| Nucleic Acids Research | Pages |
Human DNA helicase VIII: a DNA and RNA helicase corresponding to the G3BP protein, an element of the Ras transduction pathway
Introduction
Materials And Methods
Buffers
Preparation of DNA helicase substrates
Preparation of direction-specific substrates
Preparation of RNA/RNA and RNA/DNA substrates
DNA helicase assay
Affinity labelling with ATP
Results
Purification of HDH VIII
Reaction requirements and preferred substrates
Direction of unwinding
Microsequencing
Activity on DNA/RNA and RNA/RNA partial duplexes
Discussion
Acknowledgements
References
Human DNA helicase VIII: a DNA and RNA helicase corresponding to the G3BP protein, an element of the Ras transduction pathway
ABSTRACT
INTRODUCTION
DNA helicases play a crucial role in DNA replication, repair and recombination (1); similarly RNA/RNA and RNA/DNA helicases have been identified and found to be essential in such functions as transcription, translation and RNA splicing (2,3), processes requiring at least a transient unwinding of the nucleic acids to provide an appropriate substrate. More pertinently, as concerns the human species, hereditary defects in DNA helicases have been shown to be the cause of several genetic diseases characterised by pronounced impairment of some aspect of the DNA damage repair machinery (4). So far, thanks to the progress in the sequencing of the human genome, the helicase superfamily is expanding its putative members, mainly on the basis of the presence of the DEAD/H motif (5). In our laboratory we moved from a different perspective, namely the systematic study of human DNA helicases from a nuclear extract of HeLa cells, an approach which allows, in principle, the isolation of both the canonical (with DEAD/H box) (6,7) and the non-canonical ATP-dependent helicases by following the catalytic activity of the protein. This approach appears especially appropriate, considering that, since no specific functional description of the role of the so-called `helicase domains' has been obtained so far, there is no guarantee that they may represent specific recognition features for all duplex unwinding enzymes. In fact, in the course of our study, we have already identified two non-canonical helicases, namely human DNA helicases II and IV (HDH II and IV), which turned out to be respectively Ku (8) and nucleolin (9,10). Now, in the present report, we describe the identification and isolation of still another molecule that can unwind DNA and RNA partial duplexes in an ATP-dependent fashion, while lacking the canonical domains and presenting some similarity with the C-terminal portion of nucleolin; this molecule turned out to correspond to a protein identified in a different context and for which no evidence for helicase activity had been reported previously.
MATERIALS AND METHODS
Buffers
All the buffers used during the purification of HDH VIII contained 1 mM DTT, 1 mM sodium bisulfite, 0.5 mM PMSF, 1 µM pepstatin, 1 µM leupeptin. Buffer A contained 20 mM HEPES (pH 8.0), 0.1 mM NaCl, 1 mM EDTA and 20% glycerol. Buffer B contained 50 mM Tris-HCl (pH 8.0), 50 mM KCl, 1 mM EDTA and 10% glycerol. Buffer C was the same as buffer B but with 0.1 M KCl. Buffer D contained 50 mM Tris-HCl (pH 8.0), 50 mM KCl and 1 mM MgCl2. The buffer for Mono Q column contained 50 mM Tris-HCl (pH 8.0), 150 mM KCl, 1 mM EDTA and 10% glycerol.
Preparation of DNA helicase substrates
The DNA substrates used in the helicase assay consisted of four different 32P-labelled oligonucleotides annealed to M13mp19 phage single-stranded (ss) DNA to create a partial duplex. Substrate without hanging tails: GTAAAACGACGGCCAGT, complementary to nt 6291-6307 of M13mp19 ssDNA; substrate with the same oligonucleotide carrying a hanging tail of 15 T residues at its 5[prime] end; substrate with the same hanging tail at its 3[prime] end; substrate with hanging tails at both the 5[prime] and 3[prime] ends. Aliquots of 25 ng of each oligonucleotide, labelled at the 5[prime] end with T4 polynucleotide Kinase (Promega Corporation, Madison,WI) and 0.9 MBq of [[gamma]-32P]ATP (Amersham Life Sciences, UK), were subsequently annealed to M13mp19 phage ssDNA (4 µg) in 40 mM Tris-HCl (pH 8.0), 10 mM MgCl2, 1 mM DTT and 50 mM NaCl. The mixture was heated at 95°C for 2 min, and slowly cooled to room temperature. Each substrate was purified by gel filtration through a 5 ml Sepharose 4B column.
Preparation of direction-specific substrates
Two different substrates both based on M13mp19 were prepared to determine the direction of unwinding of HDH VIII. The substrate used to detect an enzyme with a 5[prime] to 3[prime] polarity was annealed to a 33mer oligonucleotide (CTCTAGAGGATCCCCGGGTACCGAGCTCGAATT) labelled at the 3[prime] end; the one used to detect an enzyme translocating in the 3[prime] to 5[prime] direction was annealed to a 5[prime] end-labelled 32mer oligonucleotide (CGACTCTAGAGGATCCCCGGGTACCGAGCTCG). Preparation of the latter substrate followed the procedure described in the previous paragraph, whereas for the substrate with the 3[prime] end label, 25 ng of oligo were first annealed to M13 ssDNA (4 µg) and then labelled by adding to the 3[prime]-OH end one 32P-labelled C residue with the DNA polymerase large fragment (New England Biolabs Inc., Beverly, MA). After slow cooling to room temperature the two substrates were each digested with SmaI restriction enzyme (Promega) to generate a linearised molecule carrying a labelled 18mer oligonucleotide annealed to either end of M13 DNA. The reaction mixture in each case was passed through a 5 ml Sepharose 4B column to remove unreacted nucleotides.
Preparation of RNA/RNA and RNA/DNA substrates
The RNA/RNA and RNA/DNA substrates were obtained as follows: pGEM vector (Promega) containing the Ku 70 gene (11) was linearised by EcoRI and transcribed in vitro with the SP6 RNA polymerase from the specific promoter yielding a 1.3 kb RNA. A 17 bp DNA or RNA oligonucleotide complementary to the same region of Ku 70 (nt 1840-1856 of the Ku sequence) was synthesised and labelled in the 5[prime] end by T4 polynucleotide Kinase (Promega) with 0.9 MBq [32P]ATP. A large excess of labelled oligonucleotide was mixed with 1 µM of synthesised Ku RNA, heated at 95°C for 2 min and allowed to anneal by slow cooling at room temperature. The substrates were then purified by gel filtration through a 5 ml Sepharose 4B column.
DNA helicase assay
The helicase assay measures the unwinding of a 32P-labelled DNA fragment from a partial duplex DNA molecule. The 10 µl reaction mixture contained 20 mM Tris-HCl (pH 9.0), 8 mM DTT, 2 mM MgCl2, 2 mM ATP, 10 mM KCl, 4% (w/v) sucrose, 80 µg/ml BSA and 32P-labelled helicase substrate (1000 c.p.m.). The helicase fraction to be assayed was added to the mixture, incubated at 37°C for 30 min and the reaction was terminated by the addition of 0.3% SDS, 10 mM EDTA, 5% glycerol and 0.1% Bromophenol Blue. The products of the reaction were fractionated by electrophoresis on a 12% non-denaturing polyacrylamide gel. The gel was dried and the extent of DNA unwinding was quantitated by electronic autoradiography (Instant Imager, Packard Corp., Meriden, CT). One unit of DNA helicase is defined as the amount of enzyme unwinding 1% of the substrate in 1 min at 37°C (30% in 30 min) in the linear range of enzyme concentration dependence.
Affinity labelling with ATP
Affinity labelling with [[alpha]-32P]ATP by UV cross-linking, to reveal ATP binding by helicase, was performed as already described (8). A negative control containing all components of the reaction mixture but not irradiated with UV light was included to monitor effective binding and cross-linking of the cofactor to the enzyme. After the SDS-PAGE analysis of both samples, the gel was washed for 18 h with 10% acetic acid to remove non-bound radioactivity and then dried and exposed for autoradiograhy.
RESULTS
Purification of HDH VIII
The nuclear extract was obtained from 300 g of frozen HeLa cells by the procedure described by Dignam et al. (12) and the proteins with helicase activity were purified following the protocol of Tuteja et al. up to Fraction IV (13). Briefly, HeLa nuclear extract was precipitated by slowly adding ammonium sulfate (0.35 g/ml) with constant stirring. The mixture was stirred for an additional hour and the precipitated proteins were collected by centrifugation at 25 000 g for 30 min in a Sorvall ss34 rotor, dialysed in buffer A (Fraction I) and applied onto a Bio-Rex column (2.5 cm diameter × 33 cm) equilibrated with buffer A. The column was washed with 3 column vol of buffer A and the non-adsorbed protein fractions containing helicase activity were pooled (Fraction II). This pool was again treated with ammonium sulfate as described above and the resulting pellet, after centrifugation, was resuspended and dialysed in buffer B (Fraction III). This fraction was loaded onto a 1.6 cm × 14 cm DEAE-Sephacel column equilibrated with buffer B. The column was then washed with 3 column vol of buffer B and eluted with a 5 column vol linear gradient between 0.05 and 0.65 M KCl. The active fractions were pooled (Fraction IV). Fraction IV was loaded onto a heparin Sepharose column (1.4 × 4 cm) equilibrated with buffer C. The column was washed with 3 column vol of buffer C and subsequently eluted with a 5 column vol linear gradient from 0.1 to 1 M KCl in buffer C. The active fractions were pooled and diluted to 0.15 M KCl in buffer B (Fraction V). Fraction V was loaded onto an ssDNA column (ssDNA-D8273 Sigma, 1.6 × 3cm) equilibrated in buffer D. The column was then washed with 3 vol of buffer D and subsequently eluted with 5 vol of a gradient between 0.15 and 0.6 M KCl. The protein fractions eluting around 0.4 M salt contained helicase VIII (Fraction VI), whereas the fractions eluting at lower and higher ionic strength contained other unwinding activities that will be object of future studies. Fraction VI was loaded onto an FPLC monoQ column (Pharmacia-LKB, Uppsala, Sweden) equilibrated with buffer B and the proteins were eluted with 10 column vol of a linear gradient from 0.15 to 1 M KCl; in the early fractions of the gradient two peaks of unwinding activity were visible that will also be the object of future investigations, whereas helicase VIII was eluted around 0.3 M KCl. The relevant fractions were pooled and concentrated by a second passage through the monoQ column (Fraction VII). The active fractions were analysed by SDS-PAGE and the silver-stained gel showed a prominent band of 68 kDa (Fig.
Figure 1. SDS-PAGE of the fractions at various stages of purification of HDH VIII. Fractions were separated by 10% gel and revealed by Coomassie staining (A) or by silver staining (B). (A) Lane 1, Mr markers; lane 2, 10 µg of HeLa nuclear extract; lane 3, 10 µg of Fraction IV; lane 4, 10 µg of Fraction V; lane 5, 20 µg of Fraction VI. (B) Lane 1, Mr markers; lane 2, 0.5 µg of Fraction VII. Table 1. No unwinding activity was detected in the absence of ATP or Mg2+ (Fig. Figure 2. Dependence of helicase activity on ATP (A) and MgCl2 (B). Helicase assays were carried out for 30 min at 37°C with 30 ng of pure HDH VIII and 1 ng of 32P-labelled tailless 17mer substrate as described in Materials and Methods. The ATP (3 mM) or MgCl2 (10 mM) concentrations correspond to the optimal ones. `Denatured' lanes show the substrate heated at 95°C for 5 min; the `Control' lanes are without enzyme (but with ATP and MgCl2). Figure 3. Affinity labelling with [[alpha]-32P]ATP by UV cross-linking. SDS-PAGE of 0.5 µg UV irradiated (+) and non-irradiated (-) HDH VIII. The band of interest is indicated by the arrow. DNA unwinding by HDH VIII was assayed with different types of substrates; the results summarised in Figure Figure 4. Helicase activity with various substrates. The helicase reaction was performed with 30 ng of pure HDH VIII. Each panel shows the structure of the substrate used and the % of unwinding observed. Asterisks denote the 32P-labelled end. In order to determine the polarity of unwinding of HDH VIII we prepared two different substrates (Fig. Approximately 20 µg of protein were loaded on SDS-PAGE and, after migration, the Coomassie stained slide of the gel containing the protein was eluted and the latter was trypsinised and fractionated on an HPLC column. The four fragments obtained were microsequenced at their N-terminal and the following results were obtained: TFSWASVTSK, HPDSHQLFIGNLPHEVDK, VLSNRPIMFR and GPPRGGMVQKPGFGVGRGLA. The data bank search showed a 100% correspondence with G3BP (GenBank accession no. U32519). As described by Parker et al. (14), this protein is a member of the heterogeneous nuclear RNA-binding proteins and is an element of the Ras signal transduction pathway (see below). This observation suggested the likelihood that the protein may in fact be endowed also with RNA duplex unwinding properties. The RNA/DNA and RNA/RNA substrates were obtained as indicated in Materials and Methods and tested in the same conditions as the DNA/DNA substrates. The results showed that HDH VIII can in fact unwind both RNA/DNA and RNA/RNA substrates with a comparable efficiency. HDH VIII (0.5 U) incubated with 1 ng of DNA/DNA, DNA/RNA or RNA/RNA substrates unwound 12, 7 and 10% respectively of the annealed oligonucleotide (Fig. The isolation, characterisation and sequencing of HDH VIII show that this is a protein with DNA and RNA helicase activity corresponding to the so-called G3BP, namely a 68 kDa protein encoded by a 3.3 kb mRNA, which had been previously isolated by Parker et al. (14) as an element of the Ras signal transduction pathway; G3BP is in fact a protein binding specifically to the SH3 (Src homology 3) domain of the Ras-GTPase activating protein (GAP) (15,16). Figure 5. Direction of unwinding by HDH VIII. The top of the panel shows the structure of the linear substrates used to detect the 3[prime] to 5[prime] (A) and 5[prime] to 3[prime] (B) directions of translocation. The bottom of each panel shows the autoradiographs of the relative gels. Lane 1, reaction without enzyme; lane 2, reaction with 30 ng of HDH VIII; lane 3, heat-denatured substrate. Figure 6. RNA/DNA and RNA/RNA unwinding activity of HDH IV and HDH VIII. The top of the panel shows the structures of the RNA/DNA (A) and RNA/RNA (B) substrates. The bottom of each panel shows the autoradiographs of the relative gels. Lane 1, heat-denatured substrate; lane 2, reaction with 30 ng of HDH IV; lane 3, reaction with 15 ng of HDH VIII; lane 4, control reaction without enzyme. At present, according to the mere amino acid sequence, 31 putative DNA helicases containing the canonical DEAD(H) box have been identified in human cells (17). On the other hand, the functional similarity in this group of proteins cannot be assumed purely on the basis of sequence homology and a direct biochemical demonstration of helicase activity remains essential. In fact, in the case of the HDH VIII sequence we do not observe the typical features of the helicases; we can observe instead the presence of an RNP2 and an RNP3 motif that are typical of the proteins belonging to the hnRNP superfamily (18), as well as of a 23 residue stretch of RGG boxes with a 75% identity with the gly-rich C-terminal of nucleolin, as follows (the letters in bold indicate the homology):
It has to be recalled, in this context, that in our laboratory we have shown that nucleolin is in fact a DNA and RNA helicase (HDH IV) and that its gly-rich C-terminal domain [previously shown to be endowed with RNA-helix-destabilizing properties (19,20)] is indeed the site of its ATP-dependent unwinding activity. Moreover, also the p68 RNA helicase (21,22), a DEAD box protein, contains an RGG-rich motif. Interestingly, this domain is often situated at the C-terminal of the protein, possibly a reflection of its functional role. Several proteins endowed with both DNA and RNA helicase activity are described in the literature, although certainly the RNA unwinding ability is not a universal property of DNA helicases, and vice versa; for example the SV40 T antigen (23), HDH I (13) and HDH IV (10) are all DNA and RNA helicases but several other human DNA helicases, like HDH II (8), HDH VI (24) or HDH VII (Ochem et al., submitted) are devoid of RNA unwinding capacity, whereas in the case of the p68 RNA helicase the DNA unwinding activity is controversial. HDH VIII is able to unwind with the same, albeit low, efficiency, in a strictly ATP-dependent fashion, DNA, DNA/RNA or RNA partial duplexes in which the annealed oligonucleotide need not have unannealed tails; the presence of an unannealed 3[prime] stretch approximately doubles the efficiency of unwinding. Several helicases, whether involved in replicative, repair or recombinative processes, show an analogous preference for fork-like structures. The enzyme is not stimulated by RPA (data not shown) and moves in the 5[prime] to 3[prime] direction. The unwinding reaction catalyzed by HDH VIII is observable in vitro only with short (17 bp) duplex DNA molecules whereas, as the length of the duplex DNA increases, the unwinding capacity decreases dramatically: the unwinding of partial DNA duplexes in which the annealed portion is 40 bp long is almost undetectable suggesting that, in vitro, HDH VIII is a non-processive enzyme. This result is not surprising in view of the possible role of HDH VIII in DNA and RNA metabolism. In fact, the identification of this molecule with G3BP implies that: (i) it is involved in the Ras signal transduction pathway, since it binds specifically (probably with its di-proline motif) to the SH3 motif of the Ras-specific GTPase-activating protein (GAP), a molecule playing an essential role in regulating the level of the proliferation-proficient form of Ras; (ii) its presence in GAP-bound form is strictly proliferation correlated; (iii) it presents, as mentioned above, strong similarity with the family of RNA binding and destabilizing proteins; (iv) it is mainly present in the cytoplasm, but its presence in the nucleus is also significant, since we have isolated it from a nuclear extract. Hence, in view of its RNA helicase activity, it can be speculatively envisaged as playing a function connecting RNAs to upstream signalling molecules like GAP. Since the SH3 motif of GAP appears to be essential for the Ras signal transduction, HDH VIII/G3BP could be a good candidate for linking some aspect of RNA metabolism to cell proliferation. Several hnRNP proteins (25) have been shown to shuttle between nucleus and cytoplasm (26) and these shuttling RNA-binding proteins have been proposed to act as a carriers of mRNA out of the nucleus, particularly in the so-called Ran pathway (27) that presents several similarities with the Ras one. Furthermore, the serine-phosphorylated form of G3BP has been reported recently (28) to be able to bind specifically to the 3[prime]-untranslated region of c-myc RNA, and to cleave it, whereas such capacity is nearly abolished in the non-phosphorylated form; the unwinding capacity reported here could conceivably represent a corollary of (or a prerequisite for) the initiation of such specific mRNA turnover. Alternatively, or additionally, one can speculate that the helicase activity could be useful in destabilizing and presenting the RNA to ribosomes and that the presence or absence of bound RNA could modulate the effect of G3BP/HDH VIII on GAP and thus on the activation of Ras. Conversely, it is not possible to establish at present whether the ability of HDH VIII to also unwind DNA has any functional significance or is merely a quirk of the structure of its active site. Further study on this protein will certainly be necessary to assign it a function in nucleic acid metabolism. The assistance of Ms Maria Elena Lopez for the preparation of HeLa cells is gratefully acknowledged. Drs Frédéric Coin and Jean-Marc Egly provided extremely valuable advice.
Reaction requirements and preferred substrates
Direction of unwinding
Microsequencing
Activity on DNA/RNA and RNA/RNA partial duplexes
DISCUSSION
Nucleolin 658
GRGGFGGRGGGRGG.RGGFGGRGR 682
G3BP 428
LRGPGGPRGGLGGGMRGP.PRGGM 450
ACKNOWLEDGEMENTS
REFERENCES
This article has been cited by other articles:
This page is run by Oxford University Press, Great Clarendon Street, Oxford OX2 6DP, as part of the OUP Journals
Comments and feedback: www-admin{at}oup.co.uk
Last modification: 15 Jan 1999
Copyright©Oxford University Press, 1999.
CiteULike 
Connotea 
Del.icio.us What's this?
D. Alex and K. A. W. Lee
RGG-boxes of the EWS oncoprotein repress a range of transcriptional activation domains
Nucleic Acids Res.,
March 2, 2005;
33(4):
1323 - 1331.
[Abstract]
[Full Text]
[PDF]
G. C. Katsafanas and B. Moss
Vaccinia Virus Intermediate Stage Transcription Is Complemented by Ras-GTPase-activating Protein SH3 Domain-binding Protein (G3BP) and Cytoplasmic Activation/Proliferation-associated Protein (p137) Individually or as a Heterodimer
J. Biol. Chem.,
December 10, 2004;
279(50):
52210 - 52217.
[Abstract]
[Full Text]
[PDF]
T. Kikuma, M. Ohtsu, T. Utsugi, S. Koga, K. Okuhara, T. Eki, F. Fujimori, and Y. Murakami
Dbp9p, a Member of the DEAD Box Protein Family, Exhibits DNA Helicase Activity
J. Biol. Chem.,
May 14, 2004;
279(20):
20692 - 20698.
[Abstract]
[Full Text]
[PDF]
S. Cui, R. Klima, A. Ochem, D. Arosio, A. Falaschi, and A. Vindigni
Characterization of the DNA-unwinding Activity of Human RECQ1, a Helicase Specifically Stimulated by Human Replication Protein A
J. Biol. Chem.,
January 10, 2003;
278(3):
1424 - 1432.
[Abstract]
[Full Text]
[PDF]
H.-J. Cho, H. G. Jeong, J.-S. Lee, E.-R. Woo, J.-W. Hyun, M.-H. Chung, and H. J. You
Oncogenic H-Ras Enhances DNA Repair through the Ras/Phosphatidylinositol 3-Kinase/Rac1 Pathway in NIH3T3 Cells. EVIDENCE FOR ASSOCIATION WITH REACTIVE OXYGEN SPECIES
J. Biol. Chem.,
May 24, 2002;
277(22):
19358 - 19366.
[Abstract]
[Full Text]
[PDF]
C. J. Barnes, F. Li, M. Mandal, Z. Yang, A. A. Sahin, and R. Kumar
Heregulin Induces Expression, ATPase Activity, and Nuclear Localization of G3BP, a Ras Signaling Component, in Human Breast Tumors
Cancer Res.,
March 1, 2002;
62(5):
1251 - 1255.
[Abstract]
[Full Text]
[PDF]
E. E. Biswas, R. G. Nagele, and S. Biswas
A novel human hexameric DNA helicase: expression, purification and characterization
Nucleic Acids Res.,
April 15, 2001;
29(8):
1733 - 1740.
[Abstract]
[Full Text]
[PDF]
A. Vindigni, A. Ochem, G. Triolo, and A. Falaschi
Identification of human DNA helicase V with the far upstream element-binding protein
Nucleic Acids Res.,
March 1, 2001;
29(5):
1061 - 1067.
[Abstract]
[Full Text]
[PDF]
M. Prigent, I. Barlat, H. Langen, and C. Dargemont
Ikappa Balpha and Ikappa Balpha /NF-kappa B Complexes Are Retained in the Cytoplasm through Interaction with a Novel Partner, RasGAP SH3-binding Protein 2
J. Biol. Chem.,
November 10, 2000;
275(46):
36441 - 36449.
[Abstract]
[Full Text]
[PDF]
C. J. Westmark and J. S. Malter
Up-regulation of Nucleolin mRNA and Protein in Peripheral Blood Mononuclear Cells by Extracellular-regulated Kinase
J. Biol. Chem.,
January 5, 2001;
276(2):
1119 - 1126.
[Abstract]
[Full Text]
[PDF]
This Article 
Abstract
Print PDF (174K)
Alert me when this article is cited
Alert me if a correction is posted
Services
Email this article to a friend
Similar articles in this journal
Similar articles in ISI Web of Science
Similar articles in PubMed
Alert me to new issues of the journal
Add to My Personal Archive
Download to citation manager
Search for citing articles in:
ISI Web of Science (24)
Request Permissions
Commercial Re-use Guidelines
for Open Access NAR Content
Google Scholar
Articles by Costa, M.
Articles by Falaschi, A.
Search for Related Content
PubMed
PubMed Citation
Articles by Costa, M.
Articles by Falaschi, A.
Social Bookmarking
What's this?