe,V.E. (1989) Development, 107, 1-22. MEDLINE Abstract

8. Wakimoto,B.T., Turner,F.R. and Kaufman,T.C. (1984) Dev. Biol., 102, 147-172. MEDLINE Abstract

9. Doyle,H.J., Kraut,R. and Levine,M. (1989) Genes Dev., 3, 1518-1533. MEDLINE Abstract

10. Yamaguchi,M., Hirose,F., Nishida,Y. and Matsukage,A. (1991) Mol. Cell. Biol., 11, 4909-4917. MEDLINE Abstract

11. Hirose,F., Yamaguchi,M. and Matsukage,A. (1994) J. Biol. Chem., 269, 2937-2942. MEDLINE Abstract

12. Sawado,T., Hirose,F., Takahashi,Y., Sasaki,T., Shinomiya,T., Sakaguchi,K., Matsukage,A. and Yamaguchi,M. (1998) J. Biol. Chem., 273, 26042-26051. MEDLINE Abstract

13. Takahashi,Y., Yamaguchi,M., Hirose,F., Kobayashi,J., Miyajima,S. and Matsukage,A. (1997) J. Biochem., 122, 1215-1223. MEDLINE Abstract

14. Michael,W.M., Bowtell,D.D. and Rubin,G.M. (1990) Proc. Natl Acad. Sci. USA, 87, 5351-5353. MEDLINE Abstract

15. Herberlein,U. and Rubin,G.M. (1990) Proc. Natl Acad. Sci. USA, 87, 5916-5920.

16. Treier,M., Pfeifle,C. and Tautz,D. (1989) EMBO J., 8, 11517-11525.

17. Beverley,P.A. and Wilson,A.C. (1984) J. Mol. Evol., 21, 1-13. MEDLINE Abstract

18. McGinnis,W., Shermoen,A.W. and Beckendorf,S.K. (1983) Cell, 34, 75-84. MEDLINE Abstract

19. Chomczynski,P. and Sacchi,N. (1987) Anal. Biochem., 162, 156-159. MEDLINE Abstract

20. Yamaguchi,M., Nishida,Y., Moriuchi,T., Hirose,F., Hui,C.-C., Suzuki,Y. and Matsukage,A. (1990) Mol. Cell. Biol., 10, 872-879. MEDLINE Abstract

21. Brand,A.H. and Perrimon,N. (1993) Development, 118, 401-415. MEDLINE Abstract

22. Hay,B.A., Wolff,T. and Rubin,G. M. (1994) Development, 120, 2121-2129. MEDLINE Abstract

23. Spradling,A.C. (1986) In Roberts,D.B. (ed.), Drosophila: A Practical Approach. IRL Press, Oxford, UK, pp. 175-197.

24. Robertson,H.M., Preston C.R., Philips,R.W., Johnson-Schlitz,D.M., Benz,W.K. and Engels,W.R. (1988) Genetics, 118, 461-470. MEDLINE Abstract

25. Wilder,E.L. and Perrimon,N. (1995) Development, 121, 477-488. MEDLINE Abstract

26. O'Shea,E., Rutkowski,R. and Kim,P. (1992) Cell, 68, 699-708. MEDLINE Abstract

27. Matsukage,A., Kitani,H., Yamaguchi,M., Kusakabe,M., Morita,T. and Koshida,Y. (1986) Dev. Biol., 117, 226-232. MEDLINE Abstract

28. Matsukage,A., Hirose,F. and Yamaguchi,M. (1994) Jpn J. Cancer Res., 85, 1-8.

29. Hirose,F., Yamaguchi,M., Nishida,Y., Masutani,M., Miyazawa,H., Hanaoka,F. and Matsukage,A. (1991) Nucleic Acids Res., 19, 4991-4998. MEDLINE Abstract

30. Yamaguchi,M., Hirose,F. and Matsukage,A. (1996) Genes Cells, 1, 47-58. MEDLINE Abstract

31. Brent,R. and Ptashne,M. (1985) Cell, 43, 729-736. MEDLINE Abstract

32. Kassis,J.A., Poole,S.J., Wright,D.K. and O'Farrell,P. H. (1986) EMBO J., 5, 3583-3589. MEDLINE Abstract


*To whom correspondence should be addressed. Tel: +81 52 762 6111; Fax: +81 52 763 5233; Email: myamaguc@aichi-cc.pref.aichi.jp
+Present address: Department of Basic Gerontology, National Institute for Longevity Science, Ohbu, Aichi 474-8522, Japan


This page is run by Oxford University Press, Great Clarendon Street, Oxford OX2 6DP, as part of the OUP Journals
Comments and feedback: www-admin{at}oup.co.uk
Last modification: 23 Dec 1998
Copyright©Oxford University Press, 1998.

Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
Nucleic Acids ResHome page
H. Ida, N. Suzusho, O. Suyari, H. Yoshida, K. Ohno, F. Hirose, M. Itoh, and M. Yamaguchi
Genetic screening for modifiers of the DREF pathway in Drosophila melanogaster: identification and characterization of HP6 as a novel target of DREF
Nucleic Acids Res., April 1, 2009; 37(5): 1423 - 1437.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
K. Nakamura, H. Ida, and M. Yamaguchi
Transcriptional regulation of the Drosophila moira and osa genes by the DREF pathway
Nucleic Acids Res., July 1, 2008; 36(12): 3905 - 3915.
[Abstract] [Full Text] [PDF]


Home page
GENES CELLSHome page
Y. Kato, M. Kato, M. Tachibana, Y. Shinkai, and M. Yamaguchi
Characterization of Drosophila G9a in vivo and identification of genetic interactants.
Genes Cells, July 1, 2008; 13(7): 703 - 722.
[Abstract] [Full Text] [PDF]


Home page
GENES CELLSHome page
Y. S. Kim, M. J. Shin, D. J. Yang, M. Yamaguchi, S. Y. Park, and M. A. Yoo
Transcriptional regulation of the Drosophila ANT gene by the DRE/DREF system
Genes Cells, May 1, 2007; 12(5): 569 - 579.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
D. Yamashita, H. Komori, Y. Higuchi, T. Yamaguchi, T. Osumi, and F. Hirose
Human DNA Replication-related Element Binding Factor (hDREF) Self-association via hATC Domain Is Necessary for Its Nuclear Accumulation and DNA Binding
J. Biol. Chem., March 9, 2007; 282(10): 7563 - 7575.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
K.-i. Takata, H. Yoshida, M. Yamaguchi, and K. Sakaguchi
Drosophila Damaged DNA-Binding Protein 1 Is an Essential Factor for Development
Genetics, October 1, 2004; 168(2): 855 - 865.
[Abstract] [Full Text] [PDF]


Home page
GENES CELLSHome page
H. Yoshida, E. Kwon, F. Hirose, K. Otsuki, M. Yamada, and M. Yamaguchi
DREF is required for EGFR signalling during Drosophila wing vein development
Genes Cells, October 1, 2004; 9(10): 935 - 944.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
S. Y. Park, Y.-S. Kim, D.-J. Yang, and M.-A. Yoo
Transcriptional regulation of the Drosophila catalase gene by the DRE/DREF system
Nucleic Acids Res., February 24, 2004; 32(4): 1318 - 1324.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
N. Ohshima, M. Takahashi, and F. Hirose
Identification of a Human Homologue of the DREF Transcription Factor with a Potential Role in Regulation of the Histone H1 Gene
J. Biol. Chem., June 13, 2003; 278(25): 22928 - 22938.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
F. Hirose, N. Ohshima, E.-J. Kwon, H. Yoshida, and M. Yamaguchi
Drosophila Mi-2 Negatively Regulates dDREF by Inhibiting Its DNA-Binding Activity
Mol. Cell. Biol., July 15, 2002; 22(14): 5182 - 5193.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
F. Hirose, N. Ohshima, M. Shiraki, Y. H. Inoue, O. Taguchi, Y. Nishi, A. Matsukage, and M. Yamaguchi
Ectopic Expression of DREF Induces DNA Synthesis, Apoptosis, and Unusual Morphogenesis in the Drosophila Eye Imaginal Disc: Possible Interaction with Polycomb and trithorax Group Proteins
Mol. Cell. Biol., November 1, 2001; 21(21): 7231 - 7242.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
J. C. Badciong, J. M. Otto, and G. L. Waring
The Functions of the Multiproduct and Rapidly Evolving dec-1 Eggshell Gene Are Conserved Between Evolutionarily Distant Species of Drosophila
Genetics, November 1, 2001; 159(3): 1089 - 1102.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
Y. Hayashi, M. Yamagishi, Y. Nishimoto, O. Taguchi, A. Matsukage, and M. Yamaguchi
A Binding Site for the Transcription Factor Grainyhead/Nuclear Transcription Factor-1 Contributes to Regulation of the Drosophila Proliferating Cell Nuclear Antigen Gene Promoter
J. Biol. Chem., December 3, 1999; 274(49): 35080 - 35088.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
F. Hirose, M. Yamaguchi, and A. Matsukage
Targeted Expression of the DNA Binding Domain of DRE-Binding Factor, a Drosophila Transcription Factor, Attenuates DNA Replication of the Salivary Gland and Eye Imaginal Disc
Mol. Cell. Biol., September 1, 1999; 19(9): 6020 - 6028.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Print PDF (252K) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (28)
Right arrowRequest Permissions
Right arrow Commercial Re-use Guidelines
for Open Access NAR Content
Google Scholar
Right arrow Articles by Takahashi, Y.
Right arrow Articles by Yamaguchi, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Takahashi, Y.
Right arrow Articles by Yamaguchi, M.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?