Nucleic Acids Research

Strains and growth media

The bacterial strains used in this study derive from E.coli K-12 and were provided by Dr Bernard Weiss (Johns Hopkins University School of Medicine, Baltimore, MD): AB1157 wild-type, BW286 [dut-1, [Delta](xth-pncA)] (18) and BW528 [nfo-1::Kan [Delta](xth-pncA)] (13) were grown in standard LB or on LB agar. For the BW286 strain (18), LB was supplemented with 250 µg/ml thymidine. The T.cruzi Y strain and L.major 252 strain were grown in LIT and M199 medium (Gibco) respectively, both of them supplemented with 10% fetal bovine serum (Gibco).

Trypanosoma cruzi and Leishmania major cDNA libraries

The cells used for construction of cDNA libraries were epi-mastigotes from the Y strain of T.cruzi and promastigotes derived from the 252 strain of L.major. Log phase, 24 × 10⁶ parasites/ml for T.cruzi and 17 × 10⁶ parasites/ml for L.major, were used. Isolation of poly(A)⁺ mRNA, library construction and complementation screening were carried out as described (19). Sequencing was performed using the dideoxy Sanger terminator method in an Applied Biosystem 373 DNA sequencer. Appropriate primers were synthesized at the Analytical Services of the Instituto de Parasitología y Biomedicina, Granada. General methods for DNA manipulation were as described (20).

Leishmania major genomic DNA cloning

A genomic L.major library was constructed in [lambda]EMBL3 (Stratagene) and packed with GigapackR III Gold Packaging Extract (Stratagene). Approximately 6 × 10⁵ p.f.u. were replica plated onto nitrocellulose and screened. An EcoRI fragment (1079 bp) from the partial cDNA of L.major was used as a probe for the screening. Five positive clones were isolated and one was selected for digestion mapping and analysis. After digestion with SalI, a 4.1 kb fragment was cloned in pBluescript KS(-) that contained, along with 3.6 kb of the 5[prime] upstream genomic region, 514 bp of the 5[prime] coding sequence of the L.major AP endonuclease gene. The genomic sequence was fully determined by the analysis of another 2.1 kb SalI fragment containing the remaining 827 bp of the 3[prime] region of the AP endonuclease gene together with 1273 bp of the 3[prime]-UTR and agreed with the one obtained by cDNA sequencing.

The sequence data reported in this paper have been deposited in the DDBJ/EMBL/GenBank databases under accession nos U92486 and U92487 for the tcap and lmap sequences respectively.

RT-PCR analysis

For mapping the splice acceptor site, cDNA was synthesized using as primer an oligonucleotide complementary to positions +516 to +535 of the tcap gene. The resulting cDNA was used as template in a first PCR using as primers the same oligonucleotide and a 23mer complementary to the 3[prime]-end of the splice leader sequence (23-SL) of T.cruzi. The reaction products were diluted and used as template in a second PCR reaction using as primers 23-SL and an oligonucleotide complementary to positions +258 to +277. Products were separated by gel electrophoresis and hybridized with tcap.

Construction of plasmids for expression in DNA repair-deficient E.coli

For expression and complementation studies in E.coli, the entire coding sequence of the T.cruzi gene (tcap) was amplified using the PCR technique and cloned in pKK223.3 (Pharmacia). Oligonucleotide primers for amplification of the AP endonuclease coding region, ATG-AP (TATGCCGTCGGGACCTAAG) and TGA-AP (ACGCGGATCCAAGCTTATCACCTGCGCAG) were synthesized. ATG-AP was designed so that blunt ends generated by the PCR reaction were ligated into the SmaI site of the vector. TGA-AP contained a HindIII restriction site. The tcap gene was inserted downstream of the tac promoter of pKK223.3 to give plasmid pKtcap. Double strand DNA sequencing was performed to confirm the correct sequence after amplification.

Complementation studies

Plasmids pBKlmap, pBKtcap and pKtcap were used to transform by electroporation the different E.coli expression hosts AB1157, BW286 and BW528. Bacteria were grown in LB containing 50 mg/l ampicillin and/or 50 mg/l kanamycin. pKK223.3 and a pBK-CMV derivative containing 1330 bp of a non-coding sequence were used as controls (pBKdv). The gradient plate assays were prepared basically according to Cunningham et al. (13). To 50 ml of molten (50°C) LB agar, agents were added. The medium was poured into 12 × 12 cm square Petri dishes elevated at one edge. After the agar hardened, the plate was leveled and overlaid with another 50 ml of molten LB agar without agents. Fresh stationary phase bacterial cultures were diluted to an OD₅₉₅ of 0.5. An aliquot of 40 µl of culture was diluted further in 2 ml of molten soft agar to 42°C and transferred to a microscope slide. Gradient plates were inoculated by dipping the edge of a warm microscope slide in the suspension and then touching the surface of the plate. Incubation was for 48 h at 28°C for BW286 cells and 24 h at 37°C for AB1157 and BW528. To visualize bacterial growth, plates were stained with an acridine orange solution and photographed under UV light. The average of at least three experiments using three independent transformants for each plasmid are shown in the figures. Standard deviations did not exceed 5% the average value.

The agents assayed were the alkylating agent MMS (Merck) and the chemical oxidants H₂O₂ and tBO₂H (t-butylhydroperoxide). The concentration of the agents distributed from bottom to top were: 0-12 mM MMS, 0-28 µM tBO₂H and 0-2 mM H₂O₂ for constructs using pBK-CMV and 0-6 mM MMS, 0-14 µM tBO₂H and 0-1 mM H₂O₂ for constructs performed using pKK223.3.

Expression and purification of recombinant protein

The lmap gene coding sequence was isolated by PCR and cloned into the NdeI and HindIII sites of pET28a (Novagen). The resulting plasmid, pETlmap, was sequenced in order to confirm that the correct reading frame was used, with the polyhistidine tail placed in the N-terminal position. This construct was used to transform the E.coli expression host BL21(DE3). The production of polyhistidine-LMAP fusion proteins was induced in mid logarithmic E.coli cultures grown in LB containing 50 µg/ml kanamycin by 0.4 mM isopropyl-1-thio-[beta]-d-galactoside. After 6 h of growth at 37°C, bacteria were pelleted by centrifugation, resuspended in 4 ml of 5 mM imidazole, 50 mM NaCl, 20 mM Tris-HCl, pH 7.9, buffer and sonicated. The soluble supernatant was applied to a nickel-chelated agarose affinity column and protein was purified as described by the manufacturer (Novagen).

Enzyme assays

An 800 bp fragment of a non-coding sequence from L.major was used as template for PCR amplification using dUTP instead of dTTP. This DNA was named U-DNA. Approximately 8 µg of GeneClean (Promega)-purified U-DNA was used as substrate for E.coli uracil-DNA glycosylase (1 U) (Boehringer Mannheim). Following phenol/chloroform extraction, the AP site-containing DNA was precipitated with cold ethanol. Aliquots of this abasic DNA were then incubated for 60 min at 37°C with purified recombinant polyhistidine-LMAP (1 µg) in buffer A (30 mM HEPES, 100 mM NaCl, 5 mM MgCl₂, 50 mM KCl, pH 7.4) and E.coli exonuclease III (0.02 U) in buffer B (30 mM HEPES, 200 mM NaCl, 5 mM MgCl₂, 50 mM KCl, pH 7.4) which inhibits 3[prime]->5[prime] exonuclease activity. U-DNA was also directly incubated under the same conditions with purified polyhistidine-LMAP or exonuclease III for use as negative controls. Similar reactions were performed using as substrate a DNA amplified by PCR with a normal mixture of dNTPs (T-DNA) and therefore with no potential AP sites. Samples were electrophoresed on 1.5% agarose gels, Southern blotted, hybridized using the initial 800 bp DNA as probe and analyzed by autoradiography.

Immunological techniques

Anti-LMAP antibodies were obtained by injection of rabbits with 300 µg of purified recombinant protein in 1 ml of complete Freund's adjuvant (Bacto). Antisera used in this study were collected 7 weeks after the initial injection. For immunoblotting, protein samples were transferred from SDS-PAGE gels to nitrocellulose membranes. Bound antibodies were detected using anti-rabbit antibodies coupled to alkaline phosphatase. The stains were visualized with p-nitrophenyl phosphate in diethanolamine buffer.

Isolation of the Leishmania major AP endonuclease gene

A L.major ZAP Express cDNA expression library was screened for complementation of dUTPase and exonuclease III deficiency in E.coli. The bacterial strain used for screening (BW286) contains both the dut-1 (dUTPase) and [Delta](xth-pncA)90 (exo-nuclease III) alleles which in combination are lethal on rich medium at 37°C (18). Of the plasmids isolated, one has been shown to encode a protein with dUTPase activity (20). Four of the remaining clones (which appeared to contain overlapping inserts) were selected and the complete nucleotide sequence of both strands of the longest cDNA insert was determined. The sequence established (pBKlmap) contained an open reading frame but sequences corresponding to the spliced leader (a 39 nt sequence added by trans-splicing) were not found at the 5[prime]-end. The sequence terminated with a 16 bp poly(A) tail at 997 bp from the stop codon. Codon usage studies and the absence of sequences characteristic of the 5[prime]-untranslated region (UTR) of other Leishmania genes suggested that the coding sequence was truncated at the 5[prime]-end. This was also the case of the remaining positive clones. Moreover, this observation raised the possibility that the gene was expressed as a fusion protein in BW286 cells and, as such, was capable of repair of AP sites. Indeed, when SDS gels of BW286 cells transformed with pBKlmap were analyzed, a band of 50 kDa was observed in transformed cells whose apparent molecular weight agreed with that of a protein resulting from the fusion of the predicted coding sequence to [beta]-galactosidase (Fig. 1A, lane 3). Further screening of a genomic library resulted in isolation of clones containing the complete AP endonuclease sequence for L.major. Of the 1341 bp identified as the structural sequence, the first 94 were absent in the cDNA sequence. Thus, the fusion protein complementing AP deficiency in BW286 cells lacked ~32 amino acids of the N-terminus. The ATG considered as initiation codon was selected on the basis of codon usage studies as well as homology analysis and comparison with the sequence isolated after screening the T.cruzi cDNA library as described below. The sequence predicts a protein of 48.6 kDa and a pI of 8.8 and its C-terminal region shows pronounced similarity with the major human/E.coli exonuclease III family of AP endonucleases (Fig. 2).

Figure 1. SDS-PAGE electrophoresis (A) and western blot analysis (B) of crude extracts from DNA repair-deficient E.coli (BW286 strain) expressing T.cruzi (pBKtcap) and L.major (pBKlmap) AP endonucleases fused to [beta]-galactosidase. Lane 1, BW286/pBKdv; lane 2, BW286/pBKtcap; lane 3, BW286/pBKlmap. Samples in (B) were made to react with LMAP antibodies and detection was performed as described in Materials and Methods.

Figure 2. Alignment of the LMAP and TCAP predicted amino acid sequence with human AP endonuclease HAP1 (21) and E.coli exonuclease III (EXO III) (22). The protein sequences were aligned using the Pileup program from the UWGCG sequence analysis software. The main residues involved in HAP1 and EXO III DNA interaction, metal binding and catalytic mechanism are shaded. Arrows point to the active site amino acids responsible for the activation of a molecule of water and the consequent nucleophilic attack on the phosphodiester bond (27,28). The probable nuclear localization signals are underlined.

Isolation of the Trypanosoma cruzi AP endonuclease gene

A similar strategy to the one used in the case of L.major was used for isolation of the T.cruzi AP endonuclease gene. Of the positive clones selected, one of them hybridized with the L.major AP endonuclease probe. Plasmid DNA was isolated and the insert fully sequenced. An ORF was identified that encoded a protein comprising 405 amino acids with a calculated M_r of 45.2 kDa and a pI of 10.1. The cDNA sequence starts with 4 bp identical to the 3[prime]-end of the splice leader sequence of T.cruzi and terminates with a 22 bp poly(A) tail. When SDS-polyacrylamide gels of BW286 cells transformed with pBKtcap were examined, a band of 49 kDa was observed that was not present in control cells transformed with pBKdv (Fig. 1A, lane 2). Hence, in the screening procedure tcap was apparently also expressed as a fusion protein although in this case, the [beta]-galactosidase domain was fused to a non-truncated version of T.cruzi AP endonuclease and a linker region of three amino acids corresponding to translation of the 5[prime]-UTR region was also introduced. RT-PCR was performed to fully establish the position of the splice acceptor site for tcap which was located 4 bp upstream of the translation initiation site previously established. Thus, the initiation codon is the first ATG identified 3[prime] downstream of the splice acceptor site.

The deduced amino acid sequences of the lmap and tcap genes were compared with other reported class II AP endonucleases to analyze structural relationships. Figure 2 shows an alignment with exonuclease III from E.coli and the human HAP1 gene.

Complementation studies

We have used the E.coli BW286 strain for complementation screening of the cDNA libraries. The dut mutants, which are deficient in dUTPase, incorporate large amounts of uracil into their DNA. The uracil is removed by uracil-DNA glycosylase, thereby generating apyrimidinic sites. Exonuclease III (xth) initiates the repair of AP sites in E.coli, so that the double mutant is non-viable at 37°C due to the accumulation of such unrepaired sites. The viability of BW286 was completely restored to wild-type by expression of TCAP and LMAP cDNAs as fusion proteins (pBKtcap and pBKlmap) (Fig. 1A) showing that the protozoan endonucleases are able to repair damage generated as a result of uracil misincorporation. Complementation of the temperature-dependent phenotype was even attained in the case of pBKlmap where the AP protein was a truncated version lacking 32 amino acids of the N-terminus and fused to [beta]-galactosidase.

Furthermore, both T.cruzi and L.major AP endonucleases overproduced as fusion proteins conferred significant resistance in BW286 cells to the mutagenic agents tBO₂H, H₂O₂ and MMS (Fig. 3, lanes 5 and 6). These experiments were performed at 28°C since control BW286 cells transformed with the pBK-CMV derivative (pBKdv) (Fig. 3, lane 4) are unable to grow at 37°C.

Figure 3. Complementation of the repair-deficient BW286 strain by pBKlmap and pBKtcap (Materials and Methods). Each bar represents the relative survival of cells in the presence of a linear gradient of the DNA damaging agents. The agar contained from the bottom to the top: (A) 0-28 µM tBO₂H; (B) 0-2 mM H₂O₂; (C) 0-12 mM MMS. Bars 1-6 in each panel represent the following strain/plasmid: 1, AB1157/pBKdv; 2, AB1157/pBKtcap; 3, AB1157/pBKlmap; 4, BW286/pBKdv; 5, BW286/pBKtcap; 6, BW286/pBKlmap. These experiments were carried out at 28°C.

Expression of the entire coding sequence of tcap in pKK223.3 (pKtcap) as an individual protein was also analyzed for its capacity to confer resistance. Thus, pKtcap was able to restore the viability at 37°C of BW286 cells (with a reversion efficiency of 73%, versus 0.3% using pKK223.3 as control) indicating that the protein was expressed to significant levels under control of the tac promoter. However, attempts to quantify levels of TCAP by western blot in BW286 or BW528 cells were unsuccessful suggesting that they are extremely low or it is unstable. The consequences of TCAP overexpression on the sensitivity of BW286 cells grown at 28°C to tBO₂H, H₂O₂ and MMS are shown in Figure 4. Trypanosoma cruzi AP endonuclease re-established resistance to MMS and peroxides to levels similar to wild-type cells. When studies were performed at 37°C (Fig. 5), pKtcap not only restored the viability of BW286 cells, but also conferred resistance to the alkylating and oxidizing agents assayed (Fig. 5A-C, lane 6) even though damage in cells at this temperature is extensive due to complete absence of dUTPase activity which leads to massive uracil misincorporation.

Figure 4. Resistance conferred by expression of TCAP in BW286 cells. (A) tBO₂H; (B) H₂O₂; (C) MMS. Lane 1, AB1157/pKK 223.3; lane 2, AB1157/pKtcap; lane 3, BW286/pKK 223.3; lane 4, BW286/pKtcap. The length of cell growth along the gradient is a measure of the strain resistance to the different agents. Petri dishes were incubated at 28°C.

Figure 5. Resistance to oxidant and alkylating agents conferred by expression of TCAP in xth^-nfo^- (BW528) and dut^-xth^- (BW286) mutant strains. Bars 1-6 in each panel represent: 1, AB1157/pKK 223.3; 2, AB1157/pKtcap; 3, BW528/pKK223.3; 4, BW528/pKtcap; 5, BW286/pKK223.3; 6, BW286/pKtcap. (A) 0-14 µM tBO₂H; (B) 0-1 mM H₂O₂; (C) 0-6 mM MMS. The complementation of the temperature-sensitive mutation of BW286 by tcap can be observed in lanes 5 (no growth) and 6. Petri dishes were incubated at 37°C.

The ability of TCAP to restore resistance to MMS and peroxides was further tested in the xth-nfo double mutant BW528 lacking both exonuclease III and endonuclease IV activity. No effect on the sensitivity to tBO₂H (Fig. 5A, lanes 3 and 4) and only marginal effects on the sensitivity to H₂O₂ (Fig. 5B, lanes 3 and 4) were found in this strain yet resistance to MMS (Fig. 5C, lanes 3 and 4) was similar to levels exhibited by AB1157 cells.

Purification of recombinant LMAP and antibody specificity

Overexpression of lmap as a his-tagged protein using the expression host E.coli BL21(DE3) is illustrated in Figure 6. Leishmania major AP endonuclease constituted ~20% of soluble cell protein obtained following sonication of BL21(DE3)/pETlmap cells. The affinity purification procedure based on polyhistidine-LMAP fusion protein production resulted in a homogeneous preparation judged by SDS-PAGE and Coomassie blue staining (Fig. 6A, lane 2). Antibodies raised against purified LMAP were examined by immunoblotting. Purified antiserum reacted specifically with the purified fractions of M_r 48 600, the size of the purified polypeptide (Fig. 6B). Immunoblots also revealed some additional cross-reactive polypeptides of lower M_r in cells transformed with pBKtcap and pBKlmap (Fig. 1B, lanes 1 and 2) suggesting possible protein degradation.

Figure 6. Purification of recombinant polyhistidine-LMAP. (A) SDS-PAGE. (B) Western blot of soluble extract from E.coli BL21(DE3)/pETlmap induced with IPTG and expressing polyhistidine-LMAP (1) and affinity-purified enzyme (2).

AP endonuclease activity assays

A defective DNA was prepared by using dUTP instead of dTTP in the amplification by PCR. AP sites were created after incubation with E.coli uracil-DNA glycosylase. The resulting DNAs are stable (Fig. 7A, lanes 1 and 2) and are not altered by incubation with either purified recombinant LMAP or E.coli exonuclease III (Fig. 7A, lanes 3 and 4). When the abasic DNA was further incubated with purified recombinant polyhistidine-LMAP or E.coli exonuclease III, DNA degradation was observed (Fig. 7A, lanes 5 and 6) due to hydrolysis of the AP sites. DNA containing dTTP remained unaltered after incubation with either enzyme (Fig. 7B).

DISCUSSION

We have isolated L.major and T.cruzi cDNAs, encoding cellular enzymes that attack AP sites in DNA. The predicted LMAP and TCAP polypeptides present, as described for other AP endo-nucleases, two well-differentiated domains. The protozoan C-terminal domains (considered as 319 amino acids for L.major and 301 amino acids for T.cruzi) are highly conserved between each other (60% identity) and more distantly related to prokaryotic AP endonucleases than to eukaryotic counterparts. Hence, there is a 38% identity of the L.major and 41% of the T.cruzi sequences with the HAP1 endonuclease of human cells (21,26), 37 and 39% of the L.major and T.cruzi endonucleases, respectively, with the Rrp1 Drosophila melanogaster homologous region (23), 42% identity of both protozoan sequences with AP endonuclease from Dictyostelium discoideum (24) and 30% identity of both sequences with exonuclease III of E.coli (22).

Invariant amino acids involved in catalysis or substrate binding are especially conserved (Fig. 2). Mol et al. (25) and Gorman et al. (26) proposed that the mechanism for the hydrolytic cleavage of the P-O3[prime] bond in the abasic site is a nucleophilic attack of the hydroxyl group for E.coli exonuclease III and human HAP1. The residues involved in this attack and in stabilization of the active site are entirely conserved in the protozoan deduced sequence. Amino acids believed to be important in the pocket which recognizes the AP site, those that bind to the scissile phosphate or residues that could participate in metal binding are all present in the T.cruzi and L.major AP endonucleases.

Likewise, similar to the D.melanogaster Rrp1 (23) and Arp from Arabidopsis thaliana (27) the protozoan enzymes have an extended and highly charged N-terminal domain. These N-termini, 128 residues in L.major and 104 in T.cruzi, share 37% identity and exhibit low similarities with the N-terminal domains of other eukaryotic AP endonucleases or with any other sequences in the available DNA databases. In addition, the lengths of the N-termini are intermediate between human HAP1 and D.melanogaster Rrp1 and contain probable nuclear localization signals KKSEK (amino acids 102-106, L.major) and RKTEK (amino acids 78-82, T.cruzi) which are closely related to consensus targeting sequences and are consistent with the nuclear localization of AP endonucleases (28).

Database searching revealed also that amino acids 27-105 in L.major and 1-84 in T.cruzi exhibit 22% identity with histone H1 of E.coli. It has been reported that the D.melanogaster Rrp1 AP endonuclease protein efficiently renatures homologous single-stranded DNA in vitro, a property that is associated with its unique N-terminal region. Likewise, a ssDNA renaturation activity for histone H1 has also been described (23). The existence of DNA binding or renaturing activity associated with the N-terminus of the protozoan enzymes and the possible role of these properties in endonuclease activity is yet to be established.

The non-viability of BW286 E.coli mutants at 37°C is due to the incapability of endonuclease IV (which represents only ~5% of total AP endonuclease activity) to repair the high level of AP sites (21). The fact that the L.major and T.cruzi proteins were able to restore complete viability at restrictive temperature and that the recombinant polyhistidine fusion protein was able to degrade a PCR-amplified DNA using dUTP in place of dTTP suggests that the protozoan enzymes are effective AP endonucleases with a capacity for AP site repair equivalent to that of exonuclease III.

We tested further the role of these enzymes in the resistance to different mutagenic agents: the alkylating agent MMS and the oxidative agents H₂O₂ and tBO₂H. MMS alkylates mainly purine nitrogens in DNA and generates AP sites via spontaneous and enzymatic hydrolysis of glycosidic bonds. In contrast, a much wider spectrum of lesions is generated by peroxides, including DNA strand breaks with 3[prime] fragmented deoxyribose groups (reviewed in 8,29). The expression of the protozoan proteins conferred resistance not only to MMS but also to oxidative agents in BW286 indicating that TCAP and LMAP proteins are active in the repair of AP sites and may participate in the repair of other oxygen radical-generated DNA lesions.

Figure 7. AP endonuclease assay. (A) DNA was amplified by PCR using dUTP in place of dTTP (U-DNA). (B) DNA was amplified with dTTP (T-DNA) and used as control. Lane 1, U-DNA (A) and T-DNA (B); lane 2, DNA treated with 1 µg of LMAP; lane 3, DNA treated with 0.02 U of E.coli exonuclease III; lane 4, DNA treated with 1 U of E.coli uracil-DNA glycosylase; lane 5, DNA treated with E.coli uracil-DNA glycosylase and then with 1 µg of LMAP; lane 6, DNA treated with E.coli uracil-DNA glycosylase and then with E.coli exonuclease III.

The expression of tcap in BW528 cells, that lack both exonuclease III and its backup enzyme endonuclease IV, gave only a slight increase in resistance to H₂O₂ and did not confer resistance to tBO₂H. Similar results were obtained when the expression of human HAP1 in E.coli nfo mutants was analyzed (28). Cunningham et al. (13) have demonstrated a requirement for endonuclease IV, but not exonuclease III for resistance to tBO₂H. Apparently, endonuclease IV has an important role in damage induced by tBO₂H and in its absence, only partial resistance is obtained. In contrast, lesions caused by H₂O₂ and MMS are repaired effectively by exonuclease III and to a lesser extent by Apn1, a yeast endonuclease homologous to endonuclease IV (30).

In summary, we have identified protozoan enzymes with AP endonuclease activity capable of conferring resistance to alkylating and oxidizing agents in E.coli hypersensitive mutants. This work constitutes the first report on enzymes involved in base excision repair in parasitic protozoa and provides information concerning the possible biological role of trypanosomatid AP endonucleases in DNA damage. Further studies will determine the contribution of the activity of TCAP and LMAP to base excision repair in general, as well as the importance of this pathway in defense against intracellular oxidative stress.

ACKNOWLEDGEMENTS

We are grateful to Dr Bernard Weiss for the E.coli mutant strains BW286 and BW528. These studies were supported by grants from the Spanish Programa Nacional de Investigación (BIO97-0659) and the Plan Andaluz de Investigación (CVI.199). J.P. was supported by a postdoctoral fellowship from the Spanish Ministerio de Educación y Ciencia. C.G. and V.B. are Predoctoral Fellows of the Ramón Areces Foundation. A.C. is a Predoctoral Fellow of the Plan Andaluz de Investigación.

REFERENCES

1. Halliwell,B. (1987) FASEB J., 1, 358-364. MEDLINE Abstract

2. Hutchinson,F. (1985) Prog. Nucleic Acid Res., 32, 115-154.

3. Lindahl,T., Sedgwick,B., Sekiguchi,M. and Nakabeppu,Y. (1988)Annu. Rev. Biochem., 57, 133-158. MEDLINE Abstract

4. Lindahl,T. and Nyberg,B. (1972) Biochemistry, 11, 3610-3618. MEDLINE Abstract

5. Wallace,S. (1988) Environ. Mol. Mutagen., 12, 431-477. MEDLINE Abstract

6. Sancar,A.and Sancar,G.B. (1988) Annu. Rev. Biochem., 57, 29-67. MEDLINE Abstract

7. Warner,H.R., Demple,B., Deutsch,W.A., Kane,C.M. and Linn,S. (1980) Proc. Natl Acad. Sci. USA, 77, 4602-4606. MEDLINE Abstract

8. Demple,B. and Harrison,L. (1994) Annu. Rev. Biochem., 63, 915-948. MEDLINE Abstract

9. Johnson,A.W. and Demple,B. (1988) J. Biol. Chem., 263, 18009-18016. MEDLINE Abstract

10. Johnson,A.W. and Demple,B. (1988) J. Biol. Chem., 263, 18917-18022.

11. Yajko,D.M. and Weiss,B. (1975) Proc. Natl Acad. Sci. USA, 72, 688-692. MEDLINE Abstract

12. Chan,E. and Weiss,B. (1987) Proc. Natl Acad. Sci. USA, 84, 3189-3193.

13. Cunningham,R.P., Saporito,S.M., Spitzer,S.G. and Weiss,B. (1986)J. Bacteriol., 168, 1120-112. MEDLINE Abstract

14. Docampo,R. and Moreno,S.N.J. (1984) Free-Radical Intermediates in the Antiparasitic Action of Drugs and Phagocytic Cells. In Pryor,W.A. (ed.), Free Radicals in Biology. Academic Press, New York. NY. pp. 243-288.

15. Docampo,R. and Moreno,S.N.J. (1984) Rev. Infect. Dis., 6, 223-238. MEDLINE Abstract

16. Docampo,R., (1990) Chem. Interact., 73, 1-27.

17. Goyal,N., Roy,U.and Rastogi,A.K. (1996) Free Radical Biol. Med., 21, 638-689.

18. Taylor,A.F. and Weiss,B. (1982) J. Bacteriol., 151, 351-357. MEDLINE Abstract

19. Camacho,A., Arrebola,R., Peña-Díaz,J., Ruiz-Pérez,L.M. and González-Pacanowska,D. (1997) Biochem. J., 325, 441-447. MEDLINE Abstract

20. Ausubel,F.M., Brent,R., Kingston,R.E., Moore,D.D., Seidman,J.G., Smith,J.A. and Struhl,K. (eds) (1995) Current Protocols in Molecular Biology. John Wiley & Sons, New York, NY.

21. Robson,C.N. and Hickson,I.D. (1991) Nucleic Acids Res., 20, 5519-5523. MEDLINE Abstract

22. Saporito,S., Smith-White,B.J. and Cunnigham,R.P. (1988) J. Bacteriol., 170, 4542-4547. MEDLINE Abstract

23. Sanders,M., Lowenhaupt,K. and Rich,A. (1991) Proc. Natl Acad. Sci. USA, 88, 6780-6784.

24. Freeland,T.M., Guyer,R.B., Ling,A.Z. and Deering,R.A. (1996)Nucleic Acids Res., 24, 1950-1953. MEDLINE Abstract

25. Mol,C.D., Kuo,C.F., Thayer,M.M., Cunningham,R.P. and Tainer,J.A. (1995) Nature, 374, 381-386. MEDLINE Abstract

26. Gorman,M.A., Morera,S., Rothwell,D.G., La Fortelle,E., Mol,C.D., Tainer,J.A., Hickson,I.D. and Freemont,P.S. (1997) EMBO J., 16, 6548-6558. MEDLINE Abstract

27. Babiychuk,E., Kushnir,S., Montagu,M.V. and Inze,D. (1994) Proc. Natl Acad. Sci. USA, 91, 3299-3303. MEDLINE Abstract

28. Demple,B., Herman,T. and Chen,D.S. (1991) Proc. Natl Acad. Sci. USA, 88, 11450-11454. MEDLINE Abstract

29. Lindahl,T. (1982) Annu. Rev. Biochem., 51, 61-87. MEDLINE Abstract

30. Ramotar,D., Popoff,S.C. and Demple,B. (1991) Mol. Microbiol., 5, 149-155. MEDLINE Abstract

---

*To whom correspondence should be addressed. Tel: +34 958 203802; Fax: +34 958 203323; Email: lmruiz@ipb.csic.es
⁺Present address: Departamento de Microbiología, Facultad de Farmacia, Campus Cartuja, Universidad de Granada, 18071 Granada, Spain

---

This page is run by Oxford University Press, Great Clarendon Street, Oxford OX2 6DP, as part of the OUP Journals
Comments and feedback: www-admin{at}oup.co.uk
Last modification: 15 Jan 1999
Copyright©Oxford University Press, 1999.
CiteULike    Connotea    Del.icio.us    What's this?

This article has been cited by other articles:

				E. A. Worthey, A. Schnaufer, I. S. Mian, K. Stuart, and R. Salavati Comparative analysis of editosome proteins in trypanosomatids Nucleic Acids Res., November 15, 2003; 31(22): 6392 - 6408. [Abstract] [Full Text] [PDF]

				S. Taladriz, T. Hanke, M. J. Ramiro, M. Garcia-Diaz, M. Garcia de Lacoba, L. Blanco, and V. Larraga Nuclear DNA polymerase beta from Leishmania infantum. Cloning, molecular analysis and developmental regulation Nucleic Acids Res., September 15, 2001; 29(18): 3822 - 3834. [Abstract] [Full Text] [PDF]

				M. E. Farez-Vidal, C. Gallego, L. M. Ruiz-Perez, and D. Gonzalez-Pacanowska Characterization of uracil-DNA glycosylase activity from Trypanosoma cruzi and its stimulation by AP endonuclease Nucleic Acids Res., April 1, 2001; 29(7): 1549 - 1555. [Abstract] [Full Text] [PDF]

This Article Abstract Print PDF (173K) Alert me when this article is cited Alert me if a correction is posted Services Email this article to a friend Similar articles in this journal Similar articles in ISI Web of Science Similar articles in PubMed Alert me to new issues of the journal Add to My Personal Archive Download to citation manager Search for citing articles in: ISI Web of Science (11) Request Permissions Commercial Re-use Guidelines for Open Access NAR Content Google Scholar Articles by Perez, J. Articles by Ruiz-Perez, L. M. Search for Related Content PubMed PubMed Citation Articles by Perez, J. Articles by Ruiz-Perez, L. M. Social Bookmarking          What's this?