Skip Navigation

This Article
Right arrow Abstract Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (21)
Right arrowRequest Permissions
Right arrow Commercial Re-use Guidelines
for Open Access NAR Content
Google Scholar
Right arrow Articles by Marathias, V. M.
Right arrow Articles by Bolton, P. H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Marathias, V. M.
Right arrow Articles by Bolton, P. H.
Social Bookmarking
Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Nucleic Acids Research Pages 1854-1858  

Damage increases the flexibility of duplex DNA
Introduction
Materials And Methods
Results And Discussion
Acknowledgements
References

Damage increases the flexibility of duplex DNA

Damage increases the flexibility of duplex DNA

Vasilios M. Marathias, Bozidar Jerkovic and Philip H. Bolton*

Chemistry Department, Wesleyan University, Middletown, CT 06459, USA

Received January 7, 1999; Revised and Accepted March 1, 1999

ABSTRACT

It is proposed that much of the recognition of specific types of damaged DNAs is based on accessible structural features, while much of the recognition of damaged DNAs, as a class, is based on flexibility. The more flexible a DNA the faster its diffusion rate. The diffusion rates of each member of a series of damaged duplex DNAs has been found to be significantly faster than that of the corresponding undamaged duplex DNA. The damaged sites studied include apurinic and apyrimidinic abasic sites, thymine glycol and urea. The presence of mismatched sites also increases the diffusion. Thus, damaged DNAs appear to have sufficient flexibility for recognition and the flexibility may allow damaged sites to act as a universal joint or hinge that allows distant sites on the DNA to come together.

INTRODUCTION

The proteins that recognize and repair DNA damage are of considerable biological importance as are their complexes with damaged DNA. Cellular transformation can arise from a cell’s inability to recognize DNA damage and from the effects of unrepaired damaged sites on replication and transcription (1-11). The presence of damaged DNA can arrest the cell cycle leading to apoptosis (8,9,12-15). A number of tumor suppressor factors, including p53, are involved in cell cycle regulation (6,7,16-19).

DNA-protein complexes with bent DNA are known (20,21) and bending seems to be an approach well suited to the recognition of damaged DNA. The ease of bending damaged DNA, its flexibility, could be a common feature that might be used to recognize damaged DNA as schematically depicted in Figure 1. Duplex DNAs with sufficient flexibility would preferentially bind to recognition proteins. The bent DNA-protein complexes could then bind to additional proteins as shown in Figure 1. Alternatively, the binding of the first protein could enhance the formation of the complex of the DNA with a subsequent protein as XPG enhances the formation of damaged DNA complexes with hNth1 (22).

While bent DNA can only bring together properly positioned cis elements, a ‘universal joint’ has been proposed to allow bending of DNA in all directions and hence to provide a general mechanism for the association of distant sites regardless of position (23). A cis element of the human c-myc DNA, which is melted under in vivo conditions in association with a single-strand DNA binding protein, appears to form a universal joint which can promote association of sites distant in DNA sequence (23). Curvature of DNA only allows bringing together of precisely positioned elements of the proper helical phase. A universal joint or hinge can enhance the bringing together of sites that are separated at various distances and helical phases along the DNA. Flexible damaged sites may also act as universal joints or hinge points.

There is evidence that the recognition of DNA by some repair proteins involves local changes in the conformation of the DNA. The Escherichia coli Uvr nucleotide excision repair (NER) proteins can form a pre-incision complex with a range of damaged DNA sites apparently by inducing local strand separation (24,25). It appears that a dimer of the UvrA protein forms a transient complex with DNA and the UvrB protein in which the strands of the DNA are locally separated (26). The final complex only contains UvrB and DNA (26). Examination of the interactions of mammalian NER proteins with a range of large base adducts, such as acetylaminofluorene and benzo[a]pyrene, indicated that the recognition is based, at least in part, on the thermodynamic stability of the region near the damaged site (27). The specificity of global genome repair has been proposed to begin with the binding of XPC to NER lesions, followed by damage verification by XPA in a two step process (28). NER proteins do not recognize some deoxyribose C4[prime] modified residues or other deoxyribose adducts that do not affect the chemistry or stability of the bases, suggesting that structural disruption is the key to recognition of damaged DNAs by NER (29-31). Repair of compound mismatch sites, which have low stability, can be carried out by NER (32,33).

The high mobility group protein-1, HMG-1, seems to induce a structural change into damaged DNA, perhaps by bending, which is dependent on the local sequence context of the damaged DNA (34), that facilitates the interaction of the damaged DNA-HMG-1 complex with p53 (35). The repair proteins XPA, XPG and the UvrABC system appear to recognize small single-stranded regions, ‘bubbles’, caused by the presence of DNA damage (25,36-38). It has also been proposed that the transcription factor TF1, which is encoded by the Bacillus subtilis bacteriophage SPO1, uses DNA flexibility as a means of recognition and the observation that TF1 has higher affinity for DNA containing a mismatched site has been used to support this claim (39,40).


Figure 1. The top contains a schematic depiction of the bending of a DNA upon binding to a recognition protein. The bent DNA-protein complex can then bind to additional proteins or once the DNA is bent it can bind to other proteins without the recognition protein. The bottom contains drawings of the structures of the three types of damaged sites studied that are thymine glycol, urea and the abasic site.


All of this evidence is consistent with the use of the flexibility, or ease of bending, as a general or global means of recognizing damaged DNA. To assess the possible importance of DNA flexibility in recognition mechanisms, a means to experimentally monitor DNA flexibility is needed. Hydrodynamic theory predicts that the more flexible a DNA is the faster its diffusion will be, since a flexible rod will form, on average, a more compact structure in solution than a rigid rod of the same length. Diffusion rates can be directly measured by solution state NMR methods. Thus, the comparison of the diffusion rates of damaged and undamaged DNAs can offer information about the flexibility induced by DNA damage. Monitoring the difference in flexibility between damaged and undamaged duplex DNA, as a function of temperature, will give information about the free energy of the flexibility due to the presence of the damaged site.

The hydrodynamics of an undamaged duplex DNA can be modeled as a rigid rod with a diameter of 20 Å and a length of 3.4 Å per bp with an end-to-end bending amplitude of ~10° per 10 bp (41-47). The presence of a flexible site will increase the diffusion rate by decreasing the average effective length due to the presence of the larger end-to-end bending amplitude associated with the increased flexibility (42,44,48). For example, the introduction of a single-strand nick increases both the flexibility and the diffusion rates of DNA (49), and there is evidence that mismatched sites do so as well (40,50). The rate of cyclization of DNA has been used as a means to monitor the flexibility of DNAs, and this method has shown that three consecutive mismatched sites considerably enhance the cyclization rate and hence the flexibility of DNA (50). Thus, the comparison of the diffusion rates of different DNAs can be used to determine the flexibility differences between them.

A series of three related damaged sites: thymine glycol, urea, apurinic and apyrimidinic abasic sites, whose structures are shown in Figure 1, were studied in the same sequence context. A duplex with three consecutive mismatches was studied for its intrinsic interest and for comparison with the prior cyclization kinetics results on a DNA containing three consecutive mismatches (50). The comparison of the experimentally determined diffusion rates of the damaged and undamaged DNAs has allowed an assessment of the increase in flexibility due to the presence of various types of damaged sites.

MATERIALS AND METHODS

The DNA samples d(ACAGGACCGCGATACGCCGGAACGA), d(ACAGGACCGCGCCCCGCCGGAACGA), d(CGCGAATTCGCG) and d(TGTCCTGGCGCTATGCGGCCTTGCT) were obtained from Integrated DNA Technologies, Inc. (Coralville, IA). The d(CGCGAUACGCC), d(GCGCTATGCGG), d(CGCGATACGCC) and d(GCGCTCTGCGG) were obtained from DNAgency (Melvern, PA). All of the DNAs were purified by HPLC. The 25mer DNA samples were dissolved in solutions of 140 mM NaCl and 20 mM perdeuteriated Tris at pH 7.0. The 11mer DNAs were in 100 mM NaCl, 10 mM Na2HPO4 and 0.05 mM EDTA at pH 7.0. NMR and HPLC results on the samples showed no detectable impurities.

The DNA containing thymine glycol was prepared by oxidation of the parent single-stranded DNA with 0.02 M KMnO4 and subsequent purification as described previously (51,52). Urea containing DNA was prepared by alkaline hydrolysis of thymine glycol containing single-stranded DNA in 0.025 M sodium phosphate buffer at pH 13.0. The reaction was conducted by mixing 0.135 µmol (15 A260) of dry DNA with 1 ml of buffer. The reaction was allowed to run for 1 h at room temperature after which 1.35 ml of 0.2 M EDTA at pH 5.4 was added to quench the reaction. The reaction mixture was then desalted and the DNA purified by HPLC in the same manner as the thymine glycol containing DNA. The abasic site containing DNAs were prepared as described previously (53,54).

The NMR samples containing the 25mer DNAs contained 27 A260 of DNA in 500 µl of 140 mM NaCl and 20 mM perdeuteriated Tris buffer at pH 7.0. All of the other NMR samples consisted of 25-29 A260 of DNA in 500 µl of 100 mM NaCl, 10 mM Na2HPO4 and 0.05 mM EDTA at pH 7.0. One A260 is equivalent to an absorption of 1 at 260 nm with the sample in a 1 cm pathlength cell.

All NMR experiments were carried out on a Varian INOVA 500 MHz spectrometer using a Varian triple-resonance pulse field gradient probe with the samples at 25°C. NMR gradient calibration was conducted using a 1 cm high sample in 90% H2O and 10% 2H2O. Gradient strength calibration was conducted by obtaining a spin-echo FID of the sample with the gradient on during the acquisition period. The maximum gradient obtainable is 31 Gauss/cm. The largest error in the determination of the diffusion constants is in the calibration of the gradient field strength which is estimated to be ~5%.

The diffusion experiments were carried out using the PFG-STE (Pulsed Field Gradient STimulated Echo) experiment (55) shown in Figure 2 with [delta] = 4 ms and [Delta] = 250 ms. The strengths of the first and third gradient pulses were the same and the experiment was carried out with values of the gradient strength from 1 to 9.9 Gauss/cm. The strength of the gradient used to suppress transverse magnetization during the time [Delta] was 0.22 Gauss/cm. The diffusion constants, D, were obtained from the ratio of the intensity obtained with gradient strength G, IG, to that obtained with no gradient, I0, by use of IG/I0 = exp[-D[gamma]H2[delta]2G2([Delta] - [delta]/3)] (55). Plots of ln(IG/I0) versus G2 were fit by non-linear least squares to obtain the diffusion constants D. KaleidaGraph version 3.02 (Synergy Software) was used to graph the results and to carry out the non-linear least square fits. The correlation coefficients (56) were also calculated by the KaleidaGraph program.


Figure 2. The pulse sequence used for the PFG-STE experiment (55) is shown. The vertical lines on the proton channel line indicate proton 90° pulses and the rectangles on the gradient channel line indicate pulse field gradients. The diffusion constants, D, were obtained from the ratio of the intensity obtained with gradient intensity G, IG, to that obtained with no gradient, I0, by use ofIG/I0 = exp[-D[gamma]H2[delta]2G2([Delta] - [delta]/3)].

To demonstrate the methodology, the diffusion of undamaged, fully complementary duplex DNA was compared with that of a duplex containing three consecutive mismatches and to single-stranded DNA. It was expected that the presence of three consecutive mismatches would give rise to considerable flexibility of the DNA. The DNAs were 25 nt in length so that the sample containing the three mismatches in the middle would be stable. The diffusion constants of a 25mer fully complementary duplex, a 25mer duplex with three successive mismatches in the center and single-stranded 25mers were determined with the data shown in Figure 3.


Figure 3. The plots of ln (IG/I0) versus G2 are plotted for all of the samples examined here. The top panel contains the results for the 25mer duplex, mismatched and single-stranded samples. The two lower panels contain the results for the 11mer duplex, the 11mer duplexes with damaged sites and the 11mer single-stranded DNA.

The reproducibility of the approach was examined by carrying out five independent sets of experiments to determine the diffusion constant of the single-stranded 25mer with the central ATA sequence. The diffusion constants, in units of 10-6 cm2/s, from this series were determined to be 1.305, 1.299, 1.303, 1.301 and 1.307. These results have a mean value of 1.303 and a standard deviation of 0.0065.

The diffusion experiments have also been carried out on a series of 11mer duplex DNAs containing a single damaged site as well as the analogous undamaged duplex and a 25mer single-stranded DNA. The same sequence context containing a thymine glycol site, an abasic site opposite a dA, an abasic site opposite a dC, a urea site opposite a dA and a single-stranded DNA were used. The data used to obtain these diffusion constants are shown in Figure 3. The results obtained here for the undamaged 11mer and 25mer duplexes are in good agreement with those recently determined by the same experimental approach for 12mer and 24mer duplexes (41). For direct comparison we determined the diffusion constant of the duplex formed by the self-complementary Dickerson dodecamer, d(CGCGAATTCGCG), and found it to be 1.232 × 10-6 cm2/s, which is essentially the same as the 1.230 × 10-6 cm2/s determined previously (41). Taken together these results support the cylindrical hydrodynamic model for normal duplexes between 11 and 25 nt per strand.

RESULTS AND DISCUSSION

The flexibility of DNA induced by the presence of three consecutive mismatched sites has been previously studied by the examination of the rates of cyclization of DNA (50). Cyclization kinetics detects DNA flexibility in a manner that is more readily understood than the results of gel electrophoresis experiments (50). Diffusion also has a direct relationship to flexibility. In addition, the diffusion experiments can be carried out without altering the DNA and can be carried out on the same samples, under the same conditions that have been used for solution state structure determinations based on NMR methods (52-54,57,58). The experimental results shown in Figure 3 were used to determine the diffusion constants. The diffusion constant of the fully paired 25mer duplex was found to be 9.760 × 10-7 cm2/s with a correlation coefficient of 0.998, that of the analogous sample with three consecutive mismatches is 1.095 × 10-6 cm2/s with a correlation coefficient of 0.995, and that of the corresponding single-stranded DNA is 1.305 × 10-6 cm2/s with a correlation coefficient of 0.997. The increase in diffusion due to the presence of the mismatches is almost 40% of the difference between the duplex and single-stranded DNAs. These results of the diffusion experiments are qualitatively consistent with the cyclization results on a DNA containing three consecutive mismatches.

The diffusion constants of a series of 11mer duplex DNAs containing damaged sites in the center, in the same sequence context, have been determined as have those of the analogous undamaged duplex and an 11mer single-stranded DNA. The damaged sites include thymine glycol, urea and abasic sites whose structures are shown in Figure 1. The diffusion constant of the undamaged 11mer duplex was found to be 1.221 × 10-6 cm2/s with a correlation coefficient of 0.997, that of the duplex with a thymine glycol site opposite a dA 1.387 × 10-6 cm2/s with a correlation coefficient of 0.999, with a urea residue opposite a dA 1.242 × 10-6 cm2/s with a correlation coefficient of 0.998, with a dA residue opposite an abasic site 1.345 × 10-6 cm2/s with a correlation coefficient of 0.998, with a dC residue opposite an abasic site 1.268 × 10-6 cm2/s with a correlation coefficient of 0.996, and for a single-stranded 11mer 1.701 × 10-6 cm2/s with a correlation coefficient of 0.996. The diffusion constants were determined at 25°C which is more than 20° below the melting temperatures of any of these duplex samples.

The duplex with an abasic site opposite a dA has been found to have a structure more similar to that of undamaged DNA than the DNA with a dC opposite the abasic site (53). Combined, the two types of results indicate that the apurinic abasic site sample, dC opposite the abasic site, is both structurally more distorted and more flexible than the apyrimidinic sample with dA opposite the abasic site. The presence of a thymine glycol residue in duplex DNA perturbs the base stacking with the thymine glycol being partially extrahelical (52) and the structural results are consistent with the high level of flexibility observed for this sample. A structure determination of the urea containing DNA is nearly complete and the preliminary structure indicates that it is largely B-form with the structural distortions occurring near the damaged site.

The diffusion results show that the presence of mismatches or one of the damaged sites can considerably increase the flexibility of duplex DNA. The presence of a universal joint or hinge in a 25mer duplex will have a larger effect on the diffusion of the DNA than the same joint when placed in an 11mer duplex. This is due to the ratio of length to diameter being ~4.25 for an undamaged 25mer duplex but only ~1.9 for an 11mer duplex. The presence of a joint in a duplex of six residues would have little effect on the diffusion as the undamaged duplex has a length to diameter ratio of ~1. The damaged sites studied here can be placed within longer DNA duplexes, using methods already demonstrated (59), which will allow additional characterization of the flexibility induced by damaged sites.

The flexibility induced by these damaged and mismatched sites has been found to be 10-40% of the difference between undamaged duplex and single-stranded DNAs. This level of difference may be sufficient to allow the general or global recognition of damaged DNAs on the basis of their flexibility by DNA repair, cell cycle regulation and other biological systems. Recognition of the damaged DNAs on the basis of their flexibility will depend on the free energy associated with bending. This free energy can be determined by examination of the diffusion of the DNAs as a function of temperature and such experiments are planned. Information about the free energy associated with the extra flexibility may correlate with the recognition of the damaged DNAs by the general or global DNA damage recognition systems. The results on the quantification of the flexibility of damaged DNAs have the potential to guide studies on the mechanism of global or general recognition of damaged DNAs. Intercalation, single- and double-strand breaks and other modifications of DNA that may effect the flexibility and diffusion of duplex DNA can be studied by the methods presented here.

Stable curvature of DNA will reduce the end-to-end length of DNA and give rise to faster diffusion. Helical phasing can be used to distinguish between stable curvature and flexibility (20,60-63). The effects of curved elements will be additive when placed in a DNA when separated by an integral multiple of the helical repeat and cancel out when separated by an odd integral multiple of half of the helical repeat. Flexible elements will have additive effects no matter what the separation. This approach has been elegantly used to show that dA tracts curve DNA (20,60-63). Studies are planned to examine the diffusion of DNAs with damaged sites separated by various lengths to determine if there is any significant contribution from curvature to the enhanced diffusion of damaged DNAs. Studies on the comparison of the diffusion of DNAs curved by the presence of dA tracts are underway.

Our prior studies of the solution state structures of duplex DNAs containing damaged sites by NMR based methods have indicated that these have accessible structural features that can allow recognition of specific types of damaged DNA (52-54). As the temperature of the damaged DNA samples is raised, there will be more localized melting of the DNA near the damaged site which may be accompanied by more flexibility of the DNA, and the temperature dependence is now being examined. The bending of the damaged DNAs by proteins can increase the accessibility of structural features to aid the recognition of specific types of damaged DNA and this may be what is occurring in the case of XPG catalyzing the interaction of hNth1 with duplex DNA containing thymine glycol (22).

ACKNOWLEDGEMENTS

This research was supported, in part, by grant GM-51298 from the National Institutes of Health. The 500 MHz spectrometer was purchased with support from the National Science Foundation BIR-95-12478 and from the Camille and Henry Dreyfus Foundation.

REFERENCES

1. Friedberg,E.C., Walker,G.C. and Siede,W. (1995) DNA Repair and Mutagenesis. ASM, Washington, DC.

2. Griffin,S. (1996) Curr. Biol., 6, 497-499. MEDLINE Abstract

3. Jiricny,J. (1996) Cancer Surv., 28, 47-68. MEDLINE Abstract

4. Loft,S. and Poulsen,H.E. (1996) J. Mol. Med., 74, 297-312. MEDLINE Abstract

5. Loeb,L.A. (1996) Cancer Surv., 28, 329-342. MEDLINE Abstract

6. Sherr,C.J. (1996) Science, 274, 1672-1677. MEDLINE Abstract

7. Stillman,B. (1996) Science, 274, 1659-1664. MEDLINE Abstract

8. Nojima,H. (1997) Human Cell, 10, 221-230. MEDLINE Abstract

9. O'Connor,P.M. and Fan,S. (1996) Prog. Cell Cycle Res., 2, 165-173. MEDLINE Abstract

10. Weinert,T. (1998) Cell, 94, 555-558. MEDLINE Abstract

11. Weinert,T. (1998) Curr. Opin. Genet. Dev., 8, 185-193. MEDLINE Abstract

12. DiLeonardo,A., Linke,S.P., Clarkin,K. and Wahl,G.M. (1994) Genes Dev., 8, 2540-2551.

13. Hartwell,L.H. and Kastan,M.B. (1994) Science, 266, 1821-1827. MEDLINE Abstract

14. Muller,S.J. and Caradonna,S. (1993) J. Biol. Chem., 268, 1310-1319. MEDLINE Abstract

15. Strasser,A., Harris,A.W., Jacks,T. and Cory,S. (1994) Cell, 78, 329-339. MEDLINE Abstract

16. Nasmyth,K. (1996) Science, 274, 1643-1645. MEDLINE Abstract

17. Edgar,B.A. and Lehner,C.F. (1996) Science, 274, 1646-1652. MEDLINE Abstract

18. Elledge,S.J. (1996) Science, 274, 1664-1672. MEDLINE Abstract

19. King,R.W., Deshaies,R.J., Peters,J.-M. and Kirschner,M.W. (1996) Science, 274, 1652-1659. MEDLINE Abstract

20. Crothers,D.M. (1998) Proc. Natl Acad. Sci. USA, 95, 15163-15165. MEDLINE Abstract

21. Harrington,R.E. (1992) Mol. Microbiol., 6, 2549-2555. MEDLINE Abstract

22. Klungland,A., Hoss,M., Gunz,D., Constantinou,A., Clarkson,S.G., Doetsch,P.W., Bolton,P.H., Wood,R.D. and Lindahl,T. (1999)Mol. Cell, 3, 33-42.

23. Tomonaga,T., Michelotti,G.A., Libutti,D., Uy,A., Sauer,B. and Levens,D. (1998) Mol. Cell, 1, 759-764.

24. Gordienko,I. and Rupp,W.D. (1997) EMBO J., 16, 889-895. MEDLINE Abstract

25. Gordienko,I. and Rupp,W.D. (1997) EMBO J., 16, 880-888. MEDLINE Abstract

26. Freidberg,E.C., Walker,G.C. and Siede,W. (1995) DNA Repair and Mutagenesis. ASM Press, Washington, DC.

27. Gunz,D., Hess,M.T. and Naegeli,H. (1996) J. Biol. Chem., 271, 25089-25098. MEDLINE Abstract

28. Sugasawa,K., Ng,J.M., Masutani,C., Iwai,S., van der Spek,P.J., Eker,A.P., Hanaoka,F., Bootsma,D. and Hoeijmakers,J.H. (1998) Mol. Cell, 2, 223-232.

29. Hess,M.T., Schwitter,U., Petretta,M., Giese,B. and Naegeli,H. (1996) Chem. Biol., 3, 121-128. MEDLINE Abstract

30. Hess,M.T., Gunz,D. and Naegeli,H. (1996) Nucleic Acids Res., 24, 824-828. MEDLINE Abstract

31. Hess,M.T., Schwitter,U., Petretta,M., Giese,B. and Naegeli,H. (1997) Proc. Natl Acad. Sci. USA, 94, 6664-6669. MEDLINE Abstract

32. Mu,D., Hsu,D.S. and Sancar,A. (1996) J. Biol. Chem., 271, 8285-8294. MEDLINE Abstract

33. Mu,D., Tursun,M., Duckett,D.R., Drummond,J.T., Modrich,P. and Sancar,A. (1997) Mol. Cell. Biol., 17, 760-769. MEDLINE Abstract

34. Stos,M. (1998) J. Biol. Chem., 273, 10355.

35. Jayaraman,L., Moorthy,N.C., Murthy,K.G., Manley,J.L., Bustin,M. and Prives,C. (1998) Genes Dev., 12, 462-472. MEDLINE Abstract

36. Cleaver,J.E. and Layher,S.K. (1995) Cell, 80, 825-827. MEDLINE Abstract

37. Evans,E., Fellows,J., Coffer,A. and Wood,R.D. (1997) EMBO J., 16, 625-638. MEDLINE Abstract

38. Evans,E., Moggs,J.G., Hwang,J.R., Egly,J.M. and Wood,R.D. (1997) EMBO J., 16, 6559-6573. MEDLINE Abstract

39. Grove,A., Galeone,A., Mayol,L. and Geiduschek,E.P. (1996) J. Mol. Biol., 260, 120-125. MEDLINE Abstract

40. Grove,A., Galeone,A., Mayol,L. and Geiduschek,E.P. (1996) J. Mol. Biol., 260, 196-206. MEDLINE Abstract

41. Lapham,J., Rife,J.P., Moore,P.B. and Crothers,D.M. (1997) J. Biomol. NMR, 10, 255-262. MEDLINE Abstract

42. Huertas,M.L., Navarro,S., Lopez Martinez,M.C. and Garcia de la Torre,J. (1997) Biophys. J., 73, 3142-3153. MEDLINE Abstract

43. Garcia de la Torre,J., Navarro,S. and Lopez Martinez,M.C. (1994) Biophys. J., 66, 1573-1579. MEDLINE Abstract

44. Garcia De la Torre,J., Lopez Martinez,M.C. and Tirado,M.M. (1984) Macromolecules, 17, 2715-2722.

45. Garcia de la Torre,J., Lopez,M.C., Tirado,M.M. and Freire,J.J. (1983) Macromolecules, 16, 1121-1127.

46. Eimer,W., Williamson,J.R., Boxer,S.G. and Pecora,R. (1990) Biochemistry, 29, 799-811. MEDLINE Abstract

47. Eimer,W. and Pecora,R. (1991) J. Chem. Phys., 94, 2324-2329.

48. Small,E.W., Libertini,L.J. and Rudzki Small,J. (1988) Proc. SPIE-Int. Soc. Opt. Eng., 909, 97-107.

49. Fishman,D.M. and Patterson,G.D. (1996) Biopolymers, 38, 535-552. MEDLINE Abstract

50. Kahn,J.D., Yun,E. and Crothers,D.M. (1994) Nature, 368, 163-166. MEDLINE Abstract

51. Jerkovic,B., Kung,H.C. and Bolton,P.H. (1998) Anal. Biochem., 255, 90-94. MEDLINE Abstract

52. Kung,H.C. and Bolton,P.H. (1997) J. Biol. Chem., 272, 9227-9236. MEDLINE Abstract

53. Beger,R.D. and Bolton,P.H. (1998) J. Biol. Chem., 273, 15565-15573. MEDLINE Abstract

54. Wang,K.Y., Parker,S.A., Goljer,I. and Bolton,P.H. (1997) Biochemistry, 39, 11629-11639. MEDLINE Abstract

55. Tanner,J.E. (1970) J. Chem. Phys., 52, 2523-2526.

56. Acton,F.S. (1966) Analysis of Straight-Line Data. Dover, New York.

57. Kung,H.C., Wang,K.Y., Parker,S.A., Goljer,I. and Bolton,P.H. (1996) Magn. Reson. Chem., 34, S47-S54.

58. Goljer,I., Kumar,S. and Bolton,P.H. (1995) J. Biol. Chem., 270, 22980-22987. MEDLINE Abstract

59. McNulty,J.M., Jerkovic,B., Bolton,P.H. and Basu,A.K. (1998) Chem. Res. Toxicol., 11, 666-673. MEDLINE Abstract

60. Calladine,C.R. and Drew,H.R. (1996) J. Mol. Biol., 257, 479-485. MEDLINE Abstract

61. Harvey,S.C., Dlakic,M., Griffith,J., Harrington,R., Park,K., Sprous,D. and Zacharias,W. (1995) J. Biomol. Struct. Dyn., 13, 301-307. MEDLINE Abstract

62. Hagerman,P.J. (1990) Annu. Rev. Biochem., 59, 755-781. MEDLINE Abstract

63. Harrington,R.E. (1993) Electrophoresis, 14, 732-746. MEDLINE Abstract

*To whom correspondence should be addressed. Tel: +1 860 685 2668; Fax: +1 860 685 2211; Email: pbolton@wesleyan.edu

This page is run by Oxford University Press, Great Clarendon Street, Oxford OX2 6DP, as part of the OUP Journals
Comments and feedback: www-admin{at}oup.co.uk
Last modification: 26 Mar 1999
Copyright©Oxford University Press, 1999.
Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
 Molecular Cancer TherapeuticsHome page
N. F. Krynetskaia, M. S. Phadke, S. H. Jadhav, and E. Y. Krynetskiy
Chromatin-associated proteins HMGB1/2 and PDIA3 trigger cellular response to chemotherapy-induced DNA damage
Mol. Cancer Ther., April 1, 2009; 8(4): 864 - 872.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
B. O. Wittschieben, S. Iwai, and R. D. Wood
DDB1-DDB2 (Xeroderma Pigmentosum Group E) Protein Complex Recognizes a Cyclobutane Pyrimidine Dimer, Mismatches, Apurinic/Apyrimidinic Sites, and Compound Lesions in DNA
J. Biol. Chem., December 2, 2005; 280(48): 39982 - 39989.
[Abstract] [Full Text] [PDF]

Home page
 Nucleic Acids ResHome page
M. M. Somoza, D. Andreatta, C. J. Murphy, R. S. Coleman, and M. A. Berg
Effect of lesions on the dynamics of DNA on the picosecond and nanosecond timescales using a polarity sensitive probe
Nucleic Acids Res., May 6, 2004; 32(8): 2494 - 2507.
[Abstract] [Full Text] [PDF]

Home page
 Cancer Res.Home page
E. Y. Krynetski, N. F. Krynetskaia, M. E. Bianchi, and W. E. Evans
A Nuclear Protein Complex Containing High Mobility Group Proteins B1 and B2, Heat Shock Cognate Protein 70, ERp60, and Glyceraldehyde-3-Phosphate Dehydrogenase Is Involved in the Cytotoxic Response to DNA Modified by Incorporation of Anticancer Nucleoside Analogues
Cancer Res., January 1, 2003; 63(1): 100 - 106.
[Abstract] [Full Text] [PDF]

Home page
 Nucleic Acids ResHome page
S. T. Hoehn, C. J. Turner, and J. Stubbe
Solution structure of an oligonucleotide containing an abasic site: evidence for an unusual deoxyribose conformation
Nucleic Acids Res., August 15, 2001; 29(16): 3413 - 3423.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (21)
Right arrowRequest Permissions
Right arrow Commercial Re-use Guidelines
for Open Access NAR Content
Google Scholar
Right arrow Articles by Marathias, V. M.
Right arrow Articles by Bolton, P. H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Marathias, V. M.
Right arrow Articles by Bolton, P. H.
Social Bookmarking
Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?