| Nucleic Acids Research | Pages |
Functional analysis of human MutS[alpha] and MutS[beta] complexes in yeast
Introduction
Materials And Methods
Yeast strains
Vector construction
Overexpression of mismatch recognition proteins in yeast
Yeast extract preparation
Western blot analysis of yeast extracts
Mismatch binding assay
Results
Lack of complementation by human MutS homologs
Dominant negative mutator effects by human MutS homologs
Analysis of heteroduplex binding
Analysis of the effect of an hMSH2 missense mutation
Discussion
Acknowledgements
References
Functional analysis of human MutS[alpha] and MutS[beta] complexes in yeast
ABSTRACT
INTRODUCTION
DNA mismatch repair (MMR) increases the stability of cellular genomes by correcting DNA replication errors that escape proofreading. This process is initiated when bacterial MutS protein or its eukaryotic homologs bind to mismatches. In humans, the hMSH2 protein can bind to mismatched DNA either alone (1,2) or when complexed with hMSH6 or hMSH3 to form hMutS[alpha] and hMutS[beta] heterodimers, respectively. hMutS[alpha] binds to and participates in the repair of single base·base mismatches as well as those containing 1-8 unpaired nucleotides (3-7). Although hMutS[beta] has little binding affinity for single base mismatches, it participates in the repair of substrates containing 1-8 unpaired nucleotides (5,6).
In addition to binding to their MSH partner and to mismatched DNA, the hMSH proteins work in concert with other proteins to conduct ATP-dependent reactions that excise replication errors and replace them with correct nucleotides (reviewed in 8-10). Perturbation of these multiple interactions and enzymatic reactions can result in inactivation of MMR, a defect that has been linked to both hereditary and sporadic cancers in several tissues (reviewed in 11,12). Loss of MMR activity leads to a mutator phenotype in vivo, whose magnitude depends on the nature of the defect and the reporter gene used to detect it. In yeast, complete loss of MMR elevates the rate of forward mutation to canavanine resistance ~40-fold (e.g. 13), while greater differences are seen with mutant alleles of reporter genes that can revert by deletions or additions in repetitive sequences (e.g. 14). The most sensitive microsatellite sequences for detecting loss of MMR are long homopolymeric runs having a high probability of misalignment and a low probability of proofreading during replication (15). In such sequences, inactivation of MMR leads to a very strong increase in mutation rate. For example, the rate of loss of a single A·T base pair from an (A·T)14 run in the LYS2 gene is 10 000-fold higher in an msh2 mutant yeast strain than in a wild-type yeast cell strain (16). This highly sensitive reporter gene can be used to examine even partial loss of MMR capacity. Here we use it for functional analysis of the human MutS[alpha] and MutS[beta] complexes produced in yeast. We show that although the hMSH proteins are unable to complement the mutator phenotype of a yeast msh2 mutant, concomitant expression of hMSH2 and hMSH6 or hMSH2 and hMSH3 in a wild-type yeast strain produces a mutator phenotype. We then use the system to demonstrate the functional consequence of an hMSH2 missense mutation found in a cancer patient.
MATERIALS AND METHODS
Yeast strains
Yeast strains E134 (wild-type) and DAG60 (msh2::kanMX) were constructed from the original strain CG379 (S1 in our collection): Mat[alpha] ade5-1 his7-2 leu2-3,112 trp1-289 ura3-52 (17). Both E134 and DAG60 carry the lys2::InsE-A14 mutant allele which reverts via single base deletions in the A14 homonucleotide run (16). The msh2::kanMX mutation in DAG60 was created by replacing a major portion of the MSH2 coding region (leaving 41 nt on the 5[prime] side and 96 nt on the 3[prime] side) using the PCR disruption technique by the kanMX module (18). The kanMX cassette was amplified by PCR using the following pair of primers (underlined are sequences of primers homologous to the kanMX cassette): msh2-kanMX-5[prime]: d(ATGTCCTCCACTAGGCCAGAGCTAAAATTCTCTGATGTATCCGTACGCTGCAGGTCGAC) and MSH2-kanMX-3[prime]: d(CTGGTTCATTTGCTATAGCACGCAATAGCTCTTGTATTTTATGCTGATCGATGAATTCGAGCTCG). Strain E134 was transformed to G418-resistance and msh2 mutant transformants were verified by an allelism test. The yeast strain E203 (msh6::kanMX), containing a deletion of the entire open reading frame of MSH6, was constructed using the PCR disruption technique by the kanMX module (18,19). The strain E209 (msh3::hisG) was prepared from E134 by transformation with EcoRI digested pEN33 (20). All transformants for strain construction were verified by allelism tests.
Vector construction
Expression plasmids are derived from previously described yeast-Escherichia coli shuttle vectors (21). YEp195SPGAL, a gift from E. Perkins, was derived from the YEplac195 2µ origin based plasmid with a URA3 selectable marker by replacing the YEplac195 PvuII fragment with the PvuII fragment from the pSPORT cloning vector (Life Technologies). An EcoRI/SalI fragment containing GAL1-10 promoter was ligated into the pSPORT multicloning sequence at the EcoRI and SalI restriction sites providing multicloning sites on both sides of the divergent GAL1-10 promoter. Both the YEp181SPGAL (LEU2 marker) and the YEp112SPGAL (TRP1 marker) expression plasmids were derived from YEplac181 and YEplac112 by replacing the original pUC lacZ PvuII fragment with the PvuII fragment containing the GAL1-10 promoter with the pSPORT multicloning sites from YEp195SPGAL. The yeast MSH2 expression plasmid pAC12, containing the yeast coding sequence for MSH2 fused to the GAL promoter, was constructed by ligating the yeast gene isolated from pEN11 (a gift from R. Kolodner) as a blunt-ended XhoI/KpnI fragment into the blunt-ended EcoRI/KpnI digested YEp195SPGAL expression vector. This construction places the start codon of yeast MSH2 18 nt further downstream than the start codon of the GAL10 gene (22). The human MSH2 expression plasmid pAC20.2, containing the human coding sequence for MSH2 fused to the GAL promoter, was constructed by ligating the human MSH2 cDNA isolated from pBS-hMSH2 (a gift from Burt Vogelstein) as a blunt-ended XbaI/KpnI fragment into the blunt-ended EcoRI/KpnI digested YEp195SPGAL expression vector. This positioning of the human MSH2 coding sequence places the start codon 18 nt further downstream than the start site of the GAL10 gene (22) and includes 289 nt 3[prime] of the termination codon. The expression plasmid pAC31.3, containing the human MSH3 coding sequence fused to the GAL promoter, was constructed by creating a HindIII and MluI fragment of hMSH3 cDNA (a gift from T. Shimada) by PCR using deep vent DNA polymerase (New England Biolabs). The PCR fragment was digested 5[prime] and 3[prime] of the hMSH3 coding sequence with HindIII and MluI, respectively, and ligated into the HindIII and MluI sites in YEp181SPGAL in which the BamHI fragment within the multicloning sequence had been deleted. This construction places the start codon of hMSH3 18 nt further downstream than the start codon of the GAL1 gene (22) and includes 46 nt 3[prime] of the termination codon. The expression plasmid pAC61.2, containing the human MSH6 cDNA sequence, was isolated as a BamHI/blunt-ended XhoI fragment from pBS-hGTBP (a gift from J. Jiricny) and ligated into the BamHI/blunted MluI site of YEp181SPGAL, placing the hMSH6 cDNA start codon 6 nt further downstream than the start codon of the GAL1 gene. The sequence of the hGTBP overexpression construct and all of the above MutS homolog constructions were determined to be correct by DNA sequencing.
Overexpression of mismatch recognition proteins in yeast
Yeast strains were transformed with expression plasmids according to the modified lithium acetate procedure (21). Transformants were selected on synthetic media without uracil and leucine (23). For induction of the gene or cDNA sequences fused to the GAL1-10 promoter, transformants were streaked onto synthetic media without uracil and leucine, but containing lysine and 2% galactose (Pfanstiehl Laboratories, Inc., Waukegan, IL) substituted for glucose. Quantitative measurements of the ability of the expressed sequences to either complement an msh2 null mutant or exhibit a dominant negative mutator phenotype were determined on galactose containing media lacking lysine by fluctuation analysis as previously described (24).
Yeast extract preparation
Yeast cultures overexpressing human mismatch recognition proteins were grown in liquid synthetic media containing 2% galactose substituted for glucose and lacking uracil and leucine. Cells were harvested at a density of ~5 × 107 cells/ml, resuspended in 1 ml of 10% sucrose, 50 mM Tris pH 7.5, 10 mM EDTA/g of cells, and frozen in liquid nitrogen. Upon thawing cells, zymolyase 100T (ICN, Costa Mesa, CA) was added to 1 mg/ml and the cells were incubated on ice for 30 min. An equal volume of lysis buffer 0.5 M NaCl, 50 mM Tris pH 7.5, 10 mM EDTA, 10% glycerol, 1 mM 2-mercaptoethanol, 0.1 M PMSF was added and the cells were incubated on ice for 30 min. Lysates were centrifuged at 25 000 g for 10 min and the supernatants were collected.
Figure 1. Vectors used in this study. Multicopy galactose expression vectors were constructed that contain the 2µ origin, the GAL1-10 inducible promoter with multiple cloning sites, and either LEU2, URA3 or TRP1 for selection. For the vectors containing the MutS homolog genes used in this study, only the restriction sites used for cloning are shown. The sites in parentheses were rendered blunt-ended for ligation. SDS-PAGE gels containing 30 µg of yeast extract per lane were transferred to PVDF membrane (Millipore, Burlington, MA) overnight in 25 mM Tris, 192 mM glycine buffer at 0.1 mA. Blots were blocked with 3% gelatin (BioRad, Hercules, CA) before probing with antibodies. Purified rabbit polyclonal antibody against hMSH2 (Ab-3) was purchased from Oncogene Research Products (Cambridge, MA). A multiple antigen peptide of amino acids 136-156 of human MSH3, purchased from Research Genetics (Huntsville, AL), was used for making a polyclonal rabbit antiserum. Goat affinity purified polyclonal antibody against an hGTBP peptide containing amino acids 69-88 was purchased from Santa Cruz Biotechnologies (Santa Cruz, CA). Alkaline phosphatase conjugated goat-anti-rabbit antibody was purchased from Promega (Madison, WI). Alkaline phosphatase conjugated rabbit-anti-goat antibody was purchased fromJackson ImmunoResearch Laboratories (West Grove, PA). An oligo heteroduplex containing a G·T mispair was formed by annealing radiolabeled d(GAATTCACGGCGGCGGCGGCGGGACCGG) with unlabeled d(CCGGTCCCGCCGCTGCCGCCGTGAATTC) (bold type represent mispairs bases). Homoduplex and two base loop heteroduplex were formed by annealing radiolabeled d(ATATGACATGTGGAATTCTATTGTGGC) with d(GCCACAATAGAATTCCACATGTCATAT), and d(GCCACAATAGAACCTTCCACATGTCATAT), respectively. A single T insertion simulating one of the two possible substrates occurring within lys2::InsE-A14 was prepared from radiolabeled d(CTTTCCCGTTTTTTTTTTTTTTAAGGATCT) containing a T14 run and unlabeled d(AGATCCTTAAAAAAAAAAAAACGGGAAAG) with an A13 run. A heteroduplex oligonucleotide with a single A insertion was prepared by annealing radiolabeled d(AGATCCAAAAAAAAAAAAAACGGGAAAG) with an A14 run and unlabeled d(CTTTCCCGTTTTTTTTTTTTTAAGGATCT) having a T13 run. Homoduplexes were made by annealing radiolabeled oligo-nucleotides to unlabeled complementary oligonucleotides. Mismatch binding assays were performed with 15 µg of yeast extract and 100 fmol of duplex substrate in 20 µl reactions containing 20 mM Tris pH 7.5, 5 mM MgCl2, 0.1 mM DTT, 0.01 mM EDTA, 2 µg of non-specific competitor. Mixtures were incubated on ice for 30 min, then mixed with 5 µl of loading buffer (20 mM Tris pH 7.5, 5 mM MgCl2, 0.1 mM DTT, 0.01 mM EDTA, 50% glycerol, 0.015% Bromophenol Blue) and subjected to electrophoresis (100 V) at 4°C through 6% polyacrylamide gels in 0.5× TBE buffer. Gels were dried and exposed to phosphor screens for analysis by a PhosphorImager (Molecular Dynamics). Extent of binding was calculated as the ratio of pixels in the shifted band to the total number of pixels in the gel lane.
Western blot analysis of yeast extracts
Mismatch binding assay
RESULTS
Multicopy, galactose-inducible expression vectors were constructed for expression of yMSH2, hMSH2, hMSH3 and hMSH6 in yeast (Fig.
Table 1.
| Strain/plasmid | Mutation rate (×106) | 95% Confidence limits (×106) |
| MSH2+/vectors | 0.13 | 0.07-0.19 |
| msh2-/vectors | 1900 | 980-4000 |
| msh2-/yMSH2 | 0.07 | 0.03-0.82 |
| msh2-/hMSH2 | 1400 | 1000-1800 |
| msh2-/hMSH3 | 1000 | 800-1200 |
| msh2-/hMSH6 | 2600 | 1400-3600 |
| msh2-/hMSH2 + hMSH3 | 1100 | 820-2400 |
| msh2-/hMSH2 + hMSH6 | 1600 | 1300-2200 |
Lack of complementation by human MutS homologs
The difference in LYS+ reversion rate between a wild-type and an msh2 mutant yeast strain is 10 000-fold (16). The high reversion rate in an msh2 mutant strain is unaffected by introducing control vectors that do not contain MMR genes (Table 1, line 2). However, it is fully complemented by introducing a yeast MSH2 expression vector, consistent with Alani et al. (25; Drotschman et al., submitted) (Table 1, line 3). In contrast, introduction of human MSH2, MSH3 or MSH6, either individually or in combination (Table 1, lines 4-8), does not reduce the high reversion rate of the msh2 mutant. That this lack of complementation is not due to lack of expression of the human proteins is suggested by western blot analysis of extracts of galactose-induced strains harboring the hMSH2, hMSH3 and hMSH6 expression vectors alone or in combination (Fig.
Figure 2. Immunoblots of yeast strains expressing MutS homologs. Each lane contains 30 µg of yeast extract with human proteins expressed individually or together, as indicated. The bands migrating with mobilities consistent with deduced mobilities for human MutS homologs are indicated by asterisks. Lanes 9 and 10 contain a higher mobility species stained with hMSH6 antibody. The smaller band is likely the result of proteolysis similar to that observed after purification of hMSH6 from both HeLa cells and baculovirus (5,37). The slower mobility species present in lanes 6 and 7 is a galactose-induced protein of unknown identity that cross reacts with hMSH3 antiserum. We next examined whether expression of the human proteins interfered with yeast MMR as detected by an increase in reversion rate. Expression of hMSH2, hMSH3 or hMSH6 alone did not affect the reversion rate of a wild-type yeast strain (Table 2, compare line 1 with lines 5-7), indicating that these proteins individually do not influence MMR in vivo in yeast. However, co-expression of hMSH2 with hMSH6 yielded a reversion rate of 510 × 10-6, a value 4000-fold higher than that of the wild-type strain (Table 2, line 9) and close to that of the yeast msh2 null mutant strain. Co-expression of hMSH2 and hMSH3 yielded a reversion rate of 0.66 × 10-6, a value 5-fold higher than that for the wild-type strain. For comparison, an msh3- strain has a mutation rate that is 18-fold higher than the wild-type strain (Table 2, line 2). Although small, the 5-fold effect is reproducible and significant, since the lower 95% confidence limit for co-expression of hMSH2 and hMSH3 is greater than the upper 95% confidence limit for the wild-type strain. Moreover, both the 4000- and 5-fold mutator phenotypes are absent when the strains are grown on glucose containing media (i.e., without inducing expression), and they are not observed in strains in which either the hMSH2, hMSH3 or hMSH6 expression vector is lost when selection is not maintained (data not shown). Table 2. The dominant negative mutator effects suggest that concomitant expression of hMSH2 and hMSH6 and of hMSH2 and hMSH3 may result in formation of hMutS[alpha] and hMutS[beta] complexes that inhibit yeast MMR. To determine if these human complexes form and bind to mismatched substrates, DNA mobility shift assays were performed with extracts made from both msh2 and MSH2 yeast strains overexpressing hMSH2, hMSH3 or hMSH6 individually, or from strains overexpressing both partners of hMutS[alpha] or hMutS[beta]. None of the extracts prepared from strains containing vectors lacking hMutS homologs or from strains expressing individual hMutS homologs displayed evidence of specific binding to heteroduplexes containing a 2 nt insertion/deletion mismatch (Fig. Figure 3. Band-shift analysis. Extracts were prepared from an msh2 mutant yeast strain expressing the human protein(s) in order to abolish substrate recognition by the yeast MMR system. Similar results (not shown) were obtained with a wild-type yeast strain. Extracts are indicated above each lane. The positions of the free probe and the bound complex are indicated by arrows. (A) Binding by extracts expressing individual human MutS homologs or co-expressing the partners of human MutS[alpha] and human MutS[beta] complexes. (B) Binding by co-expressed hMSH2·hMSH3 and hMSH2·hMSH6. The homoduplex or heteroduplex substrates used are indicated above the lanes. (C) A comparison of binding by wild-type or mutant hMutS[alpha] to duplex oligonucleotides containing an extra A or T in one strand. DNA mobility shift assays were also performed with single-base deletion mismatches using the same A14 run sequence that was used to score reversion rates in vivo. An extract of cells expressing hMSH2 and hMSH6 yielded a strong, unique band with substrates containing an unpaired A or T nucleotide (Fig. In addition to the results shown in Figure We examined the ability of a missense mutation in hMSH2to modulate the 4000-fold mutator effect of the wild-typehMutS[alpha] complex. We chose to investigate the R524P missensesubstitution that has been described as an HNPCC mutation (26). A human ovarian tumor cell line harboring this mutation exhibits microsatellite instability (26) and an extract of this cell line is defective in repair of base·base and insertion/deletion mismatches (27). We introduced the R524P mutation into hMSH2 in the yeast expression vector and then co-expressed it with the wild-type hMSH6 gene in a wild-type yeast strain. Immunoblots of a cell extract (not shown) revealed that the hmsh2-R524P and hMSH6 protein expression levels were similar to those of the wild-type proteins shown in Figure
Dominant negative mutator effects by human MutS homologs
Strain/plasmid
Mutation rate (×106)
95% Confidence limits (×106)
Fold increase over MSH2+
(×106)
MSH2+
MSH2+/vectors
0.13
0.07-0.19
1
msh3-
2.4
1.9-4.3
18
msh6-
22
12-39
170
msh2-/vectors
1900
1000-4000
14 000
MSH2+/hMSH2
0.08
0.04-0.17
1
MSH2+/hMSH3
0.13
0.08-0.25
1
MSH2+/hMSH6
0.15
0.08-0.29
1
MSH2+/hMSH2 + hMSH3
0.66
0.47-2.1
5
MSH2+/hMSH2 + hMSH6
510
160-940
4000
MSH2+/hMSH2R542P + hMSH6
0.20
0.10-0.57
1
Analysis of heteroduplex binding
Analysis of the effect of an hMSH2 missense mutation
DISCUSSION
The results presented here are relevant to several aspects of DNA MMR in eukaryotes. Although considerable evidence indicates that hMSH2, hMSH3 and hMSH6 participate in repair of single-base deletion mismatches in human cells (4,6,27-31), our data suggest that these proteins cannot fulfil this same role in yeast, since they fail to complement the strong single-base deletion mutator phenotype of an msh2 mutant strain. This may reflect the inability of the human proteins to productively interact with yeast proteins downstream in the MMR pathway, such as Mlh1p, Pms1p or PCNA. Nonetheless, the western blot analysis demonstrates that the human genes are expressed in yeast, and the band-shift results indicate that they bind mismatched DNA. An extract of yeast cells co-expressing hMSH2 and hMSH6, but neither protein alone, yields a band shift with DNA containing a G·T mismatch or two extra nucleotides. This is consistent with the mismatch binding specificity of natural and recombinant hMutS[alpha] (3,5,31) and with its participation in strand-specific repair of these mismatches in vitro (4,6). An extract of yeast cells co-expressing hMSH2 and hMSH3 also yields a strong band shift with a substrate containing two extra nucleotides, but not with DNA containing a G·T mismatch. Again, this is consistent with the reported mismatch binding specificity of hMutS[beta] (5), its role in correcting frameshift heteroduplexes, and the fact that it has a minor (29,32) or undetectable role (4,6,7) in correcting base·base mismatches. Collectively, the data indicate that human protein complexes with mismatch binding capacity are present in these yeast extracts.
The mutator phenotypes in the wild-type yeast strain are observed only upon galactose-induced expression of both partners of the hMutS[alpha] and hMutS[beta] heterodimers, demonstrating that the complexes are also present in vivo. The data also suggest that hMutS[alpha] and hMutS[beta] alone are sufficient for the recognition of mismatches in vivo. The increase in mutation rate conferred by hMSH2·hMSH6 (4000-fold) and by hMSH2·hMSH3 (5-fold) correlates with their respective strong versus weak binding to deletion mismatches in the lys2::InsE-A14 target DNA sequence. These differential effects are consistent with a recent in vitro study indicating that hMutS[alpha] is much more active in repairing single nucleotide insertion/deletion mismatches than is hMutS[beta] (6). The results may be explained in several ways, including a model wherein suppression of MMR in vivo results from mismatch binding by the hMutS heterodimer, with subsequent inability to interact with heterologous yeast proteins required for MMR. The human and yeast complexes may be sufficiently diverged such that the proteins cannot be interchanged. Regardless of the explanation for the increased mutation rate, the results demonstrate that, in addition to many functional studies of single mammalian repair genes in yeast (33-36), yeast can also be used for functional analysis of human multiprotein complexes.
The 4000-fold mutator effect and strong binding activity of co-expressed hMSH2 and hMSH6 are completely eliminated by the R524P missense mutation in hMSH2 found in an HNPCC patient (26). These strong effects in yeast cells are consistent with the microsatellite instability (26) and MMR defects (27) observed for a human ovarian tumor cell line that is hemizygous for this mutation. Arg524 is conserved among eukaryotic MSH2 proteins, and the non-conservative change to proline may effect function by eliminating heterodimer formation or nucleic acid binding. The yeast model system described here will be useful for functional studies of the human MutS[alpha] complex, including examination of the functional consequences of missense mutations found in hereditary and sporadic cancers. Modification of the reporter gene to monitor instability in different repetitive sequences should also provide a more sensitive assay for hMutS[beta] function.
ACKNOWLEDGEMENTS
We wish to thank Micheline Strand, Asad Umar and Polina Shcherbakova for critical evaluation of the manuscript. We thank Ed Perkins for YEp195SPGAL, Richard Kolodner for the yMSH2 plasmid, Bert Vogelstein for the hMSH2-cDNA plasmid, Takashi Shimada for the hMSH3-cDNA plasmid, and Giancarlo Marra and J. Jiricny for the hGTBP-cDNA plasmid. We also thank Asad Umar and Sam Bennett for the antibody against hMSH3.
REFERENCES
This article has been cited by other articles:
This page is run by Oxford University Press, Great Clarendon Street, Oxford OX2 6DP, as part of the OUP Journals
Comments and feedback: www-admin{at}oup.co.uk
Last modification: 15 Jan 1999
Copyright©Oxford University Press, 1999.
![]()
CiteULike
Connotea
Del.icio.us What's this?
![]()
![]()

![]()
![]()
![]()
M. Lynch
The Cellular, Developmental and Population-Genetic Determinants of Mutation-Rate Evolution
Genetics,
October 1, 2008;
180(2):
933 - 943.
[Abstract]
[Full Text]
[PDF]
![]()
![]()
![]()

![]()
![]()
![]()
A. B. Clark, L. Deterding, K. B. Tomer, and T. A. Kunkel
Multiple functions for the N-terminal region of Msh6
Nucleic Acids Res.,
June 27, 2007;
(2007)
gkm409v2.
[Abstract]
[Full Text]
[PDF]
![]()
![]()
![]()

![]()
![]()
![]()
A. B. Clark and T. A. Kunkel
Cadmium Inhibits the Functions of Eukaryotic MutS Complexes
J. Biol. Chem.,
December 24, 2004;
279(52):
53903 - 53906.
[Abstract]
[Full Text]
[PDF]
![]()
![]()
![]()

![]()
![]()
![]()
A. R. Ellison, J. Lofing, and G. A. Bitter
Human MutL homolog (MLH1) function in DNA mismatch repair: a prospective screen for missense mutations in the ATPase domain
Nucleic Acids Res.,
October 8, 2004;
32(18):
5321 - 5338.
[Abstract]
[Full Text]
[PDF]
![]()
![]()
![]()

![]()
![]()
![]()
C. L. Chang, G. Marra, D. P. Chauhan, H. T. Ha, D. K. Chang, L. Ricciardiello, A. Randolph, J. M. Carethers, and C. R. Boland
Oxidative stress inactivates the human DNA mismatch repair system
Am J Physiol Cell Physiol,
July 1, 2002;
283(1):
C148 - C154.
[Abstract]
[Full Text]
[PDF]
![]()
![]()
![]()

![]()
![]()
![]()
K. Drotschmann, W. Yang, F. E. Brownewell, E. T. Kool, and T. A. Kunkel
Asymmetric Recognition of DNA Local Distortion. STRUCTURE-BASED FUNCTIONAL STUDIES OF EUKARYOTIC Msh2-Msh6
J. Biol. Chem.,
November 30, 2001;
276(49):
46225 - 46229.
[Abstract]
[Full Text]
[PDF]
![]()
![]()
![]()

![]()
![]()
![]()
P. V. Shcherbakova, M. C. Hall, M. S. Lewis, S. E. Bennett, K. J. Martin, P. R. Bushel, C. A. Afshari, and T. A. Kunkel
Inactivation of DNA Mismatch Repair by Increased Expression of Yeast MLH1
Mol. Cell. Biol.,
February 1, 2001;
21(3):
940 - 951.
[Abstract]
[Full Text]
![]()
![]()
![]()

![]()
![]()
![]()
J. M. Kirchner, H. Tran, and M. A. Resnick
A DNA Polymerase {epsilon} Mutant That Specifically Causes +1 Frameshift Mutations Within Homonucleotide Runs in Yeast
Genetics,
August 1, 2000;
155(4):
1623 - 1632.
[Abstract]
[Full Text]
![]()
![]()
![]()

![]()
![]()
![]()
R. Gary, M. S. Park, J. P. Nolan, H. L. Cornelius, O. G. Kozyreva, H. T. Tran, K. S. Lobachev, M. A. Resnick, and D. A. Gordenin
A Novel Role in DNA Metabolism for the Binding of Fen1/Rad27 to PCNA and Implications for Genetic Risk
Mol. Cell. Biol.,
August 1, 1999;
19(8):
5373 - 5382.
[Abstract]
[Full Text]
[PDF]
![]()
![]()
![]()

![]()
![]()
![]()
K. Drotschmann, A. B. Clark, H. T. Tran, M. A. Resnick, D. A. Gordenin, and T. A. Kunkel
Mutator phenotypes of yeast strains heterozygous for mutations in the MSH2 gene
PNAS,
March 16, 1999;
96(6):
2970 - 2975.
[Abstract]
[Full Text]
[PDF]
![]()
![]()
![]()

![]()
![]()
![]()
P. Dufner, G. Marra, M. Raschle, and J. Jiricny
Mismatch Recognition and DNA-dependent Stimulation of the ATPase Activity of hMutSalpha Is Abolished by a Single Mutation in the hMSH6 Subunit
J. Biol. Chem.,
November 17, 2000;
275(47):
36550 - 36555.
[Abstract]
[Full Text]
[PDF]
![]()
This Article ![]()
![]()
Abstract
![]()
Print PDF (334K)
![]()
Alert me when this article is cited
![]()
Alert me if a correction is posted
![]()
Services ![]()
![]()
Email this article to a friend
![]()
Similar articles in this journal
![]()
Similar articles in ISI Web of Science
![]()
Similar articles in PubMed
![]()
Alert me to new issues of the journal
![]()
Add to My Personal Archive
![]()
Download to citation manager
![]()
Search for citing articles in:
ISI Web of Science (23)
![]()
Request Permissions ![]()
Commercial Re-use Guidelines
for Open Access NAR Content
![]()
Google Scholar ![]()
![]()
Articles by Clark, A. B.
![]()
Articles by Kunkel, T. A.
![]()
Search for Related Content
![]()
PubMed ![]()
![]()
PubMed Citation
![]()
Articles by Clark, A. B.
![]()
Articles by Kunkel, T. A.
![]()
Social Bookmarking ![]()
![]()
What's this?