Nucleic Acids Research, 2000, Vol. 28, No. 2 605-609
© 2000 Oxford University Press
Measurement of locus copy number by hybridisation with amplifiable probes
Institute of Genetics, University of Nottingham, Queens Medical Centre, Nottingham NG7 2UH, UK, 1The Cyprus Institute of Neurology and Genetics, PO Box 3462, 1683 Nicosia, Cyprus and 2Centre for Medical Genetics, City Hospital, Hucknall Road, Nottingham NG5 1PB, UK
Received August 10, 1999; Revised October 28, 1999; Accepted November 4, 1999.
| ABSTRACT |
|---|
|
|
|---|
Despite its fundamental importance in genome analysis, it is only recently that systematic approaches have been developed to assess copy number at specific genetic loci, or to examine genomic DNA for submicroscopic deletions of unknown location. In this report we show that short probes can be recovered and amplified quantitatively following hybridisation to genomic DNA. This simple observation forms the basis of a new approach to determining locus copy number in complex genomes. The power and specificity of multiplex amplifiable probe hybridisation is demonstrated by the simultaneous assessment of copy number at a set of 40 human loci, including detection of deletions causing Duchenne muscular dystrophy and PraderWilli/Angelman syndromes. Assembly of other probe sets will allow novel, technically simple approaches to a wide variety of genetic analyses, including the potential for extension to high resolution genome-wide screens for deletions and amplifications.
| INTRODUCTION |
|---|
|
|
|---|
Abnormalities of locus copy number in genomic DNA can underlie a wide range of phenotypes, including many human genetic disorders. The largest of these changes can be detected cytogenetically, for example in monosomies and trisomies involving entire chromosomes, and segmental abnormalities such as 5p deletion in cri-du-chat syndrome. Deletions or duplications of genomic DNA too small to be detected by conventional cytogenetics (submicroscopic rearrangements) may be involved in the pathogenesis of cancer (14) and mental retardation (5,6). At the level of individual genes, specific inherited diseases can result from deletions or duplications involving entire genes or individual exons (710).
The detection of changes in copy number in a complex genome is, however, not straightforward (11). In principle, quantitative adaptations of PCR can be used to determine copy number (12,13), but suffer from the general disadvantage that analysing numerous loci simultaneously poses a formidable technical challenge. Cytogenetic methods, and in particular comparative genomic hybridisation (14,15), have the advantage that the whole genome is analysed in a single test, but in its technically simplest form it has relatively low resolution.
In this report we show that short amplifiable probes can be recovered quantitatively after hybridisation to genomic DNA. This observation forms the basis for a highly parallel assay for locus copy number in human DNA, and we illustrate its power and specificity in the detection of specific deletions in clinical DNA samples.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Probe preparation
Probes were prepared by cloning PCR products or blunt-ended restriction fragments from genomic clones (1620) into the EcoRV site of pZero2 (Invitrogen), and probe DNA amplified directly from bacterial cells (21) using flanking vector primers PZA (AGTAACGGCCGCCAGTGTGCTG) and PZB (CGAGCGGC-CGCCAGTGTGATG). Products amplified using 33P-end-labelled PZA were separated on denaturing 6% polyacrylamide/50% urea gels and probe mixes assembled such that the mobilities of all constituent probes were distinct.
Filter preparation and hybridisation conditions
Genomic DNA for immobilisation (0.51 µg) was prepared in an initial volume of <5 µl, denatured by addition of 1 µl 1 M NaOH, spotted onto an individual nylon filter (MSI MAGNA, dimensions ~2 x 4 mm), and irreversibly bound to the filter by UV irradiation. Filters were prehybridised together in 1 ml of prehybridisation solution (0.5 M sodium phosphate pH 7.2, 7% SDS, 0.1 mg/ml alkali-denatured herring sperm DNA) at 65°C, and before hybridisation this was exchanged for 200 µl of prehybridisation solution with the addition of denatured human Cot-1 DNA (Gibco BRL) to a final concentration of 10 µg/ml. Probe mixtures containing ~100 pg of each sequence in 1 µl were mixed with 7 µg Escherichia coli DNA (DH5
DNA, digested with HaeIII), 0.5 µg
X174/HaeIII DNA, 20 pmol end-blocking primers PZAX (AGTAACGGCCG-CCAGTGTGCTGGAATTCTGCAGAT) and PZBX (CGAG-CGGCCGCCAGTGTGATGGAT), and 1 µg human Cot-1 DNA (Gibco BRL), and denatured by adding 2 µl 1 M NaOH. End-blocking primers are added to prevent cross-hybridisation between different probes used in the same mixture. After 1 min at 37°C, the probe mixture was placed on ice, neutralised by adding 3 µl 1 M NaH2PO4, and added to the hybridisation solution.
Hybridisation was left to proceed at 65°C overnight, and the filters were washed at 65°C sequentially in (i) two 1 ml changes of prehybridisation solution, (ii) 500 ml 1x SSC/1% SDS and (iii) 500 ml 0.1x SSC/0.1% SDS. Washed filters were then transferred to individual 50 µl amplification reactions (constituents as for probe amplification), and bound DNA amplified for five cycles of 95°C for 1 min and 70°C for 1 min. This low level preamplified solution was then used to seed further 10 µl amplifications using 33P-5'-end-labelled primer PZA. Products were separated by denaturing PAGE (22), and radioactivity detected either by standard autoradiography or (for quantitative analysis) using ImageQuant software analysis on data captured by a storage phosphorimager screen (Molecular Dynamics).
Quantitative and statistical analysis
To produce normalised ratios, each measured band intensity was first divided by the sum of the two nearest autosomal band intensities (but excluding SNRPN) from the same sample. This provides a ratio which reflects the band intensity relative to its neighbours, and should be approximately constant for that probe (given constant dosage) across all the samples. The mean value of this ratio across all samples was then calculated, weighting males at 50% for X-linked loci and excluding females for Y-linked loci. The ratio of each individual band was then normalised to that mean value, to give the normalised ratios shown in Figure 3.
|
| RESULTS |
|---|
|
|
|---|
Specific DNA or RNA sequences can be detected in complex genomes by hybridisation using a specific probe, for example in Southern blot hybridisation and fluorescent in situ hybridisation (FISH); such methods have generally involved labelling the probe, followed by detection of the label (2326). In multiplex amplifiable probe hybridisation (MAPH), specific hybridisation to a test sample is detected by recovery and amplification of the probe itself (Fig. 1). Multiple loci can be detected simultaneously by preparing sets of different probes flanked by the same primer binding sites. Such sets are used in hybridisations with target nucleic acid, and all probes remaining bound after stringent washing can be amplified together with the same primer pair. A set can be assembled such that each contributing probe is distinguishable, for example by virtue of its gel mobility. Although different probes may be amplified with slightly different efficiencies, the proportional contribution from each locus will reflect its copy number in the sample. As it is the retained probe that is amplified, not the DNA in the sample, the gel mobility of the product is independent of (for example) substitutional polymorphism at that locus.
|
Figure 2 illustrates the appearance of copy number determination in 10 human DNA samples using MAPH at 40 loci, including some (DMD and SNRPN) involved in pathological deletions (causing Duchenne muscular dystrophy and PraderWilli/Angelman syndromes, respectively). After hybridisation to the immobilised genomic DNA samples and high stringency washing, specifically retained probes were amplified using the flanking primers. The Y-linked probes (SRY) are only detectable in tests using DNA from males, who also yield reduced signal from X-linked loci. After quantitative analysis (see below and Fig. 3), deletions of DMD (X-linked) or SNRPN (autosomal) previously characterised by standard analyses were correctly identified among these samples in a blind test: individual 9 (male) has a complete deletion of exon 53 of the DMD gene (probe DMD in Fig. 2); individuals 2 and 7 are female carriers of a deletion of this exon, resulting in a reduction in the relative intensity of this band. Individuals 1 and 6 have heterozygous deletions of SNRPN, demonstrated by three different probes from this gene, two of which are in the enlarged part of Figure 2.
|
Quantitative analysis of these data was performed by combining the results from these 10 samples with results from two further control samples, as well as results for these same 12 samples from a second experiment. Different probes give different signal intensities, and different samples yield different total signals. The intensity of each band was therefore compared with the nearest two autosomal bands, and the mean value of this ratio for any one probe across all samples was set to a value of 1.0 (with appropriate weighting for sex-linked bands; see also Materials and Methods). This procedure gives a normalised ratio which can be used as an index of the relative intensity of a given band in a given sample. The distributions of these normalised ratios are shown in Figure 3, and the summary statistics given in Table 1.
|
Relatively few pathological changes are detected in this study, but the larger scale detection of heterozygous deletions can be modelled by comparing the distribution of values from loci present at two copies (diploid in Table 1) with values from loci present at one copy (haploid). The combined data sets each approximate well to a normal distribution, and if a threshold ratio of 0.75 is used, the probability that a false positive call will be made (i.e. that an undeleted locus will yield a ratio <0.75) is about 0.014, and that a false negative call will be made (i.e. that a deleted locus will give a value >0.75) is about 0.0003. These predicted frequencies are consistent with the observed frequencies (Table 1).
The availability of data from two experiments using the same samples and the same probes allowed assessment of inter-assay variation by pairwise comparison of the corresponding data points. While the intra-assay comparisons generally produced standard deviations of ~10% of the means, the overall standard deviation from 468 pairwise comparisons was about 0.06 (Table 1).
| DISCUSSION |
|---|
|
|
|---|
We have used the observation that amplifiable probes can be recovered quantitatively after hybridisation to develop a format in which copy number was assessed at 40 loci in a single experiment. With the ultimate aim of a genome-wide survey of copy number, how might this approach be extended?
Probes in the size range 140600 bp have been used in these gel-based experiments, and careful size selection could lead to mixes containing more than 100 probes in this range, to be used (for example) as chromosome-specific subsets to analyse copy number at megabase resolution. Greater gel resolution, and therefore the potential to use more probes per test, may be possible using fluorescently labelled primers and apparatus and software designed for automated sequence analysis (27), and could in principle use multiple fluorophores in a single track. Our recent experience confirms that fluorescence detection may well improve the discrimination of the assay, but its generally lower dynamic range may limit its usefulness. It may be possible to overcome the limitations imposed by gel resolution, and thus to distinguish and quantify even larger numbers of different amplified probes, by using them to hybridise back to a reference grid of DNA from the probe set. This would be analogous to array-CGH (15) but without the need for fluorescence microscopy, and using preselected small probes capable of defining structural changes at higher resolution. Nevertheless, although the gel format may limit the number of probes used, it has the advantage of sample throughput: dozens of samples can be analysed on the same gel.
Because the loci analysed depend only on the probes chosen, by assembling different sets of probes, groups of loci appropriate to different biological questions can be examined. Work is in progress to assemble: (i) probes from the exons of genes subject to internal deletions, such as BRCA1 (9) and NF2 (10), at which mutation screening by exon amplification and sequence analysis can fail to reveal whole exon deletions; (ii) probes from sub-telomeric sequences, frequently involved in chromosomal rearrangements causing mental retardation (5,6); (iii) a set of 3000 single copy probes for whole genome scanning at megabase resolution; (iv) chromosome-specific subsets for higher resolution scanning. The work shown here uses genomic DNA as the target nucleic acid, but an obvious extension of this technology would be to use probes from known genes to analyse RNA (or cDNA) for highly parallel analysis of gene expression. Initial work (J.A.L.Armour and M.G.Hamshere, unpublished results) suggests that differential gene expression can indeed be examined using amplifiable probes.
The observed distributions of normalised signals from diploid (autosomal/X-linked in females) and haploid loci (X-linked loci in males and heterozygous deletions of SNRPN and DMD) allow predictions of the rate of false positive and false negative calls, which are consistent with the observed rates, and which may be partially reduced by further technical refinements. Using this assay to detect deletions and amplifications in (for example) mental retardation assumes that variation in the copy number of a locus is abnormal, rather than resulting from a polymorphism; wider application of this technique in unaffected controls has the potential to identify loci at which there are copy number polymorphisms. In principle, this technology can also be applied as a systematic screen for presence/absence differences between the genomes of closely related species, such as between humans and other primates.
| ACKNOWLEDGEMENTS |
|---|
We thank M. G. Hamshere, I. Young, J. D. Brook, R. G. Lloyd, A. Sharif, K. Carpenter and other colleagues for their help with this work. This work was made possible by funding from the University of Nottingham, and is the subject of a patent application. Requests for probes should be addressed to john.armour@ nott.ac.uk ; further updated details on methods and probes are available at http://www.nott.ac.uk/~pdzjala/maph/maph.html
| FOOTNOTES |
|---|
* To whom correspondence should be addressed. Tel: +44 115 9249924; Fax: +44 115 9709906; Email: john.armour@nott.ac.uk
| REFERENCES |
|---|
|
|
|---|
-
1 Baker,S.J., Fearon,E.R., Nigro,J.M., Hamilton,S.R., Preisinger,A.C., Jessup,J.M., van Tuinen,P., Ledbetter,D.H., Barker,D.F., Nakamura,Y., White,R. and Vogelstein,B. (1989) Science, 244, 217222.
2 Fearon,E., Cho,K.R., Nigro,J.M., Kern,S.E., Simons,J.W., Ruppert,J.M., Hamilton,S.R., Preisinger,A.C., Thomas,G., Kinzler,K.W. and Vogelstein,B. (1990) Science, 247, 4956.
3 Vogelstein,B., Fearon,E.R., Kern,S.E., Hamilton,S.R., Preisinger,A.C., Nakamura,Y. and White,R. (1989) Science, 244, 207211.
4 Solomon,E., Borrow,J. and Goddard,A.D. (1991) Science, 254, 11531160.
5 Flint,J., Wilkie,A.O.M., Buckle,V.J., Winter,R.M., Holland,A.J. and McDermid,H.E. (1995) Nature Genet., 9, 132139.[Web of Science][Medline]
6 Wong,A.C.C., Ning,Y., Flint,J., Clark,K., Dumanski,J., Ledbetter,D.H. and McDermid,H.E. (1997) Am. J. Hum. Genet., 60, 113120.[Web of Science][Medline]
7 Chamberlain,J.S., Gibbs,R.A., Ranier,J.E., Nguyen,P.N. and Caskey,C.T. (1988) Nucleic Acids Res., 16, 1114111156.
8 Lupski,J.R., Wise,C.A., Kuwano,A., Pentao,L., Parke,J.T., Glaze,D.G., Ledbetter,D.H., Greenberg,F. and Patel,P.I. (1992) Nature Genet., 1, 2933.[Web of Science][Medline]
9 Puget,N., Torchard,D., Serova-Sinilnikova,O.M., Lynch,H.T., Feunteun,J., Lenoir,G.M. and Mazoyer,S. (1997) Cancer Res., 57, 828831.
10 Zucman-Rossi,J., Legoix,P., Der Sarkissian,H., Cheret,G., Sor,F., Bernardi,A., Cazes,L., Giraud,S., Ollagnon,E., Lenoir,G. and Thomas,G. (1998) Hum. Mol. Genet., 7, 20952101.
11 Prior,T.W. (1998) Clin. Chem., 44, 703704.
12 Kim,J., Yu,W., Kovalski,K. and Ossowski,L. (1998) Cell, 94, 353362.[Web of Science][Medline]
13 Kalinina,O., Lebedeva,I., Brown,J. and Silver,J. (1997) Nucleic Acids Res., 25, 19992004.
14 Kallioniemi,A., Kallioniemi,O.P., Sudar,D., Rutovitz,D., Gray,J.W., Waldman,F. and Pinkel,D. (1992) Science, 258, 818821.
15 Pinkel,D., Segraves,R., Sudar,D., Clark,S., Poole,I., Kowbel,D., Collins,C., Kuo,W.-L., Chen,C., Zhai,Y., Dairkee,S.H., Ljung,B., Gray,J.W. and Albertson,D.G. (1998) Nature Genet., 20, 207211.[Web of Science][Medline]
16 Armour,J.A.L., Povey,S., Jeremiah,S. and Jeffreys,A.J. (1990) Genomics, 8, 501512.[Web of Science][Medline]
17 Armour,J.A.L., Crosier,M., Malcolm,S., Chan,J.C.-T. and Jeffreys,A.J. (1995) Proc. R. Soc. Lond. B, 261, 345349.[Medline]
18 Armour,J.A.L., Crosier,M. and Jeffreys,A.J. (1996) Ann. Hum. Genet., 60, 1120.[Web of Science][Medline]
19 Goldfarb,M., Shimizu,K., Perucho,M. and Wigler,M. (1982) Nature, 296, 404409.[Medline]
20 Nakamura,Y., Ballard,L., Leppert,M., OConnell,P., Lathrop,G.M., Lalouel,J.M. and White,R. (1988) Nucleic Acids Res., 16, 5707.
21 Sandhu,G.S., Precup,J.W. and Kline,B.C. (1989) Biotechniques, 7, 689690.[Web of Science][Medline]
22 Sambrook,J., Fritsch,E.F. and Maniatis,T. (1989) Molecular Cloning: A Laboratory Manual, 2nd Edn. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.
23 Southern,E.M. (1975) J. Mol. Biol., 98, 503517.[Web of Science][Medline]
24 Pardue,M.L. and Gall,J.G. (1969) Proc. Natl Acad. Sci. USA, 64, 600604.
25 John,H., Birnstiel,M. and Jones,K. (1969) Nature, 223, 582587.[Medline]
26 Bauman,J.G.J., Wiegant,J., Borst,P. and van Duijn,P. (1980) Exp. Cell Res., 138, 485490.
27 Smith,L.M., Sanders,J.Z., Kaiser,R.J., Hughes,P., Dodd,C., Connell,C.R., Heiner,C., Kent,S.B.H. and Hood,L.E. (1986) Nature, 321, 674679.[Medline]
This article has been cited by other articles:
![]() |
C. Cunniff, J. Andrews, F. J. Meaney, K. D. Mathews, D. Matthews, E. Ciafaloni, T. M. Miller, J. B. Bodensteiner, L. A. Miller, K. A. James, et al. Mutation Analysis in a Population-Based Cohort of Boys With Duchenne or Becker Muscular Dystrophy J Child Neurol, April 1, 2009; 24(4): 425 - 430. [Abstract] [PDF] |
||||
![]() |
E. J. Hollox, J. C.K. Barber, A. J. Brookes, and J. A.L. Armour Defensins and the dynamic genome: What we can learn from structural variation at human chromosome band 8p23.1 Genome Res., November 1, 2008; 18(11): 1686 - 1697. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. M. Williams, H. Williams, E. Majounie, N. Norton, B. Glaser, H. R. Morris, M. J. Owen, and M. C. O'Donovan Analysis of copy number variation using quantitative interspecies competitive PCR Nucleic Acids Res., October 1, 2008; 36(17): e112 - e112. [Abstract] [Full Text] [PDF] |
||||
![]() |
F Chibon, C Primois, J-M Bressieux, D Lacombe, C Lok, L Mauriac, A Taieb, and M Longy Contribution of PTEN large rearrangements in Cowden disease: a multiplex amplifiable probe hybridisation (MAPH) screening approach J. Med. Genet., October 1, 2008; 45(10): 657 - 665. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Isaksson, J. Stenberg, F. Dahl, A.-C. Thuresson, M.-L. Bondeson, and M. Nilsson MLGA a rapid and cost-efficient assay for gene copy-number analysis Nucleic Acids Res., September 27, 2007; 35(17): e115 - e115. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. L. Pollex and R. A. Hegele Copy Number Variation in the Human Genome and Its Implications for Cardiovascular Disease Circulation, June 19, 2007; 115(24): 3130 - 3138. [Full Text] [PDF] |
||||
![]() |
J. A. L. Armour, R. Palla, P. L. J. M. Zeeuwen, M. d. Heijer, J. Schalkwijk, and E. J. Hollox Accurate, high-throughput typing of copy number variation using paralogue ratios from dispersed repeats Nucleic Acids Res., February 16, 2007; 35(3): e19 - e19. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Crepin, P. Pigny, F. Escande, C. C. Bauters, A. Calender, S. Lefevre, M.-P. Buisine, N. Porchet, and M.-F. Odou Evaluation of denaturing high performance liquid chromatography for the mutational analysis of the MEN1 gene. J. Mol. Endocrinol., April 1, 2006; 36(2): 369 - 376. [Abstract] [Full Text] [PDF] |
||||
![]() |
C Rosenberg, J Knijnenburg, E Bakker, A M Vianna-Morgante, W Sloos, P A Otto, M Kriek, K Hansson, A C V Krepischi-Santos, H Fiegler, et al. Array-CGH detection of micro rearrangements in mentally retarded individuals: clinical significance of imbalances present both in affected children and normal parents J. Med. Genet., February 1, 2006; 43(2): 180 - 186. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. M.R. Aldred, E. J. Hollox, and J. A.L. Armour Copy number polymorphism and expression level variation of the human {alpha}-defensin genes DEFA1 and DEFA3 Hum. Mol. Genet., July 15, 2005; 14(14): 2045 - 2052. [Abstract] [Full Text] [PDF] |
||||
![]() |
D Bornholdt, A Konig, R Happle, L Leveleki, M Bittar, R Danarti, A Vahlquist, W Tilgen, U Reinhold, A Poiares Baptista, et al. Mutational spectrum of NSDHL in CHILD syndrome J. Med. Genet., February 1, 2005; 42(2): e17 - e17. [Full Text] [PDF] |
||||
![]() |
S Deutsch, U Choudhury, G Merla, C Howald, A Sylvan, and S E Antonarakis Detection of aneuploidies by paralogous sequence quantification J. Med. Genet., December 1, 2004; 41(12): 908 - 915. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Dehainault, A. Lauge, V. Caux-Moncoutier, S. Pages-Berhouet, F. Doz, L. Desjardins, J. Couturier, M. Gauthier-Villars, D. Stoppa-Lyonnet, and C. Houdayer Multiplex PCR/liquid chromatography assay for detection of gene rearrangements: application to RB1 gene Nucleic Acids Res., October 11, 2004; 32(18): e139 - e139. [Abstract] [Full Text] [PDF] |
||||
![]() |
M A Aldred, R O C Sanford, N S Thomas, M A Barrow, L C Wilson, L A Brueton, M C Bonaglia, R C M Hennekam, C Eng, N R Dennis, et al. Molecular analysis of 20 patients with 2q37.3 monosomy: definition of minimum deletion intervals for key phenotypes J. Med. Genet., June 1, 2004; 41(6): 433 - 439. [Full Text] [PDF] |
||||
![]() |
M Kriek, S J White, M C Bouma, H G Dauwerse, K B M Hansson, J V Nijhuis, B Bakker, G-J B van Ommen, J T den Dunnen, and M H Breuning Genomic imbalances in mental retardation J. Med. Genet., April 1, 2004; 41(4): 249 - 255. [Abstract] [Full Text] [PDF] |
||||
![]() |
D P Locke, R Segraves, R D Nicholls, S Schwartz, D Pinkel, D G Albertson, and E E Eichler BAC microarray analysis of 15q11-q13 rearrangements and the impact of segmental duplications J. Med. Genet., March 1, 2004; 41(3): 175 - 182. [Abstract] [Full Text] [PDF] |
||||
![]() |
S M Akrami, J S Rowland, G R Taylor, and J A L Armour Diagnosis of gene dosage alterations at the PMP22 gene using MAPH J. Med. Genet., November 1, 2003; 40(11): e123 - 123. [Full Text] [PDF] |
||||
![]() |
S J White, E Sterrenburg, G-J B van Ommen, J T den Dunnen, and M H Breuning An alternative to FISH: detecting deletion and duplication carriers within 24 hours J. Med. Genet., October 1, 2003; 40(10): e113 - 113. [Full Text] [PDF] |
||||
![]() |
B B A De Vries, R Winter, A Schinzel, and C van Ravenswaaij-Arts Telomeres: a diagnosis at the end of the chromosomes J. Med. Genet., June 1, 2003; 40(6): 385 - 398. [Abstract] [Full Text] [PDF] |
||||
![]() |
E J Hollox, T Atia, G Cross, T Parkin, and J A L Armour High throughput screening of human subtelomeric DNA for copy number changes using multiplex amplifiable probe hybridisation (MAPH) J. Med. Genet., November 1, 2002; 39(11): 790 - 795. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. P. Schouten, C. J. McElgunn, R. Waaijer, D. Zwijnenburg, F. Diepvens, and G. Pals Relative quantification of 40 nucleic acid sequences by multiplex ligation-dependent probe amplification Nucleic Acids Res., June 15, 2002; 30(12): e57 - e57. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. M Akrami, R. M Winter, J D. Brook, and J. A L Armour Detection of a large TBX5 deletion in a family with Holt-Oram syndrome J. Med. Genet., December 1, 2001; 38 (12): e44 - e44. [Full Text] [PDF] |
||||
![]() |
J. S Rowland, D. E Barton, G. R Taylor, and UK Clinical Molecular Genetics Society HMSN Projec A comparison of methods for gene dosage analysis in HMSN type 1 J. Med. Genet., February 1, 2001; 38(2): 90 - 95. [Abstract] [Full Text] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||









