Nucleic Acids Research

Trypanosomes

The bloodstream life cycle stage of Trypanosoma brucei was grown in HMI-9 medium (27) supplemented with 10% (v/v) heat-inactivated bovine foetal calf serum (FCS). Incubation was at 37°C in 5% CO₂/95% air. The following strains were used: T.brucei 427-MITat serodeme, variant clones MITat 1.2 and MITat 1.4 (28); AnTat 1.1 (29); ILTAT 1.1 (30). Insect stage trypanosomes were grown at 27°C in SDM-79 medium supplemented with 10% (v/v) FCS (31).

Oligodeoxynucleotide and RNA pool synthesis

DNA oligonucleotides were synthesised by automated solid support chemistry using O-cyanoethyl-N,N-diisopropyl-phosphoramidites. The starting DNA library was a 79mer of sequence gaat-tcagtcggacagcg(N)₄₀gatggacgaatatcgtctccc which contained a central sequence stretch of 40 randomised nucleotides. The DNA was purified by reverse phase liquid chromatography and 1.1 mg were amplified during seven PCR cycles in a total volume of 60 ml using primers A (gcgaagctttaatacgactcactatagggagacgatattcgtccatc) and B (ggtcgagaattcagtcggacagcg). Of the 7.5 mg of double-stranded PCR product, 1.5 mg were transcribed into 2.5 mg RNA (reaction volume 7.5 ml) from which 1.15 mg were used in the first round of each selection. All subsequent RNA pools were transcribed from 50-150 µg of the PCR-generated double-stranded DNA templates in a final volume of 1-1.5 ml. Reactions were performed in the presence of 5 µCi [[alpha]-³²P]UTP (3000 Ci/mmol) in 20 mM Na_xH_yPO₄, pH 7.9, 8 mM MgCl₂, 20 mM DTT, 4 mM spermidine, containing 1 mM each NTP and 500 U T7 RNA polymerase. The synthesised RNAs were extracted with phenol, precipitated with ethanol and redissolved in a buffer containing 20 mM Na_xH_yPO₄, pH 7.4, 2 mM MgCl₂, 130 mM NaCl, 5 mM KCl, 20 mM glucose and 0.2 mM [beta]-mercaptoethanol. A final purification was achieved by size exclusion chromatography on Sephadex G50 columns using the same buffer. Before each round of selection, all RNAs were pre-incubated at 37°C for 30 min.

In vitro selection

Trypanosomes were harvested at a cell density of 1-2 × 10⁶ cells/ml and extensively washed in binding buffer (20 mM Na_xH_yPO₄, pH 7.4, 2 mM MgCl₂, 130 mM NaCl, 5 mM KCl, 20 mM glucose, 0.2 mM [beta]-mercaptoethanol). RNA binding was performed in a final volume of 0.5-1.5 ml with ³²P-labelled pool RNA (10-20 µM) and either 5 × 10⁸ (rounds 1-7) or 2 × 10⁸ cells/ml (rounds 8-13). After an incubation for 60 min at 30°C, unbound and weakly associated RNAs were washed off by four consecutive washes with 2 ml binding buffer. Trypanosomes and bound RNAs were collected by centrifugation and the bound RNAs recovered by two phenol extractions followed by precipitation with ethanol. Isolated RNA was reverse transcribed (150 µl reaction volume, 10 µg primer B, 100 U M-MuLV RT), amplified by PCR and the resulting DNA templates were transcribed into RNA which was used for the next round of selection. DNA templates from pool 12 were digested with HindIII and EcoRI and cloned into pUC118. Sequences of 53 clones of each selection were determined by dideoxy terminator sequencing.

Determination of binding parameters

Uniformly ³²P-labelled pool RNAs (5 nM, ~20 000 c.p.m.) or RNA aptamers (3-5 nM, 10 000-50 000 c.p.m.) were incubated with T.brucei cells in 100 µl binding buffer at cell densities of1-3 × 10⁸/ml for bloodstream stage cells and 5 × 10⁹/ml for insect stage trypanosomes. After a 30 min incubation at 37°C, the cells were washed (four times with 2 ml binding buffer), collected by centrifugation and the percentage of bound RNA was determined by scintillation counting. Average relative binding efficiencies were calculated from three independent experiments and were normalised to the binding efficiency of pool 1 RNA. Equilibrium dissociation constants were derived from experiments determining the percentage of bound RNA at varying trypanosome cell numbers. K_d values were calculated based on the Scatchard equation r/[A] = n/K_d - r/K_d with the slope of the plot representing -1/K_d; where A is the free RNA, r = B/[cells] and B is bound RNA. The number of binding sites on the trypanosome surface (n) was derived from the x-intercept of the Scatchard plot.

Association rates were determined with uniformly ³²P-labelled RNA aptamer 2-16 (0.75 nM, ~50 000 c.p.m.) and varying amounts of T.brucei cells in 50 µl binding buffer at 37°C. Parasite cell densities varied between 2.5 × 10⁷ and 2 × 10⁸/ml corresponding to calculated target concentrations of 3-24 nM (assuming 72 000 targets/cell). Under the conditions of a large excess of one binding partner, a pseudo-first-order rate constant k_obs can be determined from k_obs = ln 2/t_½. RNA aptamers and cells were pre-incubated at 37°C and the binding reaction was started by adding cells to the RNA. Aliquots were taken at time points between 0.5 and 30 min, diluted 1:500 in binding buffer and centrifuged immediately. The percentage of bound and unbound RNA was determined for each time point by scintillation counting and plotted against time.

Run-off transcription, 5[prime]-end-labelling and biotinylation

RNA aptamers were transcribed from linearised plasmid DNA templates using T7 RNA polymerase following standard procedures. DNA templates (1 µg) were transcribed in a buffer containing 20 mM Na_xH_yPO₄, pH 7.9, 8 mM MgCl₂, 20 mM DTT, 4 mM spermidine and 1 mM each NTP. Radioactive labelling of the RNAs was achieved by using [[alpha]-³²P]UTP (10-50 µCi) and 5 µM UTP in the transcription reaction. The DNA was digested with DNase I and RNA transcripts were phenol extracted and purified from non-incorporated NTPs by size exclusion chromatography. Aptamer RNAs were 5[prime]-end-labelled using alkaline phosphatase and T4 polynucleotide kinase and [[gamma]-³²P]ATP according to standard procedures.

Fluorescence labelling of aptamer 2-16 was achieved by tagging the BODIPY TMR-C₅ fluorophore (Molecular Probes) to the 5[prime]-end of the RNA. The reaction was performed according to the manufacturer’s specification and fluorophore-conjugated 2-16 RNA was dissolved in a PBS-based buffer at 0.4 µg/µl.

Biotinylation of aptamer 2-16 was performed by in vitro transcription in a reaction mixture containing 1 mM each GTP, CTP and ATP, 0.05 mM UTP and 5-50 µM biotin-16-UTP (Boehringer Mannheim). RNA transcripts were separated from non-incorporated nucleotides by size exclusion chromatography, precipitated with ethanol and dissolved in a PBS-based binding buffer at 20 ng/µl.

RNA structure determination

Theoretical secondary structures were calculated using the MFold subroutine of the GCG software package based on a free energy minimisation algorithm (Wisconsin Package v.9.1; Genetics Computer Group, Madison, WI). Calculations were performed for 37°C, which is the optimal growth temperature for bloodstream stage trypanosomes. Structure-specific enzymatic probing experiments were performed at limiting enzyme concentrations with cobra venom RNase V1 (0.25 U/ml), RNase T1 (250 U/ml) and RNase A (10 mU/ml). Cleavage reactions were done with 0.3 µg aptamer RNA at 25°C in 20 mM Na_xH_yPO₄, pH 7.4, 2 mM MgCl₂, 130 mM NaCl, 5 mM KCl. Samples were analysed on denaturing 12% (w/v) polyacrylamide gels. CD spectra and UV melting curves were recorded as described (32).

Photo-crosslinking of RNA aptamers to living cells

Uniformly ³²P-labelled RNA aptamers (5-10 nM) were incubated with T.brucei cells (2-8 × 10⁸/ml) in binding buffer at 37°C for 20 min. Following incubation, the cells were put on ice and irradiated with UV light (254 nm) for 10 min at an energy dose of 0.12 J/cm². The samples were heat denatured (95°C, 5 min), digested with a cocktail of RNase A, RNase T1 and DNase I (30 min, 37°C) and finally analysed by discontinuous SDS-PAGE. Gels were stained with Coomassie brilliant blue, dried and the ³²P-labelled proteins were visualised by autoradiography.

Fluorescence in situ hybridisation

Bloodstream stage trypanosomes were harvested at a cell density of 2 × 10⁶/ml and washed in binding buffer (four times). Samples of 2 × 10⁷ parasites were incubated at 37°C with either biotinylated (2 ng/µl) or 5[prime]-BODIPY TMR-C₅-labelled aptamer RNA (10 ng/µl) in 40 µl binding buffer. After 20 min the cells were washed (twice with 2 ml binding buffer) to remove unbound RNA and put on ice. Cells were smeared onto micoscope slides, briefly air dried and mounted in ProLong Antifade (Molecular Probes). In the case of biotinylated aptamer preparations, the parasites were further incubated with a 1:100 dilution of a monoclonal Cy[trade]3-conjugated anti-biotin antibody (Dianova). Nuclear and kinetoplast DNAs were stained with Hoechst H-33342 (Molecular Probes). Slides were examined with a digital fluorescense microscope. Images were captured and merged using IP Lab Spectrum 3.1.2c (Scanalytics Inc.). Assembly into figures and false colouring were performed using Adobe^® Photoshop 3.0.3 (Adobe^® Systems Inc.).

Selection of RNAs that bind to live trypanosomes

For the selection we used a starting pool of 10¹⁶ RNA molecules with an estimated complexity of 2 × 10¹⁵ unique sequences. The library contained 40 randomised nucleotides flanked by primer binding sites 21 and 24 nt in length, which together restricted the final molecular mass of the selected aptamers to a value around 25-27 kDa. In the case of the protease trypsin, this has been shown to be a molecular size still able to penetrate the VSG layer (22). Two independent selections were performed in parallel using two different T.brucei variant antigen clones as target cells: MITat 1.2, a cell line which stably expresses VSG 221, and MITat 1.4, which express VSG 117 on their surface (28). These two variant strains were further chosen because of steric differences in the VSG packing on the parasite surface: they respond differently when incubated with an anti-ISG75 antibody or with the protease trypsin (17). Lastly, the crystal structure for the N-terminal domain of the MITat 1.2 VSG is known to a resolution of 2.9 Å (33).

Both parasite variants were grown as bloodstream stage trypanosomes and RNA binding was accomplished over a 60 min incubation period. Despite some RNA degradation, a significant amount of full-length RNAs remained intact after the incubation (Fig. 1A) which was processed further. In both experiments, 13 rounds of selective binding and subsequent amplification were performed. Maximal enrichment of trypanosome-interacting RNAs was achieved in both selections in round 12 at which time ~18% of the input RNAs was associated with the parasite cells (Fig. 1B). Confirmation of a reduction in the pool complexities with increasing rounds of selection was derived from analytical RNase T1 digests of the different ³²P-labelled RNA pools. Starting at rounds 8 and 9, distinct RNase cleavage products could be resolved electrophoretically, indicating the selective enrichment of defined RNA sequences (Fig. 1C).

Figure 1. Selective enrichment of RNA ligands that interact with live trypanosomes. (A) Degradation kinetics of ³²P-labelled pool 1 RNA (85 nt) upon incubation with either MITat 1.2 or MITat 1.4 trypanosomes. (B) Graphical representation of the percentage of trypanosome-bound RNAs in each round of selection using MITat 1.2 or MITat 1.4 cells. Binding was performed at 30°C using 5 nM RNA and a cell density of 3 × 10⁸ cells/ml. (C) Analytical RNase T1 digestion of different RNA pools from both selections. Uniformly ³²P-labelled aptamer pools were digested with RNase T1 at limiting conditions and the resulting hydrolysis products were separated in denaturing polyacrylamide gels and analysed by autoradiography. The appearance of distinct cleavage products (arrowheads) indicate a reduction in the pool complexity and thus an enrichment of a few selected sequences. The very similar digestion pattern in both selection experiments indicates the presence of similar RNA sequences.

DNA templates from RNA pools of round 12 were cloned and the sequences of 53 clones from each selection experiment were determined. A majority of these sequences can be grouped into two families (I and II) based on common sequence motifs (Fig. 2). Family I members are characterised by an invariant CGT and a conserved NGC base triplet which are flanked by sequences that show a high degree of co-variation, suggesting base pairing. Two of the family I sequences were found in both selections. The first one is represented by the identical aptamers 2-11 and 4-2, accounting for ~50% of all clones in both selections. The second sequence (aptamers 2-16 and 4-10) appeared at a frequency of 24% in the selection using MITat 1.2 trypanosomes and at a frequency of 7% in the selection with MITat 1.4 parasites. Thus, almost 70% of the sequences were identical in both selections. The remaining family I sequences are unique to each selection and were either found in several identical isolates or as single sequences. Family II (Fig. 2) contains only five members; all are characterised by four repeats of a GGGN sequence motif. Aptamer 4-30 of that group was found in three identical clones, while all other clones were unique. Six sequences could not be assigned to either of the two families and were grouped into a separate set (family III) (Fig. 2).

Figure 2. DNA sequences and relative binding efficiencies of all aptamers from both selection experiments. The name of each aptamer is followed by its clone abundance (in parentheses) and the primary sequence of the randomised region. Base complementary sequences are underlined and co-varying nucleotide positions are indicated as capital letters in bold. Relative binding efficiencies were measured for MITat 1.2 and MITat 1.4 cells and were normalised to the binding efficiency of the starting RNA pool, which was set to a value of 1. Standard deviations were estimated from three independent binding experiments. Members of family I (92 out of 106 clones) contain an invariant CGT and a conserved NGC triplet (shaded boxes). Family II members (seven out of 106 clones) contain four repeats of a GGGN box (shaded in grey) located at the 3[prime]-end of the randomised region. Family III members (seven out of 106 clones) show no similarity to either of the two families; three RNAs, however, contain stretches with similar sequences (shaded boxes). Capital letters indicate nucleotides from the 5[prime] and 3[prime] PBS involved in base pairing. ^aThe sequence includes five clones with one or two base changes. ^bThe sequence includes one clone with a single base change.

Binding efficiencies of the RNA aptamers

Relative binding efficiencies for all aptamers were determined using both parasite variant strains as targets (Fig. 2). Each aptamer RNA shows an increased relative binding capacity compared to the starting randomised RNA pool. The values range between 2 and 40%, which corresponds to a 12- to 280-fold increase in the relative binding efficiency. Thus, weak as well as strong binders were selected in the two experiments. A more thorough inspection shows that the family I aptamers can be divided into a high affinity group which binds 150- to 280-fold stronger to either MITat 1.2 or MITat 1.4 cells and a group of RNAs with only moderate affinity (14- to 50-fold stronger binding). The family III RNAs also contain weak and strong binders, while the aptamers of family II show intermediate binding. The relative binding efficiencies range between a 50- to 90-fold increase to MITat 1.2 cells and a 50- to 180-fold stronger binding to MITat 1.4 cells. None of the RNAs is capable of discriminating between MITat 1.2 and MITat 1.4 cells, regardless of which parasite variant was used in the selection protocol. This indicates either that the RNAs interact with the structurally constant domains of the two different VSGs or that identical surface targets were selected in both SELEX experiments. In contrast, all RNAs are incapable of recognising the surface of insect stage trypanosomes (binding efficiencies [le]0.1%), indicating a bloodstream stage specificity of the aptamer/trypanosome interaction.

RNA structure determination

To gain insight into the folding details of the three aptamer families, we computed energy-minimised secondary structures for all RNA sequences. In addition, selected aptamers were experimentally probed with single- and double-strand-specific RNases and analysed by CD spectroscopy and UV melting. The combination of all data resulted in a secondary structure model for the family I RNAs consisting of a hairpin loop as shown in Figure 3A (left). On one side, the main helical element of the hairpin is interrupted by the invariant CGU triplet, which forms a bulge that protrudes from the helical geometry. The conserved NGC sequence is located within the apical loop sequence of the hairpin. Additionally, a pseudoknotted structure can be formed involving a sequence stretch of the 3[prime] primer binding sequence (PBS) (Fig. 3A, right). In the case of aptamer 2-16, the pseudoknotted structure is supported by prominent RNase V1 sites at positions A70, G69, U64, G44 and G43 and the ability to form the pseudoknot seems to distinguish strong family I aptamers from weak binders. Lastly, multiple transitions in UV melting experiments suggest additional higher order foldings (data not shown). CD measurements verified the typical A-form characteristics for the helical elements: a strong positive elipticity around 270 nm and negative elipticities at 240 and 210 nm (data not shown).

Figure 3. Structure models for family I (A) and family II aptamers (B) derived from sequence comparison and enzymatic probing data of 5[prime]-³²P-labelled 2-16 RNA (family I) or 5[prime]-³²P-labelled 4-29 aptamer (family II). Sequences derived from the constant 5[prime] and 3[prime] primer binding sites (PBS) are represented as shaded lines. Nucleotide accessibilities for the various enzymes used for the structure probing are given in the legend below the drawing. For the family I aptamers a pseudoknotted structure can be formed (A, right) involving a sequence stretch of the 3[prime] PBS which is supported by several of the RNase V1 hydrolysis sites.

The repetitive GGGN sequence motifs of the family II aptamers are likely to fold into a G-quartet structure (34,35) as shown in Figure 3B. The four GGGN elements show different sensitivities to RNase T1 with the third GGGN motif being insensitive to the nuclease. As in the case of the family I RNAs, nucleotides of the 3[prime] PBS were identified as contributing to the folding of the RNAs by base pairing with a sequence stretch at the 5[prime]-end of the randomised region. The formed helix extends the structural arrangement of the G-quartet. No consensus structure could be derived for the aptamers grouped into family III, although three of the RNAs contain short stretches with identical sequence (Fig. 2). Lastly, in contrast to the aptamers of family I, no structural differences between the strong and weak binders of families II and III could be identified.

Identification and localisation of the binding target(s)

To identify the binding target(s) on the parasite surface, we performed zero distance photo-crosslinking experiments. A representative set of results is shown in Figure 4A using the strongest binding RNA, aptamer 2-16, as the ligand. Two crosslinking products with apparent molecular masses of 42 and 29 kDa were identified. The absence of any UV irradiation or digestion with proteinase K (data not shown) after the photo-crosslinking reaction completely abolished the formation of the two products, thus identifying them as RNA-protein complexes. No radioactive signal with the apparent molecular size of VSG molecules was detected (~60 kDa), which indicated that the VSG protein is not the target for the binding of the aptamer RNAs.

Figure 4. Photo-crosslinking and quantitative characterisation of the binding reaction of aptamer 2-16. (A) Gel separation of UV-crosslinking products of uniformly ³²P-labelled aptamer 2-16 with MITat 1.2 cells in the absence (- comp.) or presence (+ comp.) of a 100-fold molar excess of unlabelled 2-16 RNA or tRNA (+ tRNA). (B) (Left) UV-crosslinking of aptamer 2-16 to bloodstream form (BF) MITat 1.2 and MITat 1.4 cells or to insect stage cells (procyclic cell form, PCF). (Right) Coomassie-stained SDS-PAGE gel showing the separation of a trypanosome whole cell lysate and purified VSG protein. Molecular masses are given in kDa.

The specificity of the two crosslinks was tested in competition experiments with homologous and heterologous RNA competitors (Fig. 4A). Crosslinking to the 42 kDa protein was abolished in the presence of a 100-fold molar excess of unlabelled 2-16 RNA, whereas a 100-fold molar excess of tRNA had no effect. This indicates a specific aptamer-protein interaction for the 42 kDa protein. In contrast, the 29 kDa band shows several unusual features. First, it cannot be competed away with either competitor RNA (Fig. 4A). Second, it was only found at lower parasite cell densities [le]10⁸ cells/ml (compare Fig. 4A with B). Third, no crosslinking was achieved at incubation intervals [ge]20 min (data not shown). Since the SELEX cycles involved 60 min incubations of the RNA pools with the parasite cells, the 29 kDa protein cannot be the specific aptamer binding target.

As expected from the binding data, aptamer 2-16 could be crosslinked to the same 42 kDa target in both MITat 1.2 and MITat 1.4 cells (Fig. 4B). No crosslinking was achieved with insect stage parasites, again demonstrating the specificity of the RNA binding reaction for the bloodstream life cycle stage. Weak binding aptamers could be crosslinked to the same 42 kDa polypeptide, although with lower efficiency (data not shown).

To localize the 42 kDa binding target on the trypanosome surface we monitored the binding of aptamer 2-16 by in situ fluorescence microscopy. Direct staining with a fluorophore-conjugated 2-16 RNA preparation as well as indirect staining with a fluorophore-coupled antibody against biotinylated 2-16 RNA gave identical results. The bound RNA localised to a punctated area proximal to the kinetoplast (Fig. 5). This likely represents the flagellar pocket, the main endo- and exocytosis site of the parasite.

Figure 5. Trypanosome-bound aptamer 2-16 localises to the flagellarpocket. In situ fluorescence microscopy of bloodstream stage trypanosomes(MITat 1.4) incubated with biotinylated 2-16 RNA and immunodecorated with a Cy[trade]3-conjugated anti-biotin antibody (yellow). Counter-staining with Hoechst H-33342 (pink) indicates the nucleus and kinetoplast. Phase contrast images of two trypanosome cells in different orientations are shown, merged with the fluorescence images in false colour. Arrowheads indicate the punctated staining due to binding of the aptamer. The area coincides with the flagellar pocket of the cells as indicated in the line drawing to the right.

Quantitative characterisation of the binding reaction

As above, we used aptamer 2-16 for a quantitative analysis of the binding reaction. The dissociation constant for the interaction of 2-16 RNA with either MITat 1.2 or MITat 1.4 cells was determined in a Scatchard analysis. Varying concentrations of the radioactively labelled RNA (0.1-250 nM) were incubated with a constant number of parasite cells (5 × 10⁸ cells/ml). The resulting binding curve (Fig. 6A) shows saturation characteristics demonstrating the presence of a defined number of binding sites which can be titrated with the aptamer RNA. From the Scatchard analysis of eight independent measurements with different target cell concentrations we derived a dissociation constant (K_d) of60 ± 17 nM indicating a high affinity interaction. The target concentration at saturation corresponds to a number of 72 000 ± 18 000 binding sites/parasite cell.

The association rate of aptamer 2-16 to the surface of the parasites was determined under pseudo-first-order conditions, equivalent to a large excess of cell surface target (25 nM) over aptamer RNA (0.75 nM). Figure 6B shows a typical example of a binding kinetic which reveals an initial association phase (0-20 min) with defined first-order characteristics and a pseudo-first-order association rate (k_obs) of 0.06 min^-1, equivalent to a half maximal association time (t_½) of 12 min (t_½ = ln 2/k_obs). After 25-30 min, however, RNA binding slows down and a slight decrease in the association was observed at later time points (50-60 min). Hence, initial pseudo-first-order association rates (k_obs) were determined at varying target concentrations (4- to 30-fold molar excess over aptamer RNA). As expected for a bimolecular association reaction, a linear dependence of k_obs on the target concentration was identified (Fig. 4D). From the slope of the curve (k_ass = k_obs/[target]) an association rate constant (k_ass) of 4.3 × 10⁴ M^-1 s^-1 was derived.

Binding to other trypanosome strains

All aptamers were unable to distinguish between the two MITat strain variants that were used in the two selections. This raised the question whether other, non-MITat trypanosomes could also be recognised. Thus, we determined the binding efficiency of the selected RNAs to two additional T.brucei strains, the well-characterised pleomorphic strains ILTAT 1.1 (30) and AnTat 1.1 (29). Binding efficiencies of aptamers from all three families were determined and normalised to the binding of pool 1 RNA (Table 1). Although both strains showed a 5- to 10-fold higher non-specific affinity for RNA (compared to the two MITat variants), pool 12 RNA still bound 3-4 times stronger to these two strains than pool 1 RNA. This clearly indicated that RNA species were selected that also have an affinity for the ILTAT and AnTat trypanosomes. Individual members of family I and family III bound 3-9 times stronger than pool 1 RNA and the G-quartet structures of family II showed a 10- to 25-fold stronger binding. These binding strengths result in 10-30% of the RNAs bound to the parasite surface, which are comparable values to the binding efficiencies to the MITat 1.2 and MITat 1.4 parasites.

DISCUSSION

We demonstrate the isolation of high affinity ligands from a combinatorial RNA library to the surface of live African trypanosomes. The selection was performed with bloodstream stage trypanosomes which represent the infective life cycle stage of the parasite. Three RNA ligand families were isolated. A major group containing almost 90% of all selected RNAs was characterised by an invariant CGU sequence in addition to a highly conserved NGC base triplet. The molecules were shown to adopt an irregular hairpin structure with the invariant CGU sequence in a bulged out, single-stranded conformation and the conserved NGC sequence located within the loop of the hairpin. This likely indicates sequence-specific contacts to the binding target, especially in the case of the invariant CGU (see below). Family II aptamers share the potential of folding into G-quartet structures. Since several other selection/amplification experiments have resulted in G-quartet nucleic acid ligands (36-40), it is not clear whether this reflects a concealed selection pressure towards very stable RNA structures inherent to the SELEX protocol. However, a comparison of the RNase stability of representative RNAs of all three aptamer families in comparison to the stability of the initial RNA pool showed no significant differences (data not shown). Therefore, RNA stability was not the main selection criterion in the two experiments.

Figure 6. (A) Determination of the dissociation constant (K_d) for the binding reaction between aptamer 2-16 and MITat 1.2 cells. (Insert) Binding curve using varying concentrations of 2-16 RNA at a constant cell density of 5 × 10⁸ cells /ml. (Main) Scatchard analysis of the binding data. The slope of the curve represents -1/K_d, while from the x-intercept the number/concentration of target molecules can be derived. (B) Determination of the association rate of aptamer 2-16 (0.8 nM) with MITat 1.2 cells (2 × 10⁸ cells/ml) under pseudo-first-order conditions. Values within the 0-20 min time frame are fitted according to a first-order equation, giving a pseudo-first-order rate constant (k_obs) of 0.06 min^-1. (Insert) Determination of k_obs at different target cell densities. The slope of the curve represents k_ass. Assuming a target number of 72 000 molecules/cell, k_ass was calculated to be 4.3 × 10⁴ M^-1 s^-1.

Table 1. Relative binding efficiencies of RNA aptamers to ILTAT 1.1 and AnTat 1.1 trypanosomes

Aptamer family	RNA	AnTat 1.1	ILTAT 1.1
	Pool 1	1	1
	Pool 12	3.1 ± 0.2	3.7 ± 0.6
Family I	2-11	5.3 ± 2.6	8.3 ± 3.0
	2-16	2.4 ± 0.5	3.5 ± 1.5
	4-25	6.5 ± 2.2	9.7 ± 1.1
	4-13	6.0 ± 0.3	7.0 ± 0.4
Family II	2-5	11.4 ± 3.7	14.4 ± 3.7
	2-10	17.1 ± 4.0	21.2 ± 12.0
	4-29	17.7 ± 3.0	24.7 ± 4.8
Family III	2-18	3.9 ± 1.3	6.6 ± 1.6
	2-29	4.0 ± 0.9	5.1 ± 1.4
	4-19	6.0 ± 2.1	8.2 ± 0.4

All aptamers can be subgrouped into high and low affinity binders. Differences between the two groups could only be manifested in the case of the family I RNAs. Strong binders are likely to adopt a stable pseudoknot structure which involves in part the conserved NGC base triplet of the hairpin loop sequence. However, further experiments are required to substantiate this hypothesis. In the case of the other two families, the binding strength differences must be due to other structural criteria. Among several possibilities, the length of the individual stem structures, a possible coaxial stacking of the helices and/or the spacing between conserved elements might account for this effect. Nevertheless, all tested RNAs specifically crosslink to the same 42 kDa protein which is present on the surface of both the MITat 1.2 and MITat 1.4 parasites. This is surprising for two reasons. First, given the complexity of the cell surface, one might have expected the selection of aptamers to different surface targets similar to what has been described by Morris et al. (26), using human erythrocyte ghosts. Second, none of the aptamers interacts with the most abundant polypeptide on the trypanosome surface, the VSG protein. Although we cannot exclude the possibility that the 42 kDa protein displays an epitope dominance as described by others (41-43), we attribute both phenomena to the unique situation of the trypanosome cell surface. The VSG layer is not only acting as a physical barrier, it also shows dynamic properties which enhance its protective function. VSG-bound antibodies, for instance, have been shown to be eliminated from the trypanosome surface by a rapid endocytotic turnover of the entire VSG layer through the flagellar pocket (44,45). Thus, any VSG-bound RNA was probably removed during the selection via this recycling reaction and, consequently, stable surface binding might have been restricted to the less abundant invariable surface elements.

Since the binding of the aptamers is restricted to the flagellar pocket of the parasites it is tempting to speculate that the 42 kDa protein might be ESAG 7, a subunit of the transferrin receptor. ESAG 7 has a molecular mass of 42 kDa, is located within the flagellar pocket and is exclusively expressed during the bloodstream life cycle stage of the parasite (46,47). In contrast, we estimated a copy number of about 70 000 molecules/trypanosome cell for the 42 kDa protein which is above the reported value of 2-3 × 10³ copies for the transferrin receptor (reviewed in 48). Thus, further experiments must be conducted to confirm this hypothesis, in addition to experiments that address the fate of the RNA after binding to the flagellar pocket.

Lastly, we cannot exclude the possibility that next to the interaction with the 42 kDa protein additional contact points between the aptamer and the trypanosome surface exist. Yang et al. (49) recently reported the selection of G-quartet DNA ligands with cellobiose. This opens up the possibility that the G-quartet RNAs of family II interact, at least in part, with a carbohydrate moiety. The trypanosome surface is abundantly glycosylated (50) and thus sugar residues could contribute to the RNA binding domain.

Three additional features of the aptamers are worth discussing. First, none of the RNAs bind to insect stage trypanosomes. This is likely to indicate that the surface target is bloodstream stage specific. Alternatively, the binding target might be accessible only in bloodstream stage cells because of steric and/or surface charge differences of the two life cycle stages. Second, none of the aptamers are capable of discriminating between the two parasite strain variants used in the selection scheme. This demonstrates that the aptamer/trypanosome interaction is independent of the particular VSG variant expressed on the trypanosome surface. Third, two unrelated trypanosome strains are also recognised by the aptamers. This may suggest that the selected RNAs can be applied to a greater range of trypanosome strains, provided the target protein is sterically accessible.

In summary, the selection of high affinity nucleic acid ligands presented in this study extends the range of applications of the SELEX methodology to living cells as binding targets. The identified RNA aptamers show high affinity binding and specificity for a single protein and as such they have the potential to be used as diagnostic as well as therapeutic tools. Their ability to bind to an invariant element on the trypanosome surface opens up the possibility of side-stepping the antigenic variation of the VSG coat. Binding to the flagellar pocket, the main site for endo- and exocytosis events, might further allow for a specific targeting of toxic components to intracellular compartments of the parasite.

ACKNOWLEDGEMENTS

We thank U. F. Müller for discussion and input in the quantification of the binding data. E. Weyher-Stingl is thanked for her help recording the CD spectra, M. Engstler and M. Boshart for providing T.brucei strains and F. Melchior for providing access to her digital imaging facility. P. Overath, G. A. M. Cross and A. S. Paul are thanked for critically reviewing the manuscript. We acknowledge the contributions of H. H. Shu during the early phase of the project, the secretarial help of A. Kohlhuber and the purification of VSG by M. Worbs. Metabion is thanked for expert oligodeoxynucleotide synthesis. The work was supported by a grant from the German Research Foundation (DFG) to H.U.G.

REFERENCES

1. Smith,D.H., Pepin,J. and Stich,A.H.R. (1998) Br. Med. Bull., 54, 341-355. MEDLINE Abstract

2. Hursey,B.S. and Slingenbergh,J. (1995) World Anim. Rev., 3-4, 67-73.

3. Taylor,K.A. (1998) Int. J. Parasitol., 28, 219-240. MEDLINE Abstract

4. Van Gompel,A. and Vervoort,T. (1997) Curr. Opin. Infect. Dis., 10, 469-474.

5. Takayanagi,T. and Enriquez,G.L. (1973) J. Parasitol., 59, 644-647. MEDLINE Abstract

6. Sternberg,J.M. (1998) Chem. Immunol., 70, 186-199. MEDLINE Abstract

7. Borst,P. and Rudenko,G. (1994) Science, 264, 1872-1873. MEDLINE Abstract

8. Cross,G.A.M. (1996) Bioessays, 18, 283-291. MEDLINE Abstract

9. Rudenko,G., Cross,M. and Borst,P. (1998) Trends Microbiol., 6, 113-117. MEDLINE Abstract

10. Carrington,M., Miller,N., Blum M., Roditi,I., Wiley,D. and Turner,M. (1991) J. Mol. Biol., 221, 823-835. MEDLINE Abstract

11. Blum,M.L., Down,J.A., Gurnett,A.M., Carrington,M., Turner,M.J. and Wiley,D.C. (1993) Nature, 362, 603-609. MEDLINE Abstract

12. Carrington,M. and Boothroyd,J. (1996) Mol. Biochem. Parasitol., 81, 119-126. MEDLINE Abstract

13. Lamont,G.S., Tucker,R.S. and Cross,G.A.M. (1986) Parasitology, 92, 355-367. MEDLINE Abstract

14. Turner,C.M. and Barry,J.D. (1989) Parasitology, 99, 67-75. MEDLINE Abstract

15. Bülow,R., Overath,P. and Davoust,J. (1988) Biochemistry, 27, 2384-2388. MEDLINE Abstract

16. Ziegelbauer,K., Multhaup,G. and Overath,P. (1992) J. Biol. Chem., 267, 10797-10803. MEDLINE Abstract

17. Ziegelbauer,K. and Overath,P. (1993) Infect. Immun., 61, 4540-4545. MEDLINE Abstract

18. Seyfang,A. and Duszenko,M. (1993) Eur. J. Biochem., 214, 593-597. MEDLINE Abstract

19. Nolan,D.P., Jackson,D.G., Windle,H.J., Pays,A., Geuskens,M., Michel,A., Voorheis,H.P. and Pays,E. (1997) J. Biol. Chem., 272, 29212-29221. MEDLINE Abstract

20. Cohn,C.S. and Gottlieb,M. (1997) Parasitol. Today, 13, 231-235.

21. Overath,P., Stierhof,Y.-D. and Wiese,M. (1997) Trends Cell Biol., 7, 27-33.

22. Johnson,J.G. and Cross,G.A.M. (1979) Biochem. J., 178, 689-697. MEDLINE Abstract

23. Tuerk,C. and Gold,L. (1990) Science, 249, 505-510. MEDLINE Abstract

24. Gold,L., Polisky,B., Uhlenbeck,O. and Yarus,M. (1995) Annu. Rev. Biochem., 64, 763-797. MEDLINE Abstract

25. Ellington,A.D. and Conrad,R. (1995) Biotechnol. Annu. Rev., 1, 185-214. MEDLINE Abstract

26. Morris,K.N., Jensen,K.B., Julin,C.M., Weil,M. and Gold,L. (1998)Proc. Natl Acad. Sci. USA, 95, 2902-2907. MEDLINE Abstract

27. Hirumi,H. and Hirumi,K. (1994) Parasitol. Today, 10, 80-84.

28. Cross,G.A.M. (1975) Parasitology, 71, 393-417. MEDLINE Abstract

29. Michiels,F., Matthyssens,G., Kronenberger,P., Pays,E., Dero,B., Van Assel,S., Darville,M., Cravador,A., Steinert,M. and Hamers,R. (1983) EMBO J., 2, 1185-1192. MEDLINE Abstract

30. Rice-Ficht,A.C., Chen,K.K. and Donelson,J.E. (1982) Nature, 298, 676-679. MEDLINE Abstract

31. Brun,R. and Schönenberger,M. (1979) Acta Trop., 36, 289-292. MEDLINE Abstract

32. Schmid,B., Riley,G., Stuart,K. and Göringer,H.U. (1995) Nucleic Acids Res., 23, 3093-3102. MEDLINE Abstract

33. Freymann,D., Down,J., Carrington,M., Roditi,I., Turner,M. and Wiley D. (1990) J. Mol. Biol., 216, 141-160. MEDLINE Abstract

34. Phillips,K., Dauter,Z., Murchie,A.I.H., Lilley,D.M.J. and Luisi,B. (1997) J. Mol. Biol., 273, 171-182. MEDLINE Abstract

35. Cheng,A.J. and van Dyke,M.W. (1997) Gene, 197, 253-260. MEDLINE Abstract

36. Macaya,R.F., Schultze,P., Smith,F.W., Roe,J.A. and Feigon,J. (1993)Proc. Natl Acad. Sci. USA, 90, 3745-3749. MEDLINE Abstract

37. Lauhon,C.T. and Szostak,J.W. (1995) J. Am. Chem. Soc., 117, 1246-1257.

38. Huizenga,D.E. and Szostak,J.W. (1995) Biochemistry, 34, 656-665. MEDLINE Abstract

39. Li,Y.F., Geyer,C.R. and Sen,D. (1996) Biochemistry, 35, 6911-6922. MEDLINE Abstract

40. Weiss,S., Proske,D., Neumann,M., Groschup,M.H., Kretzschmar,H.A., Famulok,M. and Winnacker,E.L. (1997) J. Virol., 71, 8790-8797. MEDLINE Abstract

41. Pan,W., Craven,R.C., Qiu,Q., Wilson,C.B., Wills,J.W., Golovine,S. and Wang,J.-F. (1995) Proc. Natl Acad. Sci. USA, 92, 11509-11513. MEDLINE Abstract

42. Ringquist,S., Jones,T., Snyder,E.E., Gibson,T., Boni,I. and Gold,L. (1995) Biochemistry, 34, 3640-3648. MEDLINE Abstract

43. Barry,M.A., Dower,W.J. and Johnston,S.A. (1996) Nature Med., 2, 299-305. MEDLINE Abstract

44. Webster,P., Russo,D.C.W. and Black,S.J. (1990) J. Cell Sci., 96, 249-255. MEDLINE Abstract

45. Russo,D.C.W., Grab,D.J., Lonsdale-Eccles,J.D., Shaw,M.K. and Williams,D.J.L. (1993) J. Cell Biol., 62, 432-441.

46. Steverding,D., Stierhof,Y.-D., Chaudhri,M., Ligtenberg,M., Schell,D., Beck-Sickinger,A.G. and Overath,P. (1994) Eur. J. Cell Biol., 64, 78-87. MEDLINE Abstract

47. Salmon,D., Geuskens,M., Hanocq,F., Hanocq-Quertier,J., Nolan,D., Ruben,L. and Pays,E. (1994) Cell, 78, 75-86. MEDLINE Abstract

48. Overath,P., Chaudhri,M., Steverding,D. and Ziegelbauer,K. (1994) Parasitol. Today, 10, 53-58.

49. Yang,Q., Goldstein,I.J., Mei,H.-Y. and Engelke,D.R. (1998) Proc. Natl Acad. Sci. USA, 95, 5462-5467. MEDLINE Abstract

50. McConville,M.J. (1996) In Smith,D.F. and Parsons,M. (eds), Molecular Biology of Parasitic Protozoa. IRL Press, Oxford, UK.

---

*To whom correspondence should be addressed. Tel: +49 89 8578 2475; Fax: +49 89 8578 3810; Email: goeringe@biochem.mpg.de

---

This page is run by Oxford University Press, Great Clarendon Street, Oxford OX2 6DP, as part of the OUP Journals
Comments and feedback: jnl.info{at}oup.co.uk
Last modification: 10 Apr 1999
Copyright©Oxford University Press, 1999.
CiteULike    Connotea    Del.icio.us    What's this?

This article has been cited by other articles:

				J. Konig, C. Julius, S. Baumann, M. Homann, H. U. Goringer, and M. Feldbrugge Combining SELEX and the yeast three-hybrid system for in vivo selection and classification of RNA aptamers RNA, April 1, 2007; 13(4): 614 - 622. [Abstract] [Full Text] [PDF]

				A. Mescalchin, W. Wunsche, S. D. Laufer, D. Grohmann, T. Restle, and G. Sczakiel Specific binding of a hexanucleotide to HIV-1 reverse transcriptase: a novel class of bioactive molecules Nucleic Acids Res., November 14, 2006; 34(19): 5631 - 5637. [Abstract] [Full Text] [PDF]

				T. C. Chu, K. Y. Twu, A. D. Ellington, and M. Levy Aptamer mediated siRNA delivery Nucleic Acids Res., June 1, 2006; 34(10): e73 - e73. [Abstract] [Full Text] [PDF]

				S. Fitter and R. James Deconvolution of a Complex Target Using DNA Aptamers J. Biol. Chem., October 7, 2005; 280(40): 34193 - 34201. [Abstract] [Full Text] [PDF]

				D. A. Daniels, H. Chen, B. J. Hicke, K. M. Swiderek, and L. Gold A tenascin-C aptamer identified by tumor cell SELEX: Systematic evolution of ligands by exponential enrichment PNAS, December 23, 2003; 100(26): 15416 - 15421. [Abstract] [Full Text] [PDF]

				M. Lorger, M. Engstler, M. Homann, and H. U. Goringer Targeting the Variable Surface of African Trypanosomes with Variant Surface Glycoprotein-Specific, Serum-Stable RNA Aptamers Eukaryot. Cell, February 1, 2003; 2(1): 84 - 94. [Abstract] [Full Text] [PDF]

				H. Ulrich, M. H. Magdesian, M. J. M. Alves, and W. Colli In Vitro Selection of RNA Aptamers That Bind to Cell Adhesion Receptors of Trypanosoma cruzi and Inhibit Cell Invasion J. Biol. Chem., May 31, 2002; 277(23): 20756 - 20762. [Abstract] [Full Text] [PDF]

				U. F. Muller and H. U. Goringer Mechanism of the gBP21-mediated RNA/RNA annealing reaction: matchmaking and charge reduction Nucleic Acids Res., January 15, 2002; 30(2): 447 - 455. [Abstract] [Full Text] [PDF]

				T. Hermann and D. J. Patel Adaptive Recognition by Nucleic Acid Aptamers Science, February 4, 2000; 287(5454): 820 - 825. [Abstract] [Full Text]

				B. J. Hicke, C. Marion, Y.-F. Chang, T. Gould, C. K. Lynott, D. Parma, P. G. Schmidt, and S. Warren Tenascin-C Aptamers Are Generated Using Tumor Cells and Purified Protein J. Biol. Chem., December 21, 2001; 276(52): 48644 - 48654. [Abstract] [Full Text] [PDF]

This Article Abstract Print PDF (318K) Alert me when this article is cited Alert me if a correction is posted Services Email this article to a friend Similar articles in this journal Similar articles in ISI Web of Science Similar articles in PubMed Alert me to new issues of the journal Add to My Personal Archive Download to citation manager Search for citing articles in: ISI Web of Science (47) Request Permissions Commercial Re-use Guidelines for Open Access NAR Content Google Scholar Articles by Homann, M. Articles by Goringer, H. U. Search for Related Content PubMed PubMed Citation Articles by Homann, M. Articles by Goringer, H. U. Related Collections Protein-nucleic acid interaction Social Bookmarking          What's this?