| Nucleic Acids Research | Pages |
Biochemical properties of a high fidelity DNA ligase from Thermus species AK16D
Introduction
Materials And Methods
Reagents, media, strains and GenBank accession nos
Oligodeoxyribonucleotide synthesis
DNA amplification, cloning and sequence analysis
Expression and purification of Tsp. AK16D DNA ligase
Substrates and ligation assay
Steady-state kinetics
Results And Discussion
Sequence analysis of seven Thermus ligase genes
Cloning, expression and purification of DNA ligase from Tsp. AK16D
Salt, pH and NAD+ dependence of the ligation reaction
Effects of divalent metals on the ligation reaction
Steady-state kinetics
Ligation of gapped or inserted DNA duplex substrates
Thermus DNA ligase fidelity
Thermostable DNA ligase fidelity in the presence of Mn2+
Concluding remarks
Acknowledgements
References
Biochemical properties of a high fidelity DNA ligase from Thermus species AK16D
DDBJ/EMBL/GenBank accession nos AF092862-AF092868
ABSTRACT
INTRODUCTION
DNA ligases, as an essential component of DNA replication, recombination and repair systems found from viruses to humans, catalyze the formation of a phosphodiester bond at single-stranded breaks on duplex DNA (1). DNA ligases can be classified into two families based on cofactor dependence. ATP-dependent ligases are found in bacteriophages (2,3), Chlorella virus PBCV-1 (4), vaccinia virus (5), Archea (6,7), yeasts (8-10), mammals (11-13) and more recently eubacteria (14,15). NAD+-dependent ligases, however, are found exclusively in eubacteria. While some higher eukaryotic organisms may use multiple ATP-dependent ligases to fulfil diverse biological functions, some simple eubacteria genomes appear to encode both NAD+- and ATP-dependent ligases (15,16). The origin of the additional ATP-dependent ligases in these genomes remains to be determined.
Although the ATP-dependent ligases and NAD+-dependent ligases share little sequence homology, all the ligases investigated so far use the same KXDG motif to form adenylated enzyme intermediate (11,17,18) and, furthermore, they seem to be organized by a similar structural fold in the core of the ATP/NAD+-binding domain (19-22). The diversity of ligase sequences is not only reflected by their different optimal reaction conditions and kinetic rates, but more importantly by their different specificities toward matched and mismatched substrates. Among the viral ATP-dependent ligases, the broad substrate tolerance is represented by the T4 enzyme which seals various mismatches on both the 3[prime]- and 5[prime]-side of the nick junction (23). Vaccinia ligase ligates various mismatches at both the 3[prime]-hydroxyl and 5[prime]-phosphate sides with the exception of purine-purine mismatch pairs at the 3[prime]-hydroxyl side (5). Mammalian ATP-dependent ligases show different substrate sensitivity, as ligase I is more sensitive to 3[prime] mismatches than ligase III (24). Additionally, both ligase I and III tolerate a 3[prime]-C/T mismatch more than a 3[prime]-G/T mismatch. Little is known about archeal ATP-dependent ligases which may be the progenitor of eukaryotic ATP-dependent ligases. Studies on NAD+-dependent DNA ligase from Escherichia coli, along with T4 ligase, have contributed immensely to our understanding of the basic biochemical pathway of DNA ligation reaction (1,25). Studies on the NAD+-dependent ligase from Thermus thermophilus HB8 has revealed the high discriminative power this enzyme possesses (26). Although mismatches at the 5[prime]-phosphate side are tolerated to some degree (5[prime]-A/C, 5[prime]-A/A, 5[prime]-C/A, 5[prime]-C/T, 5[prime]-G/T, 5[prime]-G/A, 5[prime]-T/T and 5[prime]-T/G), mismatches at the 3[prime]-hydroxyl side essentially abolish nick-closure activity except 3[prime]-G/T and 3[prime]-T/G mismatches (26). Apparently, sequence divergence and subsequent subtle structural variation among DNA ligases underlie an enzyme's recognition preferences toward different mismatch base pairs.
The study of ligase biochemistry is not only important for understanding its biological functions, but also for developing new technologies. The single nucleotide discrimination observed on DNA ligases has led to the development of ligase-mediated detection techniques (23,27-31). Ligase-based linear signal amplification (Ligase Detection Reaction, LDR), combined with PCR-based gene-specific target amplification, has been proven to be a powerful tool in cancer and disease gene mutation detection (32,33). The PCR/LDR technique relies on two properties of a DNA ligase: specificity and thermostability. Tth DNA ligase has been successfully used in LDR and LCR due to its highly discriminative nick closure activity toward a perfect matched substrate and its thermostability which makes thermocycling possible (30,31). To date, one more ligase has been cloned and sequenced from Thermus scotoductus (34,35), but the substrate specificity of this ligase was not determined.
The sensitivity of LDR is dependent on the fidelity of the ligase. This work intends to explore the natural ligases from Thermus species collected worldwide and evaluate their sequence divergence and biochemical properties. We herein report the sequence analysis of seven Thermus DNA ligase genes, cloning and expression of a ligase from Thermus species AK16D and biochemical characterization of this high fidelity enzyme.
MATERIALS AND METHODS
Reagents, media, strains and GenBank accession nos
All routine chemical reagents were purchased from Sigma Chemical Corp. (St Louis, MO) or Fisher Scientific (Fair Lawn, NJ). Restriction enzymes and T4 DNA ligase were obtained from New England Biolabs (Beverly, MA). Oligonucleotide synthesis reagents, DNA sequencing kits and PCR kits were obtained from Applied Biosystems Division of Perkin Elmer Corp. (Foster City, CA). dNTPs, BSA and ATP were purchased from Boehringer-Mannheim (Indianapolis, IN). Pfu DNA polymerase was purchased from Stratagene (La Jolla, CA). Escherichia coli strain NovaBlue(DE3)pLysS and plasmid pET11c were purchased from Novagen Inc. (Madison, WI). The protein assay kit was from Bio-Rad (Hercules, CA). The HiTrap Blue affinity column was from Pharmacia (Piscataway, NJ). LB medium was prepared according to the standard formula (36). Sonication buffer consisted of 50 mM Tris-HCl, pH 8.0, and 1 mM EDTA. TE buffer consisted of 10 mM Tris-HCl, pH 8.0, and 1 mM EDTA. Stop solution consisted of 50 mM EDTA, 80% formamide and 1% Blue Dextran. Tth DNA ligase and its mutant K294R were purified as previously described (26). GenBank accession nos for Thermus ligases: Tsp. AK16D ligase gene, AF092862; Thermus aquaticus YT-1, AF092863; Tth HB8, 118780; Thermus flavus, AF092864; Thermus filiformis Tok4A2, AF092865; T.filiformis Tok6A1, AF092866; Tsp. SM32, AF092868; Tsp. Vil3, AF092867.
Oligodeoxyribonucleotide synthesis
Oligonucleotides were synthesized by using a 394 automated DNA synthesizer from Applied Biosystems Division of Perkin Elmer Corp. PCR and sequencing primers were purified by ethanol precipitation according to the instruction manual. The degenerate sense primer d[ATC(T/A)(C/G)CGACGC(C/G)GA-(G/A)TA(T/C)GA] corresponding to amino acids 32-38(ISDAEYD) in the T.thermophilus HB8 DNA ligase gene and antisense primers d[CC(C/G)GT(C/G)C(G/T)(G/C)CC(G/C)AC-(C/T)TG(A/G)AA] and d[GCCTTCTC(C/G/A)A(A/G)(T/C)-TTG(C/G)(A/T)(G/C)CC] corresponding to amino acids 333-339 (FQVGRTG) and 641-647 (GSKLEKA) were used to amplify DNA ligase gene fragments from Thermus strains. Additional PCR and sequencing primers were synthesized as required. The sequences of PCR amplification primers for cloning the Tsp. AK16D DNA ligase gene into pET11c vector were d(GCGATTTCATATGACCCTAGAGGAGGCCCG) and d(GCGGGATCCGAGGCCTTGGAGAAGCTCTT), where the NdeI and BamHI sites are underlined and the initiation codon in the forward primer is shown in bold. Oligonucleotide substrates for ligation assay were purified on a denaturing sequencing gel (7 M urea/10% polyacrylamide) (37). Phosphorylation at the 5[prime]-terminus of oligonucleotides was achieved during synthesis by using Chemical Phosphorylation Reagent (Glen Research, Sterling, VA). A fluorescent group was attached to the 3[prime]-terminus using a fluorescein CPG column (Glen Research).
DNA amplification, cloning and sequence analysis
Genomic DNAs from Thermus strains were isolated as previously described (38). PCR amplifications with degenerate and unique primers and inverse PCR on circularized templates were carried out in a GeneAmp PCR System 9700 thermocycler (Applied Biosystems Division of Perkin Elmer) as described (39). The nucleotide sequences of amplified ligase fragments were directly determined on an ABI 373 sequencer using an ABI PRISM[trade] Dye Terminator Cycle Sequencing Ready Reaction Kit (Perkin Elmer). Full-length Tsp. AK16D DNA ligase gene was amplified using PCR amplification primers as described above, digested with NdeI and BamHI, ligated into the cloning vector pET11c treated with the same pair of restriction enzymes and transformed into E.coli strain NovaBlue(DE3)pLysS. Inserts in pET expression vectors were sequenced in both orientations to ensure that the plasmid constructs were free of PCR or ligation error. Nucleic acid and protein sequence analyses were carried out by the Clustal method (40) using the MegAlign program of DNASTAR (Madison, WI).
Expression and purification of Tsp. AK16D DNA ligase
Escherichia coli NovaBlue(DE3)pLysS cells containing plasmid pTAK encoding the Tsp. AK16D DNA ligase gene from a pET11c construct was propagated overnight at 37°C in LB medium containing 50 µg/ml ampicillin, 25 µg/ml chloramphenicol and 0.2% glucose. Overnight cultures were diluted 100-fold into the same medium, grown until the optical density of the culture reached 0.5 at 600 nm, then induced by the addition of IPTG to a final concentration of 1 mM and grown for an additional 4 h under the same conditions. Cells were collected by centrifugation, frozen/thawed at -20/23°C, disrupted by sonication and clarified by centrifugation as previously described (39). The resulting supernatants were heated at 70°C for 15 min to denature thermolabile E.coli proteins, placed on ice for 30 min to aggregate the denatured proteins and cleared of denatured proteins by microcentrifugation for 15 min at 4°C. The partially pure DNA ligase was further purified by chromatography using 1 ml HiTrap Blue affinity column. Briefly, the column containing Tsp. AK16D DNA ligase was washed extensively with TE buffer (pH 7.8) containing 0.1 M NaOAc and the ligase was eluted with TE buffer (pH 7.8) containing 2 M NaCl. After dialysis against TE buffer (pH 8.0) containing 0.2 M KCl and concentration using Centricon-30 (Amicon), protein concentration was assayed by the Bradford method with reagents supplied in the Bio-Rad protein assay kit. The amount of protein was determined using BSA as the standard. Ligase purity was verified through 7.5% SDS-PAGE analysis followed by visualizing the overloaded gel with routine Coomassie Brilliant Blue R staining.
Substrates and ligation assay
The oligonucleotide perfect matched substrate was formed by annealing two short oligonucleotides (33mer for LP3[prime]C and 30mer for Com3F) with a 59mer complementary oligonucleotide (Glg). Oligonucleotides LP3[prime]C and Glg were in 1.5-fold excess so that all the 3[prime]-Fam-labeled Com3F represented nicked substrates (details in 26). The T/G mismatched substrate was formed by annealing LP3[prime]T, which introduced a single base pair mismatch at the 3[prime]-end of the nick junction, along with Com3[prime]F to the complementary strand (Glg). The nicked DNA duplex substrates were formed by denaturing DNA probes at 94°C for 2 min followed by re-annealing at 65°C for 2 min in ligation buffer. The sequences of the oligonucleotides are listed in Scheme 1 (p represents the 5[prime]-phosphate group).
Scheme 1. Ligation mixtures (20 µl) containing the indicated amount of DNA ligase and matched or mismatched substrate in the ligase buffer (20 mM Tris-HCl, pH 7.6 at room temperature, 10 mM MgCl2, 100 mM KCl, 10 mM dithiothreitol, 1 mM NAD+ and 20 µg/ml BSA) were incubated at 65°C for a predetermined time. Reactions were terminated by the addition of an equal volume of stop solution. Samples (5 µl) were separated by electrophoresis through an 8 M urea-10% polyacrylamide GeneScan gel according to the manufacturer's instruction manual (Applied Biosystems Division of Perkin Elmer). The unreacted substrates (30mer Com3F) and products (63mer) were quantified using GeneScan analysis software 672 v.2.0 (Applied Biosystems Division of Perkin Elmer). For initial rate measurement, the reaction mixture consisted of 12.5 nM nicked DNA duplex substrates and the indicated amout of DNA ligases in ligation reaction buffer. Aliquots of 5 µl from a 160 µl reaction mixture were removed at 0, 10, 20, 30, 40, 50 and 60 s for reactions containing matched substrates and at 0, 1, 2, 3, 4, 5 and 6 h for reactions containing mismatched substrates and mixed with 5 µl of stop solution. The results were plotted using DeltaGraph Pro3 software (DeltaPoint Inc., Monterey, CA). The initial rates were determined as the slope of linear range of the graph with the x-axis as the time and the y-axis as the amount of the ligation product generated. Figure 1. Sequence comparison of Thermus DNA ligases. (A) Evolutionary tree for Thermus DNA ligases. (B) Regional sequence alignment of nine Thermus ligases. The amino acid sequence of T.scotoductus is retrieved from GenBank by accession no. 1085749. The adenylation motif KXDG is underlined and the adenylation site is marked by *. The numbering of amino acids is based on Tsp. AK16D ligase. The complete sequence of Tsp. AK16D ligase and partial sequences of six other Thermus ligases have been deposited with GenBank under accession nos AF092862 for Tsp. AK16D ligase gene, AF092863 for T.aquaticus YT-1, 118780 for Tth HB8, AF092864 for T.flavus, AF092865 for T.filiformis Tok4A2, AF092866 for T.filiformis Tok6A1, AF092868 for Tsp. SM32 and AF092867 for Tsp. Vil3. Steady-state kinetic constants were determined by measuring initial rates of the ligation reaction at a given substrate concentration (nicked DNA duplex substrate concentration ranging from 25 to 400 nM) and a given ligase concentration (12.5 pM for both Tth and Tsp. AK16D) in 100 µl reaction volume at 65°C. A 5 µl aliquot was removed at 0, 2, 4, 6, 8 and 10 min and mixed with 5 µl of stop solution. The remaining substrate was separated from ligated product by GeneScan gel as described above. Initial rates of the ligation reactions were calculated from the generation of ligated product over time. The Km and kcat values were determined using Ultrafit (Biosoft, Ferguson, MO).
Steady-state kinetics
RESULTS AND DISCUSSION
Sequence analysis of seven Thermus ligase genes
Amino acid sequence alignment of five Gram-negative bacterial NAD+-dependent DNA ligases indicates that Tth ligase is 93% identical to T.scotoductus ligase, 49% to Rhodothermus marinus ligase, 48% to E.coli ligase and 38% to Zymomonas mobilis based on sequence data retrieved from GenBank. Degenerate primers corresponding to highly conserved regions of these ligases were used to amplify fragments of ligase genes from seven Thermus strains which represent a worldwide collection: T.flavus from Japan, T.aquaticus YT-1 and Thermus sp. AK16D from Yellowstone National Park in the USA, T.filiformis Tok4A2 and T.filiformis Tok6A1 from New Zealand, Thermus sp. SM32 from the Azores and Thermus sp. Vil3 from Portugal. The sequences of amplified ligase fragments ranging from 1.4 to 1.6 kb were determined by directly sequencing the PCR products using an ABI 373 automated sequencer. Thermus ligases, in general, were highly conserved during evolution as demonstrated by 85-98% sequence identity. In contrast, the amino acid sequences of the restriction endonuclease TaqI and its isoschizomers from the identical strains show only 50-70% amino acid identities (38). Thermus ligases in general show 30-40% sequence identities as compared with DNA ligases from other bacteria. The sequence divergence is slightly higher among the different geographic groups than within the same group, which may reflect random drift or adaptation to their respective local environments (Fig.
Cloning, expression and purification of DNA ligase from Tsp. AK16D
To maximize our chance of finding a Thermus ligase with novel properties, we chose Tsp. AK16D ligase which showed the least sequence identity as compared with T.thermophilus ligase. To obtain the complete sequence of the ORF, the fragments of the N- and C-terminus of the gene were amplified by inverse PCR and were subjected to direct sequencing. The complete ORF of the Thermus sp. AK16D ligase gene consists of 674 amino acids, as compared with 676 amino acids for Tth ligase (GenBank accession no. 118780) and 674 amino acids for T.scotoductus ligase (GenBank accession no. 1085749). The full-length Thermus sp. AK16D ligase gene was PCR amplified using Pfu polymerase and cloned into expression plasmid pET11c (Novagen). The integrity of the insert containing the ligase gene was verified by DNA sequencing. The pET11c plasmid expressing Tsp. AK16D ligase was transformed into competent E.coli cells NovaBlue(DE3)pLysS. Production of ligases was induced by adding IPTG to 1 mM final concentration. Tsp. AK16D ligase protein was expressed to ~10% of total cellular proteins. Heating at 70°C for 15 min denatured most of the E.coli proteins while leaving the thermostable ligases as the dominant band. Cibacron blue-based affinity chromatography (Pharmacia) further removed residual E.coli proteins and nucleic acids, yielding apparently homogenous Tsp. AK16D ligase protein as judged by Coomassie staining.
Figure 2. Divalent cation dependence of Thermus ligase activity. (A) Ligation reactions with different divalent ions as the metal cofactor. Striped bars, Tsp. AK16D ligase; solid bars, Tth ligase. Reaction mixtures (20 µl) containing 20 nM nicked duplex substrate, 0.5 nM Tth ligase or 1 nM Tsp. AK16D ligase, 20 mM Tris-HCl (pH 8.5), 100 mM KCl (50 mM for Tsp. AK16D ligase), 10 mM DTT, 1 mM NAD+ and 20 µg/ml BSA and 5 mM indicated divalent cation were incubated at 65°C for 60 min. (B) Chromatogram of a representative GeneScan gel illustrating ligation product and DNA adenylate intermediate. -, negative control reactions in which ligase was omitted. Co2+ may have caused precipitation of DNA substrate which resulted in disappearance of the unreacted substrate. Reaction mixtures (20 µl) containing 20 nM nicked duplex substrate, 1 nM Tth ligase or 2 nM Tsp. AK16D ligase and 5 mM indicated divalent cation were incubated at 65°C for 20 min with Mg2+ or Mn2+ as metal cofactor. Incubation time with other metal ions was extended to 90 min due to slow ligation rates. The pH dependence curves of Tth ligase and Tsp. AK16D ligase are essentially superimposable (data not shown). The optimal pH is 8.5 for both Tth ligase and Tsp. AK16D ligase with >80% activity observed between pH 7.8 and 9.5. The identity of the pH effect suggests that both of the ligases possess similar local environments at their catalytic centers, which is in agreement with the degree of sequence conservation between the two ligases. The optimum KCl concentrations for Tth ligase and Tsp. AK16D ligase are 100 and 50 mM, respectively. The optimum NAD+ concentration is 1 mM for both Tth ligase and Tsp. AK16D ligase. The similarity of the NAD profiles is in keeping with the highly conserved nature of the N-terminal domain of the ligases which is involved in NAD+ binding (22). Divalent metal ion is indispensable for each of the three steps in a ligation reaction: (i) adenylation of a lysine residue in the adenylation motif KXDG; (ii) transfer of the adenylate to the 5[prime]-phosphate to form a DNA-adenylate intermediate; (iii) formation of a phosphodiester bond with the release of adenosine monophosphate (AMP). In general, Mg2+ is the preferred metal ion for both ATP-dependent and NAD+-dependent ligases. We substituted Mg2+ with alkaline earth metal ion Ca2+ and commonly studied period 4 transition metal ions. Tth and Tsp. AK16D ligases could use Mn2+ as an alternative metal cofactor to support ligation activity (Fig. Figure 3. Time course of Tth (A) and Tsp. AK16D (B) ligase activity in the presence of Mg2+ (open square) or Mn2+ (closed square). Reactions were performed in 100 µl mixture as described in Figure 2 legend. Aliquots (5 µl) were removed at the indicated time and reactions stopped by adding an equal volume of stop solution. Divalent cation concentration dependence of Tth (C) and Tsp. AK16D (D) ligase activity. Mg2+, open square; Mn2+, closed square. Reactions were performed in 20 µl mixture containing 20 nM nicked duplex substrate, 0.5 nM Tth ligase or 1 nM Tsp. AK16D ligase and indicated concentrations of Mg2+ or Mn2+ at 65°C for 2 min. The steady-state kinetic constants were measured by monitoring the formation of fluorescently labeled ligation product over time using substrate concentrations spanning estimated Km values (Table 1). The steady-state properties of Tsp. AK16Dligase were similar to Tth ligase, indicating that the catalytic channels are highly conserved in Thermus ligases. The average Km value of ~90 nM for Thermus ligases is similar to the Km value of 50 nM for E.coli ligase (42) and ~10-fold higher than vaccinia virus ATP-dependent ligase (21). The average kcat value of ~45 turnovers/min for Thermus ligases is higher than the kcat value of 28 turnovers/min for E.coli ligase (42). Table 1. Gapped substrates were formed by deleting 1 or 2 nt from the 3[prime]-hydroxyl site of oligonucleotide LP3[prime]C and inserted substrates were formed by adding 1 or 2 nt at the 3[prime]-hydroxyl site of oligonucleotide LP3[prime]C (sequences in Materials and Methods). Gapped or inserted duplexed DNA sequences are distinctively different from normal nicked substrate. Under our experimental conditions, no ligation was detectable with 1 or 2 nt gapped or 2 nt insertion substrates for either Tth or Tsp. AK16D ligase. As for 1 nt insertion substrates, only an A insertion gave a trace amount of ligated products for both ligases. All other 1 nt insertions at the ligation junction could not be ligated. In contrast, H.influenzae ligase and Chlorella ligase demonstrate observable ligation with a 1 nt gap (4,14). In the case of vaccinia ligase, the ligation of a 1 nt gap is negligible but the formation of DNA-adenylate intermediate is significant, suggesting that the major impact of using 1 nt gapped substrate is on nick closure (5). We did not observe formation of DNA-adenylate intermediate with the Thermus enzymes, suggesting that most of the gapped or inserted substrates may have abolished the possibility of completing the second step in the ligation cycle, adenylation of DNA substrate at the 5[prime]-phosphate. Tth DNA ligase is more discriminative when the mismatch is located at the 3[prime]-side of the nick junction. 3[prime]-G/T or 3[prime]-T/G is the only mismatch that shows observable mismatch ligation (26). To evaluate the fidelity of the cloned Tsp. AK16D ligase, we compared the rate ratio of match over 3[prime]-T/G mismatch ligation with wild-type and K294R mutant Tth DNA ligases along with T4 ligase from a commercial source (Table 2). T4 ligase demonstrated high catalytic efficiency toward both matched and 3[prime]-T/G mismatched substrate such that a ligation fidelity of 50 was obtained. Thermus ligases appeared to be less efficient in match ligation as evidenced by the requirement for higher enzyme concentration to achieve comparable match ligation rate. However, under the same assay conditions, Thermus enzymes were far less prone to ligate a 3[prime]-T/G mismatch. As a result, the fidelity of Thermus enzymes was 17- to 126-fold higher than T4 ligase (Table 2, Ligation fidelity 1). The fidelity of the newly cloned Tsp. AK16D ligase was similar to K294R Tth mutant but 6-fold higher than the wild-type Tth enzyme. A DNA-adenylate intermediate was observed with 3[prime]-T/G mismatch ligation (data not shown), suggesting that a mismatch at the 3[prime] ligation junction imposes substantial constraints on the ability of Thermus ligases to close the nick, thereby limiting the turnover of DNA-adenylate intermediate into ligated product and free AMP (the third step of the ligation cycle). We further examined the effects of moving the T/G mismatch 1 bp away from the ligation junction. The rates of ligation with a T/G mismatch at the penultimate 3[prime]-end in general improved several-fold as compared with the T/G mismatch at the 3[prime]-end of the ligation junction. However, the ligation rates were still much slower than those of match ligation, emphasizing the importance of nucleotide complementarity near the ligation junction as well as the ultimate critical role of the perfect base pair at the 3[prime]-end in controlling the ligation reaction. Consequently, the ligation fidelity when the mismatch was at the second position from the 3[prime]-side (Table 2, Ligation fidelity 2) was lower than that when the mismatch was located immediately at the ligation junction. It is noteworthy that the Tsp. AK16D enzyme maintains extremely high fidelity (1.1 × 103) even when the mismatch is at the penultimate position, further underscoring the discriminative power of this new Thermus ligase. Many enzymes such as DNA polymerase and restriction endo-nucleases demonstrate relaxed specificity when Mn2+ was used as the metal cofactor. The influence of metal ion substitution on ligase fidelity has not been fully investigated although it is known Mn2+ can be used as an alternative metal cofactor for the ligation reaction (4,14; this work). We determined the reaction rates of the match and mismatch ligation for Tsp. AK16D ligase and Tth ligase. As shown in Table 3, the match ligation rates were higher with Mg2+ than with Mn2+ (Table 2), in agreement with the consistent high ligation rate under various Mg2+ conditions (Fig. Table 2. Table 3. Studies on Tth DNA ligase has deepened our understanding of thermostable ligases and has reaffirmed the common theme of ligation, adenylation of ligase at the KXDG motif (18). This study reveals that Thermus ligases may differ from each other as to substrate specificity despite their highly identical primary protein sequences. A highly homologous structure can be anticipated from various Thermus ligases, but subtle local environments may dictate the probability of accepting a particular mismatch as the substrate. The fidelity of the Thermus ligases may be determined by multiple domains, multiple motifs and/or multiple sequence elements. In a comparison of Tth and Tsp. AK16D ligases, one can find that although K294R (in an identical local environment; Fig.
Salt, pH and NAD+ dependence of the ligation reaction
Effects of divalent metals on the ligation reaction
Steady-state kinetics
Ligase
Km (nM)
kcat (per min)
kcat/Km (per M/s)
Tth
87
56
1.1 × 107
Tsp.AK16D
104
38
0.62 × 107
Ligation of gapped or inserted DNA duplex substrates
Thermus DNA ligase fidelity
Thermostable DNA ligase fidelity in the presence of Mn2+
Ligase
Enzyme concentration (nM)
Initial rates of C-G match (fmol/min)
Initial rates of T-G mismatch at 3[prime]-end (fmol/min)
Initial rates of T-G mismatch at penultimate 3[prime]-end (fmol/min)
Ligation fidelity 1b
Ligation fidelity 2c
T4
0.5
1.4 × 102
2.8
7.1
5.0 × 10
1.9 × 10
Tth-wt
1.25
5.5 × 10
6.5 × 10-2
2.9 × 10-1
8.4 × 102
1.9 × 102
Tth-K294R
12.5
1.5 × 102
2.3 × 10-2
4.3 × 10-1
6.3 × 103
3.4 × 102
Tsp.AK16D
12.5
1.3 × 102
2.5 × 10-2
1.2 × 10-1
5.1 × 103
1.1 × 103
C-G match at 3[prime]-end
T-G mismatch at 3[prime]-end
T-G mismatch at penultimate 3[prime]-end
--GTC p--F
--GTT p--F
--GTC p--F
--CAG--
--CAG--
--CGG--
bLigation fidelity 1, initial rate of C-G match/initial rate of T-G mismatch at the 3[prime]-end.
cLigation fidelity 2, initial rate of C-G match/initial rate of T-G mismatch at the penultimate 3[prime]-end.
The concentrations of DNA ligases used in each experiment are as indicated. Results were calculated as the average of at least two experiments.
Ligase
Concentration (nM)
Initial rate of C-G match (fmol/min)
Initial rate of T-G mismatch (fmol/min)
Ligation fidelity
Tth-wt
1.25
2.6 × 10
3.7 × 10-1
7.0 × 10
Tsp. AK16D
12.5
9.5 × 10
1.1 × 10-1
8.6 × 102
Concluding remarks
ACKNOWLEDGEMENTS
We thank Jing Lu for Thermus genomic DNA preparation and Jianying Luo and Marilyn Khanna for protein purification. We also thank Dr Dale B.Wigley for communicating results prior to publication. This work was supported by grants from the National Institutes of Health (GM-41337-09 and PO1-CA65930-02-04) and the Applied Biosystems Division of Perkin Elmer Corp.
REFERENCES
This article has been cited by other articles:
This page is run by Oxford University Press, Great Clarendon Street, Oxford OX2 6DP, as part of the OUP Journals
Comments and feedback: www-admin{at}oup.co.uk
Last modification: 15 Jan 1999
Copyright©Oxford University Press, 1999.
![]()
CiteULike
Connotea
Del.icio.us What's this?
![]()
![]()

![]()
![]()
![]()
J. Kim and M. Mrksich
Profiling the selectivity of DNA ligases in an array format with mass spectrometry
Nucleic Acids Res.,
October 23, 2009;
(2009)
gkp827v1.
[Abstract]
[Full Text]
[PDF]
![]()
![]()
![]()

![]()
![]()
![]()
S. Das, M. R. Pingle, J. Munoz-Jordan, M. S. Rundell, S. Rondini, K. Granger, G.-J. J. Chang, E. Kelly, E. G. Spier, D. Larone, et al.
Detection and Serotyping of Dengue Virus in Serum Samples by Multiplex Reverse Transcriptase PCR-Ligase Detection Reaction Assay
J. Clin. Microbiol.,
October 1, 2008;
46(10):
3276 - 3284.
[Abstract]
[Full Text]
[PDF]
![]()
![]()
![]()

![]()
![]()
![]()
M. R. Pingle, K. Granger, P. Feinberg, R. Shatsky, B. Sterling, M. Rundell, E. Spitzer, D. Larone, L. Golightly, and F. Barany
Multiplexed Identification of Blood-Borne Bacterial Pathogens by Use of a Novel 16S rRNA Gene PCR-Ligase Detection Reaction-Capillary Electrophoresis Assay
J. Clin. Microbiol.,
June 1, 2007;
45(6):
1927 - 1935.
[Abstract]
[Full Text]
[PDF]
![]()
![]()
![]()

![]()
![]()
![]()
H. Gao, J. Huang, F. Barany, and W. Cao
Switching base preferences of mismatch cleavage in endonuclease V: an improved method for scanning point mutations
Nucleic Acids Res.,
January 12, 2007;
35(1):
e2 - e2.
[Abstract]
[Full Text]
[PDF]
![]()
![]()
![]()

![]()
![]()
![]()
P. Langerak, A. O. H. Nygren, J. P. Schouten, and H. Jacobs
Rapid and quantitative detection of homologous and non-homologous recombination events using three oligonucleotide MLPA
Nucleic Acids Res.,
December 9, 2005;
33(22):
e188 - e188.
[Abstract]
[Full Text]
[PDF]
![]()
![]()
![]()

![]()
![]()
![]()
J. Li, X. Chu, Y. Liu, J.-H. Jiang, Z. He, Z. Zhang, G. Shen, and R.-Q. Yu
A colorimetric method for point mutation detection using high-fidelity DNA ligase
Nucleic Acids Res.,
October 27, 2005;
33(19):
e168 - e168.
[Abstract]
[Full Text]
[PDF]
![]()
![]()
![]()

![]()
![]()
![]()
B. Wang, S. J. Potter, Y. Lin, A. L. Cunningham, D. E. Dwyer, Y. Su, X. Ma, Y. Hou, and N. K. Saksena
Rapid and Sensitive Detection of Severe Acute Respiratory Syndrome Coronavirus by Rolling Circle Amplification
J. Clin. Microbiol.,
May 1, 2005;
43(5):
2339 - 2344.
[Abstract]
[Full Text]
[PDF]
![]()
![]()
![]()

![]()
![]()
![]()
H. Pincas, M. R. Pingle, J. Huang, K. Lao, P. B. Paty, A. M. Friedman, and F. Barany
High sensitivity EndoV mutation scanning through real-time ligase proofreading
Nucleic Acids Res.,
October 28, 2004;
32(19):
e148 - e148.
[Abstract]
[Full Text]
[PDF]
![]()
![]()
![]()

![]()
![]()
![]()
P. Liu, A. Burdzy, and L. C. Sowers
DNA ligases ensure fidelity by interrogating minor groove contacts
Nucleic Acids Res.,
August 24, 2004;
32(15):
4503 - 4511.
[Abstract]
[Full Text]
[PDF]
![]()
![]()
![]()

![]()
![]()
![]()
B. W. Kirk, M. Feinsod, R. Favis, R. M. Kliman, and F. Barany
Single nucleotide polymorphism seeking long term association with complex disease
Nucleic Acids Res.,
August 1, 2002;
30(15):
3295 - 3311.
[Abstract]
[Full Text]
[PDF]
![]()
![]()
![]()

![]()
![]()
![]()
J. P. Schouten, C. J. McElgunn, R. Waaijer, D. Zwijnenburg, F. Diepvens, and G. Pals
Relative quantification of 40 nucleic acid sequences by multiplex ligation-dependent probe amplification
Nucleic Acids Res.,
June 15, 2002;
30(12):
e57 - e57.
[Abstract]
[Full Text]
[PDF]
![]()
![]()
![]()

![]()
![]()
![]()
E. Lopez-Crapez, H. Bazin, E. Andre, J. Noletti, J. Grenier, and G. Mathis
A homogeneous europium cryptate-based assay for the diagnosis of mutations by time-resolved fluorescence resonance energy transfer
Nucleic Acids Res.,
July 15, 2001;
29(14):
e70 - e70.
[Abstract]
[Full Text]
[PDF]
![]()
![]()
![]()

![]()
![]()
![]()
S. M. Dong, G. Traverso, C. Johnson, L. Geng, R. Favis, K. Boynton, K. Hibi, S. N. Goodman, M. D'Allessio, P. Paty, et al.
Detecting Colorectal Cancer in Stool With the Use of Multiple Genetic Targets
J Natl Cancer Inst,
June 6, 2001;
93(11):
858 - 865.
[Abstract]
[Full Text]
[PDF]
![]()
![]()
![]()

![]()
![]()
![]()
M. Nilsson, D.-O. Antson, G. Barbany, and U. Landegren
RNA-templated DNA ligation for transcript analysis
Nucleic Acids Res.,
January 15, 2001;
29(2):
578 - 581.
[Abstract]
[Full Text]
[PDF]
![]()
![]()
![]()

![]()
![]()
![]()
V. Sriskanda, Z. Kelman, J. Hurwitz, and S. Shuman
Characterization of an ATP-dependent DNA ligase from the thermophilic archaeon Methanobacterium thermoautotrophicum
Nucleic Acids Res.,
June 1, 2000;
28(11):
2221 - 2228.
[Abstract]
[Full Text]
[PDF]
![]()
![]()
![]()

![]()
![]()
![]()
J. Tong, F. Barany, and W. Cao
Ligation reaction specificities of an NAD+-dependent DNA ligase from the hyperthermophile Aquifex aeolicus
Nucleic Acids Res.,
March 15, 2000;
28(6):
1447 - 1454.
[Abstract]
[Full Text]
[PDF]
![]()
![]()
![]()

![]()
![]()
![]()
J. N. Housby, S. H. Thorbjarnardottir, Z. O. Jonsson, and E. M. Southern
Optimised ligation of oligonucleotides by thermal ligases: comparison of Thermus scotoductus and Rhodothermus marinus DNA ligases to other thermophilic ligases
Nucleic Acids Res.,
February 1, 2000;
28(3):
e10 - e10.
[Abstract]
[Full Text]
[PDF]
![]()
This Article ![]()
![]()
Abstract
![]()
Print PDF (103K)
![]()
Alert me when this article is cited
![]()
Alert me if a correction is posted
![]()
Services ![]()
![]()
Email this article to a friend
![]()
Similar articles in this journal
![]()
Similar articles in ISI Web of Science
![]()
Similar articles in PubMed
![]()
Alert me to new issues of the journal
![]()
Add to My Personal Archive
![]()
Download to citation manager
![]()
Search for citing articles in:
ISI Web of Science (57)
![]()
Request Permissions ![]()
Commercial Re-use Guidelines
for Open Access NAR Content
![]()
Google Scholar ![]()
![]()
Articles by Tong, J.
![]()
Articles by Barany, F.
![]()
Search for Related Content
![]()
PubMed ![]()
![]()
PubMed Citation
![]()
Articles by Tong, J.
![]()
Articles by Barany, F.
![]()
Social Bookmarking ![]()
![]()
What's this?