| Nucleic Acids Research | Pages |
The Saccharomyces cerevisiae Sgs1 helicase efficiently unwinds G-G paired DNAs
Introduction
Materials And Methods
Formation of G-DNA and duplex DNA substrates
Methylation interference and protection
Helicase assays
Results
Formation of G-G paired DNA substrates
Sgs1p unwinds G4 DNA
Sgs1p unwinds G2[prime] DNA
G-G paired DNA is a better substrate for Sgs1p than duplex DNA
Discussion
Acknowledgements
References
The Saccharomyces cerevisiae Sgs1 helicase efficiently unwinds G-G paired DNAs
ABSTRACT
INTRODUCTION
The Saccharomyces cerevisiae SGS1 gene encodes a helicase that is essential for maintaining genomic stability. The protein product of SGS1, Sgs1p, localizes to the nucleus and is particularly concentrated within the nucleolus (1), where ribosomal DNA (rDNA) transcription and rRNA processing occur (2,3). Mutation of SGS1 results in defective chromosome segregation, and increased mitotic and illegitimate recombination (4-7). Consistent with the nucleolar localization of Sgs1p, SGS1 is critical to maintenance of the rDNA repeats. Sgs1-deficient cells are characterized by increased rDNA recombination (4,5) and accumulation of extrachromosomal rDNA circles containing one or more rDNA repeats (6).
Sgs1p belongs to a DNA helicase family of which the prototypical member is Escherichia coli RecQ (8, reviewed in 9,10). Among the other eukaryotic helicases in this family are Schizosaccharomyces pombe Rqh1p (11); the human BLM helicase, deficient in Blooms syndrome (12); and the human WRN helicase, deficient in Werners syndrome (13). Mutations in E.coli RecQ, S.pombe Rqh1, and the human WRN and BLM genes all result in hyperrecombination and genomic instability; and the human genetic diseases, Blooms syndrome and Werners syndrome, are associated with frequent development of malignancies (11,14-18). Like Sgs1p (1), WRN localizes to the nucleolus in rapidly dividing cells (19,20).
Sgs1p (21), BLM (22) and WRN (23-25) are all ATP-dependent helicases which unwind duplex DNA with 3[prime]-5[prime] directionality in vitro. The RecQ family helicases are to some extent functional homologs, as either BLM or WRN can suppress the hyper-recombination characteristic of Sgs1 mutant yeast (7). Moreover, yeast strains deficient in Sgs1p exhibit premature aging that may be analogous to the premature aging characteristic of the human genetic disease, Werners syndrome (1).
Eukaryotic cells contain a variety of helicases active on duplex DNA, RNA-DNA hybrids and RNA (reviewed in 26,27). It is of considerable interest to understand why, despite the presence of these many helicases, the RecQ family helicases are of such unique importance to genomic stability. Specific interactions with other proteins are likely to contribute to the critical functions of Sgs1p in genomic stability. The SGS1 gene was identified initially as an extragenic suppressor of the slow growth phenotype characteristic of yeast deficient in topoisomerase III, and the SGS1 protein product, Sgs1p, was shown to interact directly with topoisomerase III (4). Yeast strains deficient in top3 display pleiotropic effects including DNA hyperrecombination and chromosomal missegregation (4,28,). Sgs1p also interacts with topoisomerase II (29), a topoisomerase essential for faithful chromosome segregation during mitosis and meiosis (30,31).
Substrate specificity is also a critical determinant of helicase function. We have recently demonstrated that recombinant BLM helicase (rBLM) can unwind DNAs in which guanine-guanine (G-G) pairing stabilizes interstrand interactions (32). These experiments used as model substrates G4 DNA, in which G-G pairing stabilizes interactions between four DNA strands. The BLM helicase was shown to unwind G4 DNA 10-20-fold more efficiently than duplex substrates, as measured both in direct unwinding assays and in competition experiments. Furthermore, G-G paired substrates are not unwound by at least one other very potent helicase, E.coli RecBCD. These results suggested that G-G paired DNAs may be natural substrates of BLM and related helicases in vivo, and that failure to unwind G-G paired DNAs may cause or contribute to the genomic instability characteristic of cells deficient in RecQ family helicases.
We have now asked whether S.cerevisiae Sgs1p can unwind G-G paired DNA. We have studied the activity of recombinant protein (amino acid residues 400-1268; 21), which carries the central helicase domain that is highly conserved among RecQ family members. Here we report that, like the related BLM helicase, Sgs1p not only unwinds G-G paired DNA substrates but is considerably more active on G-G paired than on standard duplex substrates. We show that Sgs1p unwinds G-G paired structures formed from G-rich telomeric repeats, raising the possibility that impaired ability to disrupt telomere-telomere interactions may contribute to the chromosome non-disjunction characteristic of Sgs1 mutants. The S.cerevisiae rDNA consists of several hundred tandem repeats of a 1.3 kb transcription unit. The rDNA repeats are G-rich on the top (non-template) strand and therefore have considerable potential to form G-G paired structures. A critical role for Sgs1p in unwinding G-G paired rDNA may cause or contribute to the dramatic effect of mutation of SGS1 on rDNA stability, which results in premature aging (1,6). Analogous activity of the WRN helicase may contribute to accelerated aging characteristic of Werners syndrome.
MATERIALS AND METHODS
Formation of G-DNA and duplex DNA substrates
The following deoxyoligonucleotides were used in this study: Scc-T, AACTTGTGTGGGTGTGTGTGGGTGTGTGT; Scc, AACTTGTGTGGGTGTGTGTGGG; TP, TGGACCAGACCTAGCAGCTATGGGGGAGCTGGGGAAGGTGGGAATGTGA; OX-1T, ACTGTCGTACTTGATATTTTGGGGTTTTGGGGAATGTGA; OX-1, ACTGTCGTACTTGATATTTTGGGGTTTTGGGG; H1, GCATCGGCTTCCCAACTAGCTTTTTTTTTT; K1, TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTGCTAGTTGGGAAGCCGATGC.
Formation of G4 DNA and G2[prime] DNA from TP, OX-1 and OX-1T, and duplex DNA by annealing H1 and K1, was performed as described (32,33). Formation of G-G paired DNAs from Scc and Scc-T was carried out by incubating oligonucleotides at 2-3 mg/ml in TE (10 mM Tris-HCl, pH 7.4, 1 mM EDTA) containing 1 M NaCl for G4 DNA formation (34) or 1 M KCl for G2[prime] DNA formation (35) at 37°C for 48 h. After incubation, samples were diluted 1:5 with 10 mM Tris-HCl, pH 7.4, 1 mM EDTA, 12.5 mM KCl and 2.5% glycerol, and DNAs resolved on a 8% non-denaturing polyacrylamide gel (29:1 polyacrylamide:bisacrylamide) run in 0.5× TBE (50 mM Tris-borate, pH 8.2, 0.5 mM EDTA) containing 10 mM KCl at 4°C, at 5-8 V/cm. Bands corresponding to G4 DNA, G2[prime] DNA and single-stranded DNA (ssDNA) were identified according to their relative mobility by UV-shadowing or autoradiography and excised. DNAs were eluted from the crushed gel slices by soaking in TE containing 50 mM NaCl and 20 mM KCl at room temperature for 8-12 h, precipitated with ethanol, washed, and stored at -20°C. DNA was labeled as described (32), and G-G pairing was verified by assaying characteristic protection of the guanine N7 from methylation with dimethylsulfate (DMS) (36).
Methylation interference and protection
For methylation interference assays, 5[prime] end-labeled single-stranded oligonucleotides were methylated with DMS prior to G4 DNA formation. Samples were first heated at 94°C for 3 min, chilled on ice to ensure complete denaturation, then incubated with 0.1% DMS in buffer containing 50 mM sodium cacodylate, pH 7.0, 1 mM EDTA for 15 min at room temperature. DNA was ethanol precipitated, washed with ethanol, used to form G4 DNA and/or G2[prime] DNA as described above, purified, precipitated, resuspended in 100 µl of 1.0 M piperidine, heated at 90°C for 30 min, then lyophilized, washed with 25 µl deionized water twice, resuspended in formamide loading dye and resolved on a 16% polyacrylamide, 7 M urea denaturing gel. For methylation protection, gel-purified G4 DNA, G2[prime] DNA or ssDNA were treated with DMS and resolved by electrophoresis on an 8% acrylamide gel in 0.5× TBE, 10 mM KCl. Bands were excised and DNAs eluted, precipitated, and cleaved with 1.0 M piperidine at 90°C for 30 min. Samples were then resolved by 16% denaturing polyacrylamide gel electrophoresis.
Helicase assays
Truncated recombinant Sgs1 protein carrying the central conserved helicase domain (residues 400-1268 of the full-length 1447 residue polypeptide) was over-expressed in S.cerevisiae and purified as described (21). Helicase activity was assayed by monitoring unwinding of G-G paired or duplex DNA substrates to single-stranded oligonucleotides. Reactions were carried out in buffer containing 50 mM Tris-HCl, pH 7.4, 2 mM MgCl2, 2 mM ATP, 50 mM NaCl and 100 µg/ml BSA at 37°C for 20 min (unless otherwise indicated), terminated by addition of SDS/proteinase K to final concentrations of 0.5% and 0.5 mg/ml, respectively, and incubated at 37°C for 15 min longer. Samples were resolved on 8% non-denaturing-polyacrylamide gels in 0.5× TBE, 10 mM KCl. Gels were dried and exposed for autoradiography or scanned and quantitated by a phosphoimager. For assays of unwinding kinetics, DNA was equilibrated in the reaction buffer at 37°C for 10 min, and the reaction was initiated by addition of Sgs1p and terminated by addition of EDTA to a final concentration of 10 mM. The quantities of Sgs1p and DNA in each experiment are specified in the figure legends.
RESULTS
Formation of G-G paired DNA substrates
Guanine-guanine interactions (37) can promote the association of DNA or RNA strands which contain runs of three or more consecutive guanine residues (34,36,38). The structures that can be produced by G-G pairing are distinguished by strand stoichiometry, strand orientation and conformation of glycosidic bonds, and include four-stranded parallel G4 DNA or antiparallel two-stranded G2[prime] DNA (Fig.
Figure 1. G-G paired DNAs. (A) Guanine residues interact via Hoogsteen pairing to form a G-quartet, a cyclic planar array (left); strand association mediated by G-G pairing is further stabilized by stacking of G-quartets (right). (B) G-G paired DNA as four-stranded parallel G4 DNA (left) and as an antiparallel hairpin dimer, G2[prime] DNA (right). (C) Methylation interference analysis of 32P-labeled G4 DNA formed from oligonucleotides Scc and Scc-T (left); methylation protection of G2[prime] DNA prepared from oligonucleotides Scc and Scc-T (center); and methylation protection of G4 DNA and G2[prime] DNA prepared from oligonucleotide OX-1T (right). The guanine residues involved in G-G Hoogsteen pairing are bracketed. To ask if Sgs1p can unwind G-G paired DNA, purified Sgs1p was incubated with G4 DNA formed from the Scc-T oligonucleotide, which carries TG1-3 repeats like those found in S.cerevisiae telomeres (reviewed in 40), and unwinding was monitored by non-denaturing polyacrylamide gel electrophoresis. Figure Figure 2. Unwinding of G4 DNA by Sgs1p. (A) Kinetics of G4 DNA unwinding. 32P-labeled G4 DNA formed from the Scc-T oligonucleotide (100 nM) was incubated with Sgs1p (8 nM) for the times indicated, and samples resolved on an 8% non-denaturing gel (inset). The graph shows the fraction of G4 DNA unwound at each time. Mobilities of G4 DNA and ssDNA are indicated in each panel. (B) Sgs1p-dependence of G4 DNA unwinding. 32P-labeled G4 DNA (100 nM) formed from the Scc-T or Scc oligonucleotides was incubated with the indicated amount of Sgs1p and products analyzed by gel electrophoresis. (C) G4 DNA unwinding activity requires Mg2+ and ATP. 32P-labeled G4 DNA (100 nM) formed from the Scc-T oligonucleotide was incubated with Sgs1p (8 nM) in the presence or absence of 2 mM ATP, 2 mM ATP[gamma]S or 2 mM Mg2+, as indicated. (D) 3[prime]-5[prime] helicase activity of Sgs1p on G4-DNA substrates. Unwinding assays of Sgs1p (0.4 nM) on 32P-labeled G4 DNA substrates (2.5 nM) prepared from oligonucleotides TP, OX-1T and OX-1. Sgs1p is a 3[prime] to 5[prime] DNA helicase that requires a short 3[prime] single-stranded region to function on duplex DNA (21). We compared unwinding of two G4 DNA substrates, one formed from Scc-T, which has a 7 nt 3[prime] tail, and the other formed from Scc, which has a blunt 3[prime] end. The tailed substrate, G4 -Scc-T, was completely unwound during 20 min incubation with Sgs1p at a 1:100 molar ratio of Sgs1p helicase to G4 DNA, while there was no unwinding of the blunt substrate G4-Scc even at 40-fold higher enzyme:DNA ratios (Fig. Both Mg2+ and ATP were required for G4 DNA unwinding, and the non-hydrolyzable ATP analog, ATP[gamma]S, did not support the unwinding reaction (Fig. We also assayed unwinding activity of Sgs1p on several additional G4 DNAs, G4-TP, G4-OX-1T and G4-OX-1. Both OX-1T and OX-1 carry two repeats of T4G4, the telomeric sequence of the ciliate, Oxytricha. G4 DNA formed from either will have a 5[prime] single-stranded region, but only G4-OX-1T will have a free 3[prime] single-stranded tail. Sgs1p unwinds G4-TP and G4-OX-1T, but not G4-OX-1, which lacks a 3[prime] tail (Fig. When G-G paired DNA is formed in the presence of K+ rather than Na+ as the major monovalent cation, the predominant products are hairpin dimers in which the two strands are antiparallel, referred to as G2[prime] DNA (33,34,41) (Fig. Figure 3. Unwinding of G2[prime] DNA by Sgs1p. (A) Kinetics of G2[prime] DNA unwinding. 32P-labeled G2[prime] DNA prepared from the OX-1T oligonucleotide (50 nM) was incubated with Sgs1p (4 nM) for the times indicated, and samples resolved on an 8% non-denaturing gel (inset). The graph shows the fraction of G2[prime] DNA unwound at each time. Mobilities of G4 DNA, G2[prime] DNA and ssDNA are indicated in each panel. (B) Sgs1p-dependence of G2[prime] DNA unwinding. 32P-labeled G2[prime] DNAs prepared from oligonucleotides OX-1T (20 nM) or OX-1 (2.5 nM) were incubated with the indicated amount of Sgs1p and products analyzed by gel electrophoresis. (C) Unwinding requires Mg2+ and ATP. 32P-labeled G2[prime] DNA prepared from the OX-1T oligonucleotide (10 nM) was incubated with Sgs1p (4 nM) in the presence or absence of 2 mM ATP, 2 mM ATP[gamma]S or 2 mM Mg2+, as indicated. A species that migrates between G4 DNA and G2[prime] DNA on the gel is indicated by an asterisk. Kinetic analysis of Sgs1p unwinding of G2[prime] DNA substrates formed from oligonucleotide OX-1T showed that the fraction of G2[prime] DNA unwound increased linearly with time, and complete unwinding was evident by 7 min (Fig. We compared Sgs1p unwinding of G-G paired DNA and standard Watson-Crick duplex DNA in both direct assays and competition experiments, using as substrate a synthetic duplex fork with single-stranded 3[prime] and 5[prime] tails generated by annealing oligonucleotides H1 and K1. Sgs1p did not completely unwind the fork substrate, even at protein:DNA ratios greater than 1:1 (Fig. Figure 4. Sgs1p preferentially unwinds G4 DNA. (A) Sgs1p activity on duplex DNA substrate. 32P-labeled H1/K1 duplex fork DNA substrate (2.5 nM) was incubated with the indicated amount of Sgs1p and products analyzed by gel electrophoresis. Mobilities of the duplex fork substrate and the single-stranded unwinding product are indicated at the left. (B) Competition assay of unwinding of 32P-labeled G4 DNA formed from the TP oligonucleotide in the presence of unlabeled G4-TP or H1/K1 duplex. Unwinding products were resolved by gel electrophoresis, the fraction of unwound substrate quantitated by phosphoimager and graphed as percentage of maximal unwinding. (C) Competition assay of unwinding of 32P-labeled H1/K1 duplex fork DNA substrate in the presence of unlabeled G4-TP or H1/K1 duplex. Quantification as in (B). We have shown that purified recombinant Sgs1p helicase unwinds G-G paired DNA. Like Sgs1p unwinding of duplex DNA (21), Sgs1p unwinding of G-G paired DNA requires a 3[prime] single-stranded tail and is dependent upon the presence of Mg2+ and ATP in the reaction. Strikingly, Sgs1p unwinds G-G paired substrates at least 10-fold more efficiently than it unwinds duplex substrates. This suggests that G-G paired DNAs may be natural targets for the Sgs1p helicase in vivo. Enzymes of the RecQ helicase family have drawn considerable attention because they play key roles in maintaining genomic stability (8-10). SGS1 appears to be the only RecQ family gene in S.cerevisiae. Other RecQ family helicases that have been identified in eukaryotic cells include S.pombe Rqh1 and the human BLM and WRN helicases (11-13). These proteins share seven conserved helicase motifs but differ in their C- and N-termini (9,10). There appears to be unusual conservation of function within this gene family, because either BLM or WRNcan suppress the hyperrecombination phenotype of yeast Sgs1mutants (7). The Sgs1p preparation used in these experiments was a truncated fragment containing amino acids 400-1268 of the wild-type 1447 residue polypeptide (21). We used truncated Sgs1p in part because it is difficult to purify intact, full-length Sgs1p at yields useful for detailed biochemical analysis. In addition, we have recently shown that, like Sgs1p, recombinant human BLM helicase preferentially unwinds G-G paired DNAs (32). These results raised the question of whether ability to unwind G-G paired DNAs might be a general property of the eukaryotic RecQ helicases. Truncated Sgs1p contains the central conserved helicase domains. As truncated Sgs1p and full-length rBLM behave similarly in unwinding G-G paired DNA substrates, the determinants necessary for recognition and unwinding of G-G paired DNA therefore reside within the central region containing the helicase domains. This central region is highly conserved among RecQ family helicases, so it is likely that other helicases of this family, including the WRN helicase deficient in Werners syndrome, will prove to unwind G-G paired substrates. Formation of alternative, non-Watson-Crick structures is thought to contribute to genomic instability in the expansions of triplet repeats that can lead to a variety of neurological deficiencies (42 and citations therein). G-rich DNA has an analogous potential to form alternative structures stabilized by G-G pairing during cellular processes that unwind the DNA duplex, including transcription, recombination or replication. ssDNAs which contain runs of three or more consecutive guanine residues readily self-associate in vitro to form structures stabilized by G-G pairing (33,34,38,43-46). That G-G interactions occur spontaneously in solution was first established nearly 40 years ago, when concentrated solutions of GMP were found to form a gel upon storage at 4°C (47). For the experiments described in this manuscript, high yields of G4 DNA were produced by incubation of synthetic oligonucleotides at 60°C for 48 h, but synthetic oligonucleotides form G4 DNA spontaneously under normal storage conditions; typically, preparations of synthetic oligonucleotides which have G runs in their sequences will contain a few percent G4 DNA. G-G paired structures are very stable once formed. For example, the Tm of the TP oligonucleotide as duplex DNA is <75°C, while the Tm of G4-TP is >90°C (34). Preferential unwinding of a G4 DNA substrate is therefore unlikely to reflect relative thermodynamic stabilities of G4 and duplex DNA. Although G-G paired DNA has not been directly observed in vivo, one reason may be that cells contain helicases, such as Sgs1p and BLM, which are very active on G-G paired substrates. In yeast, two chromosomal domains are notably G-rich, the telomeres and the rDNA. (In mammalian cells, the immunoglobulin heavy chain switch regions comprise a third G-rich chromosomal domain.) We suggest that formation of G-G paired structures may cause or contribute to the genomic instability and hyperrecombination phenotypes characteristic of cells lacking RecQ family helicases. Mechanisms by which this may occur in S.cerevisiae are outlined in Figure Figure 5. A model for formation of G-G paired DNA structures in rDNA and telomeres. (A) Telomeres. In essentially all eukaryotic chromosomes, the G-rich strand of the telomere extends to form a short 3[prime] tail which is the primer for telomerase. Intermolecular G-G pairing could result in chromosomal non-disjunction. (B) rDNA. The eukaryotic rDNA contains one G-rich strand, which has the potential to form non-Watson-Crick structures stabilized by G-G pairing. The figure shows how such structure might form during rDNA replication (above) or transcription (below). Open and closed circles denote guanines. Diagrams of G-G paired structures show for simplicity interactions involving guanines that are closely spaced. Formation of G-G paired structures in vivo could involve DNA spanning hundreds of nucleotides or more. Essentially all eukaryotic telomeric repeats contain one G-rich strand which extends to form a short tail at the 3[prime] end of telomere and which primes telomere extension by telomerase (reviewed in 48-52). Intermolecular G-G pairing between the 3[prime] tails of different telomeres may result in chromosomal non-disjunction in the absence of an appropriate unwinding activity (Fig. The rDNA of essentially all eukaryotes is G-rich on the non-template strand and has considerable potential for G-G pairing. In S.cerevisiae, mutation of SGS1 destabilizes the rDNA repeats (1,4,5), which results in premature aging (6). While the complementary strand in the Watson-Crick duplex would normally protect the G-rich strand from intrastrand G-G pairing, the duplex is transiently denatured during replication and transcription (Fig. RecQ family helicases are highly conserved within the helicase domain. The human WRN helicase, which is a member of this family, localizes to the nucleolus in rapidly dividing cells (19,20). Our observations that both BLM (32) and Sgs1 actively unwind G-G paired DNAs raise the interesting possibility that impaired G-G unwinding activity of WRN helicase could contribute to or cause the accelerated aging characteristic of Werners syndrome. This research was supported by NIH P01 CA16038 (N.M.) and fellowships from the Damon Runyon-Walter Winchell Foundation and the Human Frontier Science Program (to R.J.B).
Sgs1p unwinds G4 DNA
Sgs1p unwinds G2[prime] DNA
G-G paired DNA is a better substrate for Sgs1p than duplex DNA
DISCUSSION
ACKNOWLEDGEMENTS
REFERENCES
This article has been cited by other articles:
This page is run by Oxford University Press, Great Clarendon Street, Oxford OX2 6DP, as part of the OUP Journals
Comments and feedback: jnl.info{at}oup.co.uk
Last modification: 10 Apr 1999
Copyright©Oxford University Press, 1999.
![]()
CiteULike
Connotea
Del.icio.us What's this?
![]()
![]()

![]()
![]()
![]()
A. N. Lane, J. B. Chaires, R. D. Gray, and J. O. Trent
Stability and kinetics of G-quadruplex structures
Nucleic Acids Res.,
October 1, 2008;
36(17):
5482 - 5515.
[Abstract]
[Full Text]
[PDF]
![]()
![]()
![]()

![]()
![]()
![]()
T. Masuda-Sasa, P. Polaczek, X. P. Peng, L. Chen, and J. L. Campbell
Processing of G4 DNA by Dna2 Helicase/Nuclease and Replication Protein A (RPA) Provides Insights into the Mechanism of Dna2/RPA Substrate Recognition
J. Biol. Chem.,
September 5, 2008;
283(36):
24359 - 24373.
[Abstract]
[Full Text]
[PDF]
![]()
![]()
![]()

![]()
![]()
![]()
V. Popuri, C. Z. Bachrati, L. Muzzolini, G. Mosedale, S. Costantini, E. Giacomini, I. D. Hickson, and A. Vindigni
The Human RecQ Helicases, BLM and RECQ1, Display Distinct DNA Substrate Specificities
J. Biol. Chem.,
June 27, 2008;
283(26):
17766 - 17776.
[Abstract]
[Full Text]
[PDF]
![]()
![]()
![]()

![]()
![]()
![]()
Y. Wu, K. Shin-ya, and R. M. Brosh Jr.
FANCJ Helicase Defective in Fanconia Anemia and Breast Cancer Unwinds G-Quadruplex DNA To Defend Genomic Stability
Mol. Cell. Biol.,
June 15, 2008;
28(12):
4116 - 4128.
[Abstract]
[Full Text]
[PDF]
![]()
![]()
![]()

![]()
![]()
![]()
S. Smith, S. Banerjee, R. Rilo, and K. Myung
Dynamic Regulation of Single-Stranded Telomeres in Saccharomyces cerevisiae
Genetics,
February 1, 2008;
178(2):
693 - 701.
[Abstract]
[Full Text]
[PDF]
![]()
![]()
![]()

![]()
![]()
![]()
F. Madia, C. Gattazzo, M. Wei, P. Fabrizio, W. C. Burhans, M. Weinberger, A. Galbani, J. R. Smith, C. Nguyen, S. Huey, et al.
Longevity mutation in SCH9 prevents recombination errors and premature genomic instability in a Werner/Bloom model system
J. Cell Biol.,
January 10, 2008;
180(1):
67 - 81.
[Abstract]
[Full Text]
[PDF]
![]()
![]()
![]()

![]()
![]()
![]()
R. M. Brosh Jr and V. A. Bohr
Human premature aging, DNA repair and RecQ helicases
Nucleic Acids Res.,
December 3, 2007;
35(22):
7527 - 7544.
[Abstract]
[Full Text]
[PDF]
![]()
![]()
![]()

![]()
![]()
![]()
J. Dai, M. Carver, C. Punchihewa, R. A. Jones, and D. Yang
Structure of the Hybrid-2 type intramolecular human telomeric G-quadruplex in K+ solution: insights into structure polymorphism of the human telomeric sequence
Nucleic Acids Res.,
August 1, 2007;
35(15):
4927 - 4940.
[Abstract]
[Full Text]
[PDF]
![]()
![]()
![]()

![]()
![]()
![]()
Y.-C. Tsai, H. Qi, and L. F. Liu
Protection of DNA Ends by Telomeric 3' G-Tail Sequences
J. Biol. Chem.,
June 29, 2007;
282(26):
18786 - 18792.
[Abstract]
[Full Text]
[PDF]
![]()
![]()
![]()

![]()
![]()
![]()
O. N. Voloshin and R. D. Camerini-Otero
The DinG Protein from Escherichia coli Is a Structure-specific Helicase
J. Biol. Chem.,
June 22, 2007;
282(25):
18437 - 18447.
[Abstract]
[Full Text]
[PDF]
![]()
![]()
![]()

![]()
![]()
![]()
J. Dai, C. Punchihewa, A. Ambrus, D. Chen, R. A. Jones, and D. Yang
Structure of the intramolecular human telomeric G-quadruplex in potassium solution: a novel adenine triple formation
Nucleic Acids Res.,
April 19, 2007;
(2007)
gkm009v2.
[Abstract]
[Full Text]
[PDF]
![]()
![]()
![]()

![]()
![]()
![]()
K. H. Schmidt and R. D. Kolodner
Suppression of spontaneous genome rearrangements in yeast DNA helicase mutants
PNAS,
November 28, 2006;
103(48):
18196 - 18201.
[Abstract]
[Full Text]
[PDF]
![]()
![]()
![]()

![]()
![]()
![]()
J. Eddy and N. Maizels
Gene function correlates with potential for G4 DNA formation in the human genome
Nucleic Acids Res.,
September 1, 2006;
34(14):
3887 - 3896.
[Abstract]
[Full Text]
[PDF]
![]()
![]()
![]()

![]()
![]()
![]()
M. Azam, J. Y. Lee, V. Abraham, R. Chanoux, K. A. Schoenly, and F. B. Johnson
Evidence that the S.cerevisiae Sgs1 protein facilitates recombinational repair of telomeres during senescence
Nucleic Acids Res.,
January 20, 2006;
34(2):
506 - 516.
[Abstract]
[Full Text]
[PDF]
![]()
![]()
![]()

![]()
![]()
![]()
C. Z. Bachrati, R. H. Borts, and I. D. Hickson
Mobile D-loops are a preferred substrate for the Bloom's syndrome helicase.
Nucleic Acids Res.,
January 1, 2006;
34(8):
2269 - 2279.
[Abstract]
[Full Text]
[PDF]
![]()
![]()
![]()

![]()
![]()
![]()
A. Ambrus, D. Chen, J. Dai, T. Bialis, R. A. Jones, and D. Yang
Human telomeric sequence forms a hybrid-type intramolecular G-quadruplex structure with mixed parallel/antiparallel strands in potassium solution.
Nucleic Acids Res.,
January 1, 2006;
34(9):
2723 - 2735.
[Abstract]
[Full Text]
[PDF]
![]()
![]()
![]()

![]()
![]()
![]()
T. Z. Win, H. W. Mankouri, I. D. Hickson, and S.-W. Wang
A role for the fission yeast Rqh1 helicase in chromosome segregation
J. Cell Sci.,
December 15, 2005;
118(24):
5777 - 5784.
[Abstract]
[Full Text]
[PDF]
![]()
![]()
![]()

![]()
![]()
![]()
H. Fukuda, M. Katahira, E. Tanaka, Y. Enokizono, N. Tsuchiya, K. Higuchi, M. Nagao, and H. Nakagama
Unfolding of higher DNA structures formed by the d(CGG) triplet repeat by UP1 protein
Genes Cells,
October 1, 2005;
10(10):
953 - 962.
[Abstract]
[Full Text]
[PDF]
![]()
![]()
![]()

![]()
![]()
![]()
J. Li, J. J. Correia, L. Wang, J. O. Trent, and J. B. Chaires
Not so crystal clear: the structure of the human telomere G-quadruplex in solution differs from that present in a crystal
Nucleic Acids Res.,
August 16, 2005;
33(14):
4649 - 4659.
[Abstract]
[Full Text]
[PDF]
![]()
![]()
![]()

![]()
![]()
![]()
A. J. Zaug, E. R. Podell, and T. R. Cech
Human POT1 disrupts telomeric G-quadruplexes allowing telomerase extension in vitro
PNAS,
August 2, 2005;
102(31):
10864 - 10869.
[Abstract]
[Full Text]
[PDF]
![]()
![]()
![]()

![]()
![]()
![]()
S. Etzioni, A. Yafe, S. Khateb, P. Weisman-Shomer, E. Bengal, and M. Fry
Homodimeric MyoD Preferentially Binds Tetraplex Structures of Regulatory Sequences of Muscle-specific Genes
J. Biol. Chem.,
July 22, 2005;
280(29):
26805 - 26812.
[Abstract]
[Full Text]
[PDF]
![]()
![]()
![]()

![]()
![]()
![]()
K. Lillard-Wetherell, K. A. Combs, and J. Groden
BLM Helicase Complements Disrupted Type II Telomere Lengthening in Telomerase-Negative sgs1 Yeast
Cancer Res.,
July 1, 2005;
65(13):
5520 - 5522.
[Abstract]
[Full Text]
[PDF]
![]()
![]()
![]()

![]()
![]()
![]()
A. Yafe, S. Etzioni, P. Weisman-Shomer, and M. Fry
Formation and properties of hairpin and tetraplex structures of guanine-rich regulatory sequences of muscle-specific genes
Nucleic Acids Res.,
May 20, 2005;
33(9):
2887 - 2900.
[Abstract]
[Full Text]
[PDF]
![]()
![]()
![]()

![]()
![]()
![]()
S. Khateb, P. Weisman-Shomer, I. Hershco, L. A. Loeb, and M. Fry
Destabilization of tetraplex structures of the fragile X repeat sequence (CGG)n is mediated by homolog-conserved domains in three members of the hnRNP family
Nucleic Acids Res.,
August 9, 2004;
32(14):
4145 - 4154.
[Abstract]
[Full Text]
[PDF]
![]()
![]()
![]()

![]()
![]()
![]()
M. L. Duquette, P. Handa, J. A. Vincent, A. F. Taylor, and N. Maizels
Intracellular transcription of G-rich DNAs induces formation of G-loops, novel structures containing G4 DNA
Genes & Dev.,
July 1, 2004;
18(13):
1618 - 1629.
[Abstract]
[Full Text]
[PDF]
![]()
![]()
![]()

![]()
![]()
![]()
M. W. Van Dyke, L. D. Nelson, R. G. Weilbaecher, and D. V. Mehta
Stm1p, a G4 Quadruplex and Purine Motif Triplex Nucleic Acid-binding Protein, Interacts with Ribosomes and Subtelomeric Y' DNA in Saccharomyces cerevisiae
J. Biol. Chem.,
June 4, 2004;
279(23):
24323 - 24333.
[Abstract]
[Full Text]
[PDF]
![]()
![]()
![]()

![]()
![]()
![]()
J. P. Braybrooke, J.-L. Li, L. Wu, F. Caple, F. E. Benson, and I. D. Hickson
Functional Interaction between the Bloom's Syndrome Helicase and the RAD51 Paralog, RAD51L3 (RAD51D)
J. Biol. Chem.,
November 28, 2003;
278(48):
48357 - 48366.
[Abstract]
[Full Text]
[PDF]
![]()
![]()
![]()

![]()
![]()
![]()
M.-Y. Kim, M. Gleason-Guzman, E. Izbicka, D. Nishioka, and L. H. Hurley
The Different Biological Effects of Telomestatin and TMPyP4 Can Be Attributed to Their Selectivity for Interaction with Intramolecular or Intermolecular G-Quadruplex Structures
Cancer Res.,
June 15, 2003;
63(12):
3247 - 3256.
[Abstract]
[Full Text]
[PDF]
![]()
![]()
![]()

![]()
![]()
![]()
S.-H. Chou, K.-H. Chin, and A. H.-J. Wang
Unusual DNA duplex and hairpin motifs
Nucleic Acids Res.,
May 15, 2003;
31(10):
2461 - 2474.
[Abstract]
[Full Text]
[PDF]
![]()
![]()
![]()

![]()
![]()
![]()
M. D. Huber, D. C. Lee, and N. Maizels
G4 DNA unwinding by BLM and Sgs1p: substrate specificity and substrate-specific inhibition
Nucleic Acids Res.,
September 15, 2002;
30(18):
3954 - 3961.
[Abstract]
[Full Text]
[PDF]
![]()
![]()
![]()

![]()
![]()
![]()
P. Weisman-Shomer, E. Cohen, and M. Fry
Distinct domains in the CArG-box binding factor A destabilize tetraplex forms of the fragile X expanded sequence d(CGG)n
Nucleic Acids Res.,
September 1, 2002;
30(17):
3672 - 3681.
[Abstract]
[Full Text]
[PDF]
![]()
![]()
![]()

![]()
![]()
![]()
C. Marchand, P. Pourquier, G. S. Laco, N. Jing, and Y. Pommier
Interaction of Human Nuclear Topoisomerase I with Guanosine Quartet-forming and Guanosine-rich Single-stranded DNA and RNA Oligonucleotides
J. Biol. Chem.,
March 8, 2002;
277(11):
8906 - 8911.
[Abstract]
[Full Text]
[PDF]
![]()
![]()
![]()

![]()
![]()
![]()
J.-L. Mergny, J.-F. Riou, P. Mailliet, M.-P. Teulade-Fichou, and E. Gilson
Natural and pharmacological regulation of telomerase
Nucleic Acids Res.,
February 15, 2002;
30(4):
839 - 865.
[Abstract]
[Full Text]
[PDF]
![]()
![]()
![]()

![]()
![]()
![]()
A. Machwe, L. Xiao, S. Theodore, and D. K. Orren
DNase I Footprinting and Enhanced Exonuclease Function of the Bipartite Werner Syndrome Protein (WRN) Bound to Partially Melted Duplex DNA
J. Biol. Chem.,
February 1, 2002;
277(6):
4492 - 4504.
[Abstract]
[Full Text]
[PDF]
![]()
![]()
![]()

![]()
![]()
![]()
W. Duan, A. Rangan, H. Vankayalapati, M.-Y. Kim, Q. Zeng, D. Sun, H. Han, O. Yu. Fedoroff, D. Nishioka, S. Y. Rha, et al.
Design and Synthesis of Fluoroquinophenoxazines That Interact with Human Telomeric G-Quadruplexes and Their Biological Effects
Mol. Cancer Ther.,
December 1, 2001;
1(2):
103 - 120.
[Abstract]
[Full Text]
[PDF]
![]()
![]()
![]()

![]()
![]()
![]()
X. Xu, F. Hamhouyia, S. D. Thomas, T. J. Burke, A. C. Girvan, W. G. McGregor, J. O. Trent, D. M. Miller, and P. J. Bates
Inhibition of DNA Replication and Induction of S Phase Cell Cycle Arrest by G-rich Oligonucleotides
J. Biol. Chem.,
November 9, 2001;
276(46):
43221 - 43230.
[Abstract]
[Full Text]
[PDF]
![]()
![]()
![]()

![]()
![]()
![]()
H. Sun, A. Yabuki, and N. Maizels
A human nuclease specific for G4 DNA
PNAS,
October 23, 2001;
98(22):
12444 - 12449.
[Abstract]
[Full Text]
[PDF]
![]()
![]()
![]()

![]()
![]()
![]()
R. J. Bennett and J. C. Wang
Association of yeast DNA topoisomerase III and Sgs1 DNA helicase: Studies of fusion proteins
PNAS,
September 5, 2001;
(2001)
201387098.
[Abstract]
[Full Text]
[PDF]
![]()
![]()
![]()

![]()
![]()
![]()
X. Wu and N. Maizels
Substrate-specific inhibition of RecQ helicase
Nucleic Acids Res.,
April 15, 2001;
29(8):
1765 - 1771.
[Abstract]
[Full Text]
[PDF]
![]()
![]()
![]()

![]()
![]()
![]()
A. Ludwig, G. Saretzki, P. S. Holm, F. Tiemann, M. Lorenz, T. Emrich, C. B. Harley, and T. von Zglinicki
Ribozyme Cleavage of Telomerase mRNA Sensitizes Breast Epithelial Cells to Inhibitors of Topoisomerase
Cancer Res.,
April 1, 2001;
61(7):
3053 - 3061.
[Abstract]
[Full Text]
![]()
![]()
![]()

![]()
![]()
![]()
M. McVey, M. Kaeberlein, H. A. Tissenbaum, and L. Guarente
The Short Life Span of Saccharomyces cerevisiae sgs1 and srs2 Mutants Is a Composite of Normal Aging Processes and Mitotic Arrest Due to Defective Recombination
Genetics,
April 1, 2001;
157(4):
1531 - 1542.
[Abstract]
[Full Text]
![]()
![]()
![]()

![]()
![]()
![]()
H. Cohen and D. A. Sinclair
Recombination-mediated lengthening of terminal telomeric repeats requires the Sgs1 DNA helicase
PNAS,
March 1, 2001;
(2001)
61579598.
[Abstract]
[Full Text]
![]()
![]()
![]()

![]()
![]()
![]()
P. B. Arimondo, J.-F. Riou, J.-L. Mergny, J. Tazi, J.-S. Sun, T. Garestier, and C. Helene
Interaction of human DNA topoisomerase I with G-quartet structures
Nucleic Acids Res.,
December 15, 2000;
28(24):
4832 - 4838.
[Abstract]
[Full Text]
[PDF]
![]()
![]()
![]()

![]()
![]()
![]()
F. Hartung, H. Plchova, and H. Puchta
Molecular characterisation of RecQ homologues in Arabidopsis thaliana
Nucleic Acids Res.,
November 1, 2000;
28(21):
4275 - 4282.
[Abstract]
[Full Text]
[PDF]
![]()
![]()
![]()

![]()
![]()
![]()
I. Ohsugi, Y. Tokutake, N. Suzuki, T. Ide, M. Sugimoto, and Y. Furuichi
Telomere repeat DNA forms a large non-covalent complex with unique cohesive properties which is dissociated by Werner syndrome DNA helicase in the presence of replication protein A
Nucleic Acids Res.,
September 15, 2000;
28(18):
3642 - 3648.
[Abstract]
[Full Text]
[PDF]
![]()
![]()
![]()

![]()
![]()
![]()
J.-C. Shen and L. A. Loeb
Werner syndrome exonuclease catalyzes structure-dependent degradation of DNA
Nucleic Acids Res.,
September 1, 2000;
28(17):
3260 - 3268.
[Abstract]
[Full Text]
[PDF]
![]()
![]()
![]()

![]()
![]()
![]()
K. Muniyappa, S. Anuradha, and B. Byers
Yeast Meiosis-Specific Protein Hop1 Binds to G4 DNA and Promotes Its Formation
Mol. Cell. Biol.,
February 15, 2000;
20(4):
1361 - 1369.
[Abstract]
[Full Text]
![]()
![]()
![]()

![]()
![]()
![]()
P. Weisman-Shomer, Y. Naot, and M. Fry
Tetrahelical Forms of the Fragile X Syndrome Expanded Sequence d(CGG)n Are Destabilized by Two Heterogeneous Nuclear Ribonucleoprotein-related Telomeric DNA-binding Proteins
J. Biol. Chem.,
January 21, 2000;
275(3):
2231 - 2238.
[Abstract]
[Full Text]
[PDF]
![]()
![]()
![]()

![]()
![]()
![]()
H. Cohen and D. A. Sinclair
Recombination-mediated lengthening of terminal telomeric repeats requires the Sgs1 DNA helicase
PNAS,
March 13, 2001;
98(6):
3174 - 3179.
[Abstract]
[Full Text]
[PDF]
![]()
![]()
![]()

![]()
![]()
![]()
R. J. Bennett and J. C. Wang
Association of yeast DNA topoisomerase III and Sgs1 DNA helicase: Studies of fusion proteins
PNAS,
September 25, 2001;
98(20):
11108 - 11113.
[Abstract]
[Full Text]
[PDF]
![]()
This Article ![]()
![]()
Abstract
![]()
Print PDF (474K)
![]()
Alert me when this article is cited
![]()
Alert me if a correction is posted
![]()
Services ![]()
![]()
Email this article to a friend
![]()
Similar articles in this journal
![]()
Similar articles in ISI Web of Science
![]()
Similar articles in PubMed
![]()
Alert me to new issues of the journal
![]()
Add to My Personal Archive
![]()
Download to citation manager
![]()
Search for citing articles in:
ISI Web of Science (110)
![]()
Request Permissions ![]()
Commercial Re-use Guidelines
for Open Access NAR Content
![]()
Google Scholar ![]()
![]()
Articles by Sun, H.
![]()
Articles by Maizels, N.
![]()
Search for Related Content
![]()
PubMed ![]()
![]()
PubMed Citation
![]()
Articles by Sun, H.
![]()
Articles by Maizels, N.
![]()
Social Bookmarking ![]()
![]()
What's this?