Skip Navigation

This Article
Right arrow Abstract Freely available
Right arrow Print PDF (586K) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (21)
Right arrowRequest Permissions
Right arrow Commercial Re-use Guidelines
for Open Access NAR Content
Google Scholar
Right arrow Articles by Komori, K.
Right arrow Articles by Ishino, Y.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Komori, K.
Right arrow Articles by Ishino, Y.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

PI-PfuI and PI-PfuII, intein-coded homing endonucleases from Pyrococcus furiosus. II. Characterization of the binding and cleavage abilities by site-directed mutagenesis
Nucleic Acids Research Pages 4175-4182 ©1999 Oxford University Press


PI-PfuI and PI-PfuII, intein-coded homing endonucleases from Pyrococcus furiosus. II. Characterization of the binding and cleavage abilities by site-directed mutagenesis
Introduction
Materials And Methods
   Materials
   Construction of MBP-(PI-PfuI) and MBP-(PI-PfuII) fusion proteins
   Site-specific mutagenesis
   Purification of mutant PI-PfuI and PI-PfuII proteins
   Gel retardation assay
   Endonuclease assay
   Circular permutation assay
Results
   Binding of PI-PfuI and PI-PfuII to their substrates
   Bending of PI-PfuI and PI-PfuII to DNA
   Substitutions of putative catalytic amino acids within PI-PfuI and PI-PfuII
   Substrate binding abilities of the PI-PfuI and PI-PfuII mutant proteins
   Cleavage abilities of the PI-PfuI and PI-PfuII mutant proteins
Discussion
Acknowledgements
References


PI-PfuI and PI-PfuII, intein-coded homing endonucleases from Pyrococcus furiosus. II. Characterization of the binding and cleavage abilities by site-directed mutagenesis

Kayoko Komori1, Kenji Ichiyanagi1, 2, Kosuke Morikawa2, Yoshizumi Ishino1, *

1Department of Molecular Biology and 2Department of Structural Biology, Biomolecular Engineering Research Institute (BERI), 6-2-3, Furuedai, Suita, Osaka 565-0874, Japan

Received July 26, 1999; Revised and Accepted September 15, 1999

ABSTRACT

PI-PfuI and PI-PfuII from Pyrococcus furiosus are homing endonucleases, as shown in the accompanying paper. These two endonucleases are produced by protein splicing from the precursor protein including ribonucleotide reductase (RNR). We show here that both enzymes specifically interact with their substrate DNA and distort the DNA strands by 73° and 67°, respectively. They have two copies of the amino acid sequence motif LAGLIDADG, which is present in the majority of homing endonucleases and provides some of the catalytic residues necessary for DNA cleavage activity. Site-specific mutagenesis studies showed that two acidic residues in the motifs, Asp149 and Glu250 in PI-PfuI, and Asp156 and Asp249 in PI-PfuII, were critical for catalysis. The third residues of the active site triads, as predicted from the structure of PI-SceI, were Asn225 in PI-PfuI and Lys224 in PI-PfuII. Substitution of Asn225 in PI-PfuI by Ala did not affect catalysis. The cleavage activity of PI-PfuII was 50-fold decreased by the substitution of Ala for Lys224. The binding affinity of the mutant protein for the substrate DNA also decreased 6-fold. The Lys in PI-PfuII may play a direct or indirect role in catalysis of the endonuclease activity.

INTRODUCTION

Homing endonucleases are now known to recognize specific DNA sequences and to cleave double-stranded DNA within the recognition sequences (1,2). In addition to the biological interest of their roles in living cells, the ability to recognize a specific DNA sequence of 12-40 bases gives the homing endonucleases the potential to be useful reagents as rare cutting enzymes for genetic engineering. These enzymes are mostly encoded by introns or are derived from precursor proteins by protein splicing. The amino acid sequences of these proteins are highly diverged, but have some common motifs, and they are classified into four families characterized by the LAGLIDADG, GIY-YIG, H-N-H and His-Cys box motifs (3). With their ability to recognize specific DNA sequences, and to self-splice, especially in the case of intein-coded proteins, the biochemistry and the structure-function relationships of the enzymes in this category have attracted many molecular biologists (see the database InBase at http://www.neb.com/neb/inteins.html ). Indeed, the 3-dimensional structures of three enzymes, PI-SceI (4), I-CreI (5) and I-DmoI (6), have been determined by X-ray crystallography. These enzymes belong to the LAGLIDADG motif family, and PI-SceI (intein-encoded) and I-DmoI (intron-encoded) have two copies of the motif, respectively, whereas I-CreI (intron-encoded) has one copy and works as a dimer. Moreover, the crystal structures of the enzyme-DNA substrate complexes have been solved for I-CreI (7) and also for I-PpoI, an intron-encoded endonuclease in the His-Cys box family (8).

We cloned two intein genes, which are embedded in the gene encoding ribonucleotide reductase (RNR) in the hyperthermophilic archaeon Pyrococcus furiosus originally reported by Riera et al. (9), and overexpressed them in Escherichia coli as described in the accompanying paper (10). These two recombinant proteins exhibited endonuclease activities and cleaved double-stranded DNA at their homing (intein-less) sites, and, therefore, they were designated PI-PfuI and PI-PfuII, respectively, as the first and second intein-coded homing endonucleases isolated and characterized from P.furiosus. Like other intein-coded endonucleases, PI-PfuI and PI-PfuII recognize extremely long sequences (30 bp) and digest DNA to yield 5[prime]-phosphate and 3[prime]-hydroxyl ends.

To determine the basic biochemical properties of PI-PfuI and PI-PfuII as homing endonucleases, we analyzed the binding modes of PI-PfuI and PI-PfuII to double-stranded DNA having their own recognition sequences by a gel retardation assay including a circular permutation analysis. Furthermore, we made several mutants with one amino acid substitution in the predicted triad of the catalytic center by site-directed mutagenesis, and analyzed their properties in terms of substrate binding and cleavage.

MATERIALS AND METHODS

Materials

The plasmid pBEND2[prime], in which the cloning site and flanking region of pBEND2 (11) is inserted into the multicopy plasmid pTZ18R (US Biochemicals), was a gift from Dr M. Shimizu in our institute. Restriction endonucleases, modification enzymes, PCR-related products and oligonucleotides were purchased from Takara Shuzo (Kyoto, Japan). [[gamma]-32P]ATP was obtained from NEN Life Science Products (Boston, MA).

Construction of MBP-(PI-PfuI) and MBP-(PI-PfuII) fusion proteins

The quaternary structures of PI-PfuI and PI-PfuII bound to DNA substrates, using maltose binding protein (MBP) fusion proteins, were investigated as described (12). The genes for PI-PfuI and PI-PfuII were cloned into pMAL2c (New England Biolabs, Beverly, MA) and the MBP fusion proteins produced in E.coli were purified using an amylose column according to the manufacturer's instructions (New England Biolabs). The linker region between the MBP and PI-PfuI or PI-PfuII contains the site for a specific protease, factor Xa. Partial digestions of the fusion proteins with factor Xa (New England Biolabs) were performed at 23°C in 20 mM Tris-HCl, pH 8.0, 2 mM CaCl2 and 100 mM NaCl. Binding of these fusion proteins to the substrate DNA was analyzed by the gel retardation assay described in the accompanying paper (10).

Site-specific mutagenesis

PCR-mediated mutagenesis was performed using the Quick ChangeTM Site-Directed Mutagenesis kit (Stratagene, La Jolla, CA). An EcoRI-BamHI fragment (1250 bp) of pFINT1 (10) and an NdeI-BamHI fragment (900 bp) of pFINT2 (10), which include the target regions for mutagenesis, were transferred to pUC18 to reduce the size of PCR template plasmids, and the reactions were performed according to the manufacturer's instructions with some modifications. Mutagenized plasmids were selected by nucleotide sequencing, and the EcoRI-BamHI fragment (for PI-PfuI) or the NdeI-BamHI fragment (for PI-PfuII) was returned to its original site within pFINT1 or pFINT2, respectively. The nucleotide sequences of the regions used for the in vitro mutagenesis were confirmed using a DNA sequencer (ABI Prism 310 Genetic Analyzer; PE Applied Biosystems, Foster City, CA). The primers used for each mutagenesis and the resultant plasmids are shown in Table 1.

Table 1. Primers used for mutagenesis and resultant plasmids corresponding to each mutant
Primer Substitution Plasmid
GGGTTCATAGCAGGTGCCGGATGCTTTGATAAATAC D149A pFINTl1
GGCCTCTTTGATGCAGCGGGTCATGTGAGTAATAAAC E250A pFINT12
GGCCTCTTTGATGCAGACGGTCATGTGAGTAATAAAC E250D pFINT13
CTTAGAGGGGATAGATGCCGGAATACCACCCC N255A pFINT14
GGATGGTTCATCGGTGCCGGCTATCTCAACGTG D156A pFINT21
GGCCTCTTTAGTGCGGCTGGATACGTTGACAAG D249A pFINT22
GGCCTCTTTAGTGCGGAGGGATACGTTGACAAG D249E pFINT23
GTGAAAAACAACGAGGCGAGGATTCCAGAGATAG K224A pFINT24
Primers for coding strands are shown here. Primers having the complementary sequences were also used for PCR-mediated mutagenesis.

Purification of mutant PI-PfuI and PI-PfuII proteins

Escherichia coli BL21(DE3) carrying pFINT11-14 or pFINT21-24 was grown at 37°C with shaking in 400 ml of L broth containing 40 mg of ampicillin under the same conditions as the strain carrying the wild-type genes (pFINT1 or pFINT2). The cultivation conditions of the strains and the purification procedure for the mutant proteins were exactly the same as those described in the accompanying paper (10).

Gel retardation assay

The gel retardation assay for calculating the binding affinities of the wild-type and mutant PI-PfuI and PI-PfuII proteins was carried out using home 1 and home 2 (40 bp duplex DNAs with their homing site sequences) basically as described in the accompanying paper (10). The amounts of enzyme-substrate complex were quantified from the autoradiograms of each gel retardation experiment using a laser-excited image analyzer (BAS5000; Fuji Film, Tokyo, Japan). Apparent dissociation constants (Kd) were determined by fitting these experimental data to the equation 1/r = 1 + Kd/[A]total (f = 1 - r, where f is the degree of dissociation) with the use of the program CA-Cricket Graph IIITM (Computer Associates International, Islandia, NY), where r is the degree of binding (association) of the enzyme to the DNA substrate and [A]total is the enzyme concentration in the reaction mixture.

Endonuclease assay

The p140 and p240 plasmids were linearized by ScaI digestion, and were used for the endonuclease assay. The substrate DNA (100 ng) was incubated with various concentrations of PI-PfuI or PI-PfuII in 100 µl of the reaction buffer, with 200 mM KCl (for PI-PfuI) or without KCl (for PI-PfuII), at 80°C for 1 h. The reactions were stopped by phenol/chloroform treatment and were analyzed by agarose gel electrophoresis with ethidium bromide staining.

Circular permutation assay

The 40 bp duplex DNAs containing the recognition sequences of PI-PfuI or PI-PfuII (home1 and home 2, respectively) were inserted into the blunted XbaI site of pBEND2[prime], and various DNA fragments were cleaved out from the resultant plasmids, pBEND-140 and pBEND-240, with restriction endonucleases. A gel retardation assay was done using 5 ng of each DNA fragment (20 nM) and 20 ng of PI-PfuI (40 nM) or 50 ng of PI-PfuII (115 nM). The electrophoresis images were visualized by scanning the ethidium bromide stained gels in a laser-excited fluorescent image analyzer (FMBIO MultiView; Takara Shuzo). Analysis of the experimental data was carried out basically as described earlier (13,14). To calculate the center of bending, the relative mobility of each protein-DNA complex was plotted as a function of the distance from the cleavage site to the ends of the bending probe. Curves were plotted using a second order polynomial curve fitting program (CA-Cricket Graph). The bending angle was calculated using the equation µME = cos ([alpha]/2) reported by Thompson and Landy (15), where µM and µE are the mobilities of the protein-DNA complexes with the protein located at either the middle or the end of the DNA, respectively.

RESULTS

Binding of PI-PfuI and PI-PfuII to their substrates

Gel retardation assays using 32P-labeled oligoduplexes, home 1 and home 2, were done, because home 1[prime] and home 2[prime] (probably with the minimal 30 bp recognition size, as described in 10) had <10% of the affinity for PI-PfuI and PI-PfuII (data not shown). As shown in Figure 1A, the discretely retarded complexes increased as the protein concentration increased in the gel retardation assay. The binding was highly selective and the DNAs in the protein-DNA complexes were not displaced by unrelated DNA (data not shown). From these experiments, the apparent dissociation constants (Kd) with the corresponding substrates were calculated to be 11 nM for PI-PfuI and 13 nM for PI-PfuII, respectively (Fig. 1B). These Kd values of PI-PfuI and PI-PfuII with the 40mer duplex DNAs are comparable to that of PI-SceI with a 67mer duplex, as reported earlier (16). PI-PfuI and PI-PfuII seem to have similar affinity for their own recognition sequences. However, PI-PfuI could bind tightly to its substrate without Mg2+, as reported for PI-SceI (13,14), whereas the binding of PI-PfuII was clearly dependent on Mg2+, as shown in Figure 2. The PI-PfuII-DNA complex band was observed when TAM buffer (40 mM Tris-acetate, 0.5 mM Mg acetate) was used as the electrophoresis buffer, even though Mg2+ was not included in the binding reaction buffer. However, the complex band decreased with increasing concentrations of EDTA in the reaction buffer (data not shown). This result shows that the binding modes of PI-PfuI and PI-PfuII are very different.


Figure 1. Substrate binding of PI-PfuI and PI-PfuII. The binding abilities of PI-PfuI and PI-PfuII to their substrate DNAs were measured by a gel retardation assay using 32P-labeled oligonucleotides with 40 bp of the recognition sequences. The DNAs were incubated with various amounts of PI-PfuI or PI-PfuII in the standard binding reaction mixture, and the complexes were analyzed by 6% PAGE followed by autoradiography (A). (B) Apparent Kd values were calculated by fitting the experimental data to the equation described in Materials and Methods. r, the degree of binding; [A], enzyme concentration in the reaction mixture.


Figure 2. Effect of Mg2+ on the binding ability of PI-PfuI to its DNA substrate. The binding reactions included increasing amounts of EDTA, and the gel electrophoresis was done with TAE for the running buffer. Lane 1, 32P-labeled DNA; lane 2, 32P-labeled DNA and PI-PfuI or PI-PfuII; lanes 3-6, addition of EDTA to 0.1, 1, 10 and 20 mM, respectively.

The elution profiles on gel filtration chromatography showed that both PI-PfuI and PI-PfuII exist as monomers in solution (data not shown). To determine the quaternary structures of these homing endonucleases bound to their substrates, we constructed a system to produce these proteins as N-terminal fusions with MBP. The purified fusion proteins could be digested by factor Xa at the Ile-Glu-Gly-Arg site between MBP and PI-PfuI or PI-PfuII. The fusion proteins were subjected to increasing digestion with factor Xa after binding to the substrate DNA, as shown earlier (12). The principle of the method is that binding to a DNA substrate of the partially digested proteins as an n-fold oligomer should lead to the formation of n + 1 different complexes. The gel retardation patterns of PI-PfuI showed two kinds of DNA-protein complexes, which corresponded to the sizes of DNA-MBP-PI-PfuI and DNA-PI-PfuI, respectively (Fig. 3). These results indicate that PI-PfuI binds to its DNA substrates as a monomer. In the case of PI-PfuII, the fusion protein, MBP-PI-PfuII, did not stably bind to DNA under the same conditions (data not shown). Further analyses will be necessary to determine the binding structure of PI-PfuII.


Figure 3. PI-PfuI binds to its recognition sequence as a monomer. MBP-PI-PfuI fusion protein was subjected to increasing extents of digestion by Facor Xa to generate random cleavage of MBP-PI-PfuI. The digested protein was then used for the gel retardation assay using the 32P-labeled 40 bp recognition sequence. Two kinds of DNA-protein complexes were detected by autoradiography.

Bending of PI-PfuI and PI-PfuII to DNA

Sequence-specific DNA binding proteins often bend DNA at sites of complex formation (17,18). Restriction endonucleases stabilize substrate distortions upon binding (19,20). The homing endonucleases I-TevI (21), I-TevII (22), I-PpoI (23) and PI-SceI (13,14) have also been reported to induce a distortion of their substrate DNA. To detect the conformational differences within the target sequences of PI-PfuI and PI-PfuII in their complexes, we constructed a set of circularly permutated fragments of identical length for PI-PfuI and PI-PfuII, respectively, in which their recognition sites are located at different positions relative to the ends (Fig. 4A). Then, the relative electrophoretic mobilities of the protein-DNA complexes produced by these DNA fragments were compared. As shown in Figure 4B and C, the DNA fragments with the recognition sites near the center migrated significantly slower in the gel than the DNA fragments containing the target site near one end or the other, as reported for other homing endonucleases. From this experiment, the apparent bending angles of the DNA substrates were 73° and 67° for PI-PfuI and PI-PfuII, respectively. These values are comparable to those of PI-SceI (60-75°) and are a little higher than those of I-TevI (38°), I-TevII (50-55°) and I-PpoI (38°) reported earlier.


Figure 4. Circular permutation analysis of PI-PfuI and PI-PfuII. The circular permutation fragments used for this analysis are shown in (A). Various fragments (169 bp), including a 40 bp fragment that contains the PI-PfuI or PI-PfuII recognition sequence (shadowed boxes), were cleaved out from the plasmids derived from pBEND2[prime] with the indicated restriction enzymes. Gel retardation assays using the fragments were performed and the electrophoresis images were visualized by a laser-excited fluorescence image analyzer (B). The names of the restriction enzymes shown in each lane correspond to the fragments generated by cleavage. The DNA bending in each complex is plotted as a function of the number of base pairs from the middle of the cleavage site to the left-hand end of the fragment. The data were curve fitted to a polynomial function (C). Open squares, wild-type; closed squares, 1D149A and 2D156A; open circles, 1E250A and 2D249A; closed circles, 1E250A and 2D249E; open triangles, 1N225A.

Substitutions of putative catalytic amino acids within PI-PfuI and PI-PfuII

From the structural analyses of homodimeric restriction endonucleases, including EcoRI, EcoRV, PvuII and BamHI, three charged residues make a triad for the active site (reviewed in 24). The X-ray crystallographic study of PI-SceI showed that the spatial arrangement of Asp218, Asp326 and Lys301 resembles the active site triad of the restriction endonucleases (4), and these residues have been proved to be important by site-directed mutagenesis (16,25). These three residues are located in three (Blocks C, D and E) of eight conserved intein motifs (26,27). An amino acid sequence alignment of PI-PfuI and PI-PfuII with other homing endonucleases in the LAGLIDADG family revealed the residues of the two endonucleases that are candidates for making the triad of the catalytic center (Fig. 5). According to the alignment, Asp149, Glu250 and Asn225 of PI-PfuI, and Asp156, Asp249 and Lys224 of PI-PfuII were predicted to be the corresponding residues, and, therefore, we made four different substituted proteins for PI-PfuI, (1D149A, 1E250A, 1E250D and 1N225A) and for PI-PfuII (2D156A, 2D249A, 2D249E and 2K224A) by site-specific mutagenesis. All of the mutant genes were inserted into pET23d and were expressed in E.coli BL21(DE3) cells like the wild-type proteins. All of the mutant proteins exhibited the same purification behavior as the wild-type proteins, which suggested that the mutant proteins maintain the original conformations of PI-PfuI and PI-PfuII. Similar amounts of homogeneous proteins were obtained from each recombinant E.coli strain by exactly the same procedure as used for the wild-type proteins (data not shown).


Figure 5. An amino acid sequence alignment of the conserved regions (Blocks C, D and E) from PI-SceI, PI-PfuI and PI-PfuII. The consensus represents the conserved residues or amino acid groups from the multiple sequence alignment (27). Capital letters, conserved amino acids in standard single letter code; h, hydrophobic residue (G, A, V, L, I or M); a, acidic residue (D or E). Based on the sequence alignment, single amino acid substituted mutants were prepared by site-directed mutagenesis as indicated.

Substrate binding abilities of the PI-PfuI and PI-PfuII mutant proteins

All of the purified mutant proteins were subjected to the gel retardation assay using 32P-labeled home 1 and home 2. As shown in Figure 6, the 1E250D and 1N225A mutant proteins of PI-PfuI had a 2-fold increase in affinity. In contrast, the affinity of 1D149A was decreased 2-fold. The 1E250A mutation did not critically affect binding ability to its substrate. On the other hand, three of the four mutant proteins of PI-PfuII, 2D249A, 2D249E and 2K224A, had distinctly lower (3- to 6-fold) affinities for its substrate. The apparent Kd values of the mutant proteins and their DNA substrates are summarized in Table 2. The drastic decrease in the binding affinity of the three mutant proteins of PI-PfuII for its DNA substrate may be due to distinct changes in the protein conformation induced by the substitutions. To determine conformational changes in the DNA substrates bound to the mutant PI-PfuI and PI-PfuII proteins, a circular permutation analysis was performed. As shown in Figure 4C, the mobilities of the DNA-protein complexes were the same for the mutant and wild-type proteins for both PI-PfuI and PI-PfuII. This result shows that the bending angles of the DNA caused by binding of the mutant enzymes are almost the same as those for wild-type proteins. A set of gel retardation experiments using mutant 2K224A of PI-PfuII did not work well because of the low binding affinity, as described above.


Figure 6. Binding abilities of mutant PI-PfuI and PI-PfuII. The substrate binding assay was done exactly as shown in Figure 1 (A). The dependence of complex formation on the concentration of enzymes in each experiment was plotted by a densitometric quantification of the complex bands (B). The symbols correspond to those in Figure 4C, except that the open triangles represent 2K224A.

Table 2. Apparent equilibrium dissociation constants of wild-type and mutant proteins
Intein   Kd (nM)
PI-PfuI WT 11
  1D149A 24
  1E250A 12
  1E250D 7.3
  1N225A 6.0
PI-PfuII WT 13
  2D156A 16
  2D249A 45
  2D249E 44
  2K224A 82

Cleavage abilities of the PI-PfuI and PI-PfuII mutant proteins

All mutants were assayed for ability to cleave double-stranded DNA using the plasmids p140 for PI-PfuI and p240 for PI-PfuII, containing their recognition sequences (Fig. 7). In the case of PI-PfuI, mutations at two acidic residues in the LAGLIDADG motifs, 1D149A and 1E250A, decreased the cleavage activity to <10-4-fold as compared with that of the wild-type protein. In contrast, the mutation at 1E250D did not affect cleavage activity. The third candidate residue of the active site triad, Asn225, could be substituted by Ala without any effect on activity. The acidic residues in the two LAGLIDADG motifs of PI-PfuII, Asp156 and Asp249, were also very critical for activity. The cleavage activities of the mutant proteins 2D156A and 2D249A decreased to <10-4-fold of that of the wild-type PI-PfuII. Especially, the effect of substitution at Asp156 was more severe, because no cleavage of the plasmid substrate was observed even when 1 µg of the 2D156A protein was reacted for 24 h (data not shown). The substitution of Glu250 of PI-PfuI by Asp (1E250D), a similar residue, did not affect catalysis at all, but in contrast, substitution of Asp249 of PI-PfuII by Glu (2D249E) decreased activity 50-fold. A 50-fold decrease in activity was also observed when Lys224, which is the third candidate of the active site triad of PI-PfuII, was substituted by Ala. The cleavage activities of the mutants are summarized in Table 3.


Figure 7. Cleavage activities of mutant PI-PfuI and PI-PfuII. The plasmid substrates, p140 and p240, were digested with ScaI and used for the endonuclease assay. Various amounts of enzymes were incubated with 100 ng of substrate DNA in a standard assay mixture at 80°C for 1 h (A). The ScaI-digested p140 (100 ng) was incubated with 1 µg of PI-PfuI mutant protein at 80°C for 24 h (B). The reaction products were separated by 0.8% agarose gel electrophoresis and were visualized by ethidium bromide staining. Asterisks indicate the bands produced by the star activity of PI-PfuI.

Table 3. Cleavage activities of wild-type and mutant PI-PfuI and PI-PfuII proteins
Intein   Relative activity
PI-PfuI WT 1
  1D149A <10-4
  1E250A <10-4
  1E250D 1
  1N225A 1
PI-PfuII WT 1
  2D156A <<10-4
  2D249A <10-4
  2D249E 1/50
  2K224A 1/50

DISCUSSION

We have described some of the biochemical properties of the hyperthermophilic homing endonucleases PI-PfuI and PI-PfuII. They are two of the eight enzymes among the intein-coded homing endonucleases that have been analyzed in some detail. Due to the interest in the molecular mechanisms of recognition and cleavage of specific DNA sequences, structural analyses have been performed on many enzymes in this category. Biochemical studies of three endonucleases in the LAGLIDADG family showed that PI-SceI and I-DmoI, which have two copies of the motif, work as monomers and I-CreI, with one copy of the motif, works as a dimer. The 3-dimensional crystal structures of these enzymes revealed that the LAGLIDADG motifs form [alpha]-helices and play a role in dimerization (I-CreI) or interdomain packing (PI-SceI and I-DmoI). PI-PfuI and PI-PfuII have two copies of the motif, and PI-PfuI (and probably also PI-PfuII) binds to its recognition sequence as a monomer. PI-PfuI and PI-PfuII may also have a common structure around the LAGLIDADG motifs. PI-PfuI and PI-PfuII distort the substrate DNAs to the same extent as in the case of PI-SceI. In contrast, the bending angles induced by the intron-coded endonucleases, which are known to distort the substrate, are lower than those induced by the intein-coded enzymes. It would be interesting to determine whether there is some relation between the distortion angle of the substrate DNA and the origin of the homing endonuclease (intein or intron).

PI-PfuI binds to one of the cleaved DNA strands after the reaction, as also found for PI-SceI and I-SceI in the LAGLIDADG family (14,28), I-TevI in the GIY-YIG family (29) and I-TevII having no common motifs (22), because the DNA band was shifted when the reaction products were directly loaded onto the agarose gel without phenol extraction (data not shown). This observation is consistent with the result that ~2-4 pmol of PI-PfuI were needed for complete digestion of 1 pmol of substrate DNA for 1 h (Fig. 7). PI-PfuII also seems to turn over as slowly as PI-PfuI. PI-PfuII may have some affinity for the product DNA, even though the DNA in the reaction mixture including the enzyme (without phenol extraction) ran smoothly on the agarose gels (data not shown). When purified PI-SceI is subjected to a gel retardation assay using an oligonucleotide probe, three bands are apparent, which indicates that two kinds of binding occur between PI-SceI and its recognition sequence. In their complex, one contact is made between the protein splicing domain of PI-SceI and the region adjacent to the cleavage site, and a second contact is made as well, by additional interactions between the endonuclease domain and the cleavage site itself (13,14). On the other hand, we observed only two bands (for the unbound DNA and for the DNA-protein complex) in the gel retardation experiments using PI-PfuI and PI-PfuII (Fig. 1). These data show that the binding characteristics differ among the homing endonucleases. It is noteworthy that the specific binding of PI-PfuII to its substrate DNA requires Mg2+.

Our mutation analyses showed that two acidic residues, each of which is in the two LAGLIDADG motifs (most C-terminal D or E), respectively, are actually important for the cleavage activities of PI-PfuI and PI-PfuII. These results are in agreement with the reports for other enzymes in this family. From the mutational analysis of PI-SceI, Lys301 is also critical, because no activity was detected for the substitution mutant protein K301A (25). The candidate residue in PI-PfuII, Lys224, corresponding to Lys301 of PI-SceI, affected activity. The mutant 2K224A had 50-fold less activity than the wild-type protein. In this case, however, the decrease in binding affinity of the mutant for the substrate may cause the decrease in activity in some parts. The substitution of Asn225 by Ala in PI-PfuI has the same binding affinity and cleavage activity as the wild-type protein. It is very possible that the critical third residues may be different from those we have predicted to be candidates from the sequence alignment. In a hidden Markov model-generated multiple sequence alignment (30), Lys224 of PI-PfuII matches Lys301 of PI-SceI, but Asn225 of PI-PfuI does not match. The corresponding regions are quite divergent among the inteins. Lys218 or Lys233, located around Asn225, may be the candidate residue for the active site triad in PI-PfuI, if the reaction mechanism is conserved.

I-CreI works as a dimer, and the two sets of catalytic residues, Asp20 in the LAGLIDADG motif and Lys98, of each monomer protein are symmetrically located in the 3-dimensional structure (5). Superposition of the PI-SceI structure onto that of I-CreI revealed that two lysines, Lys301 and Lys403, in PI-SceI correspond to the two Lys98 residues in the I-CreI dimer (5). A mutational analysis of PI-SceI supported the proposal that the two lysines actually participate in catalysis, and this result suggests that PI-SceI has two symmetrically located active centers (31). Since both PI-PfuI and PI-PfuII are monomeric homing endonucleases of the LAGLIDADG family, they are likely to have two catalytic centers, both of which include a LAGLIDADG motif and a basic residue. We looked for the residues corresponding to Lys403 of PI-SceI in PI-PfuI and PI-PfuII. However, no concrete residue was predicted from the multiple sequence alignment. It is now very important to determine the 3-dimensional structures of PI-PfuI and PI-PfuII. The structures will give us clues about the catalytic residues, and, moreover, comparisons of their structures with those of PI-SceI, I-CreI, and I-DmoI will enhance our understanding of the basic mechanisms of recognition and cleavage by the homing endonucleases of the LAGLIDADG motif family.

ACKNOWLEDGEMENTS

We thank Drs H. Toh and S. Kanai for the analysis of intein sequences and Dr I. Cann for reading the two manuscripts of this work. We also thank Dr H. Iwasaki for discussions at the early stage of this work. We are grateful to Dr Y. Shimura, the director of BERI, for continuous encouragement.

REFERENCES

1. Mueller, J.E., Bryk,M., Loizos,N. and Belfort,M. (1993) In Linn,S.M., Lloyd,R.S. and Roberts,R.J. (eds), Nucleases.Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, pp. 111-143.

2. Belfort, M. and Roberts,R.J. (1997) Nucleic Acids Res., 25, 3379-3388. MEDLINE Abstract

3. Belfort, M. and Perlman,P.S. (1995) J. Biol. Chem., 270, 30237-30240. MEDLINE Abstract

4. Duan, X., Gimble,F.S. and Quiocho,F.A. (1997) Cell, 89, 555-564. MEDLINE Abstract

5. Heath, P.J., Stephens,K.M., Monnat,R.J.,Jr and Stoddard,B.L. (1997) Nature Struct. Biol., 4, 468-476.

6. Silva, G.H., Dalgaard,J.Z., Belfort,M. and Roey,P.V. (1999) J. Mol. Biol., 286, 1123-1136. MEDLINE Abstract

7. Jurica, M.S., Monnat,R.T.,Jr and Stoddard,B.L. (1998) Mol. Cell, 2, 469-476. MEDLINE Abstract

8. Flick, K.E., Jurica,M.S., Monnat,R.T.,Jr and Stoddard,B.L. (1998) Nature, 394, 96-101. MEDLINE Abstract

9. Riera, J., Robb,F.T., Weiss,R. and Fontecave,M. (1997) Proc. Natl Acad. Sci. USA, 94, 475-478. MEDLINE Abstract

10. Komori, K., Fujita,N., Ichiyanagi,K., Shinagawa,H., Morikawa,K. and Ishino,Y. (1999) Nucleic Acids Res., 27, 4167-4174.

11. Kim, J., Zwieb,C., Wu,C. and Adhya,S. (1989) Gene, 85, 15-23. MEDLINE Abstract

12. Pohler, J.R.G., Norman,D.G., Bramham,J., Bianchi,M.E. and Lilley,D.M.J. (1998) EMBO J., 17, 817-826. MEDLINE Abstract

13. Gimble, F.S. and Wang,J. (1996) J. Mol. Biol., 263, 163-180. MEDLINE Abstract

14. Wende, W., Grindl,W., Christ,F., Pingoud,A. and Pingoud,V. (1996) Nucleic Acids Res., 24, 4123-4132. MEDLINE Abstract

15. Thompson, J.F. and Landy,A. (1988) Nucleic Acids Res., 20, 9687-9705.

16. Gimble, F.S. and Stephens,B.W. (1995) J. Biol. Chem., 270, 5849-5856. MEDLINE Abstract

17. Luisi, B. (1995) In Lilley,D.M.J. (ed.), DNA-Protein: Structural Interactions.IRL Press, Oxford, UK, pp. 1-48.

18. Travers, A.A. (1995) In Lilley,D.M.J. (ed.), DNA-Protein: Structural Interactions.IRL Press, Oxford, UK, pp. 49-75.

19. Kim, Y., Grable,J.G., Love,R., Greene,P.J. and Rosenberg,J.M. (1990) Science, 249, 1307-1309. MEDLINE Abstract

20. Winkler, F.K., Banner,D.W., Oefner,C., Tsernoglou,D., Brown,R.S., Heathman,S.P., Bryan,R.K., Martin,P.D., Petratros,K. and Wilson,K.S. (1993) EMBO J., 12, 1781-1795. MEDLINE Abstract

21. Mueller, J.E., Smith,D., Bryk,M. and Belfort,M. (1995) EMBO J., 14, 5724-5735. MEDLINE Abstract

22. Loizos, N., Silva,G.H. and Belfort M. (1996) J. Mol. Biol., 255, 412-424. MEDLINE Abstract

23. Wittmayer, P.K. and Raines,R.T. (1996) Biochemistry, 35, 1076-1083. MEDLINE Abstract

24. Aggarwal, A.K. (1995) Curr. Opin. Struct. Biol., 5, 11-19. MEDLINE Abstract

25. He, Z., Crist,M., Yen,H.-C., Duan,X., Quiocho,F.A. and Gimble,F.S. (1998) J. Biol. Chem., 273, 4607-4615. MEDLINE Abstract

26. Pietrokovski, S. (1994) Protein Sci., 3, 2340-2350. MEDLINE Abstract

27. Perler, F.B., Olsen,G.J. and Adam,E. (1997) Nucleic Acids Res., 25, 1087-1093. MEDLINE Abstract

28. Perrin, A., Buckle,M. and Dujon,B. (1993) EMBO J., 12, 2939-2947. MEDLINE Abstract

29. Mueller, J.E., Smith,D. and Belfort,M. (1996) Genes Dev., 10, 2158-2166. MEDLINE Abstract

30. Dalgaard, J.Z., Klar,A.J., Moser,M.J., Holley,W.R., Chatterjee,A. and Mian,I.S. (1997) Nucleic Acids Res., 25, 4626-4638. MEDLINE Abstract

31. Seligman, L.M., Stephens,K.M., Savage,J.H. and Monnat,R.J.,Jr (1997) Genetics, 147, 1653-1664. MEDLINE Abstract


*To whom correspondence should be addressed. Tel: +81 6 6872 8208; Fax: +81 6 6872 8219; Email: ishino{at}beri.co.jp


This page is run by Oxford University Press, Great Clarendon Street, Oxford OX2 6DP, as part of the OUP Journals
Comments and feedback: jnl.info{at}oup.co.uk
Last modification:
Copyright© Oxford University Press, 1999.

Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
J. Biol. Chem.Home page
P. Singh, P. Tripathi, G. H. Silva, A. Pingoud, and K. Muniyappa
Characterization of Mycobacterium leprae RecA Intein, a LAGLIDADG Homing Endonuclease, Reveals a Unique Mode of DNA Binding, Helical Distortion, and Cleavage Compared with a Canonical LAGLIDADG Homing Endonuclease
J. Biol. Chem., September 18, 2009; 284(38): 25912 - 25928.
[Abstract] [Full Text] [PDF]


Home page
GENES CELLSHome page
R. Fujikane, H. Shinagawa, and Y. Ishino
The archaeal Hjm helicase has recQ-like functions, and may be involved in repair of stalled replication fork
Genes Cells, February 1, 2006; 11(2): 99 - 110.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
G. H. Silva and M. Belfort
Analysis of the LAGLIDADG interface of the monomeric homing endonuclease I-DmoI
Nucleic Acids Res., June 9, 2004; 32(10): 3156 - 3168.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
L. Thion, E. Laurine, M. Erard, O. Burlet-Schiltz, B. Monsarrat, J.-M. Masson, and I. Saves
The Two-step Cleavage Activity of PI-TfuI Intein Endonuclease Demonstrated by Matrix-assisted Laser Desorption Ionization Time-of-flight Mass Spectrometry
J. Biol. Chem., November 15, 2002; 277(47): 45442 - 45450.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
N. Guhan and K. Muniyappa
The RecA Intein of Mycobacterium tuberculosis Promotes Cleavage of Ectopic DNA Sites. IMPLICATIONS FOR THE DISPERSAL OF INTEINS IN NATURAL POPULATIONS
J. Biol. Chem., October 18, 2002; 277(43): 40352 - 40361.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
I. Saves, C. Morlot, L. Thion, J.-L. Rolland, J. Dietrich, and J.-M. Masson
Investigating the endonuclease activity of four Pyrococcus abyssi inteins
Nucleic Acids Res., October 1, 2002; 30(19): 4158 - 4165.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
N. Guhan and K. Muniyappa
Mycobacterium tuberculosis RecA Intein Possesses a Novel ATP-dependent Site-specific Double-stranded DNA Endonuclease Activity
J. Biol. Chem., May 3, 2002; 277(18): 16257 - 16264.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
B. S. Chevalier and B. L. Stoddard
Homing endonucleases: structural and functional insight into the catalysts of intron/intein mobility
Nucleic Acids Res., September 15, 2001; 29(18): 3757 - 3774.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
K. Komori, S. Sakae, R. Fujikane, K. Morikawa, H. Shinagawa, and Y. Ishino
Biochemical characterization of the Hjc Holliday junction resolvase of Pyrococcus furiosus
Nucleic Acids Res., November 15, 2000; 28(22): 4544 - 4551.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Print PDF (586K) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (21)
Right arrowRequest Permissions
Right arrow Commercial Re-use Guidelines
for Open Access NAR Content
Google Scholar
Right arrow Articles by Komori, K.
Right arrow Articles by Ishino, Y.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Komori, K.
Right arrow Articles by Ishino, Y.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?