Nucleic Acids Research, 2000, Vol. 28, No. 20 3999-4004
© 2000 Oxford University Press
Elongation of repetitive DNA by DNA polymerase from a hyperthermophilic bacterium Thermus thermophilus
Taiko Pharmaceutical Co., Ltd, 3-34-14 Uchihonmachi, Suita, Osaka 564-0032, Japan
Received May 31, 2000; Revised and Accepted August 21, 2000.
| ABSTRACT |
|---|
|
|
|---|
Short repetitive DNA sequences are believed to be one of the primordial genetic elements that served as a source of complex large DNA found in the genome of modern organisms. However, the mechanism of its expansion (increase in repeat number) during the course of evolution is unclear. We demonstrate that the DNA polymerase of the hyperthermophilic bacterium Thermus thermophilus can elongate oligoDNA with several tandem repeats to very long DNA in vitro. For instance, 48mer repetitive oligoDNA (TACATGTA)6, which has 25% GC content and a palindromic sequence, can be elongated up to
10 000 bases by DNA polymerase at 74°C without template DNA. OligoDNA having a different GC content or a quasi-palindromic sequence can also be elongated, but less efficiently. A spectroscopic thermal melting experiment with the oligoDNA showed that its hairpincoil transition temperature was very close to the elongation reaction temperature (74°C), but was much higher than the temperature at which duplex oligoDNA can exist stably. Taken together, we conclude that repetitive oligoDNA with a palindromic or quasi-palindromic sequence is elongated extensively by a hyperthermophilic DNA polymerase through hairpincoil transitions. We propose that such an elongation mechanism might have been a driving force to expand primordial short DNA. | INTRODUCTION |
|---|
|
|
|---|
The complex genomes of higher organisms are believed to have diversified by means of various mechanisms, such as unequal crossing over and gene duplication (1,2). Ohno proposed that modern coding sequences of DNA evolved from primordial oligomeric repeats and that these primordial oligomeric repeats were elongated progressively during the course of evolution (36). Other investigators also independently arrived at the conclusion that all polypeptide chains were originally endowed with short periodicity, thus implying an original internal repetitive structure in all coding sequences (7,8). Tandem repetitive DNA sequences are found in many organisms (923). Although the functions of these tandem repetitive sequences are not fully understood, some have recently been elucidated. For instance, telomere DNA has the structure (TTGGGG)n and it is believed to maintain the integrity of the end of chromosomal DNA (2123). However, except for telomere DNA, the mechanism of elongation (expansion of repeat number) of repetitive sequences is not well understood.
We have recently found (2426) that the DNA polymerase of the hyperthermophilic archaeon Thermococcus litoralis (24,25) and eubacterium Thermus thermophilus (Tth) (26) can creatively synthesize a large stretch of DNA from the four deoxyribonucleoside triphosphates (dNTPs), namely dATP, dTTP, dGTP and dCTP, without adding a primertemplate DNA complex, an element required for common replicative DNA synthesis by DNA polymerases (27). Such ab initio DNA synthesis can be interpreted as the creation of genetic information by a protein, because in this reaction (2426) genetic material is not copied from pre-existing genetic material, namely template DNA needed for the common reaction by DNA polymerases, but is made from a hitherto unknown source of information, if it ever existed. The DNA product synthesized without primer and template DNAs by these DNA polymerases of hyperthermophilic bacteria had the sequences, for instance, (TACATGTA)n, (TGTATGTATACATACATA)n and (TATACGTA)n (2426,28,29). These DNA sequences primarily had a structure of palindromic or quasi-palindromic tandem repeats and the motif sequence (unit sequence) of the repeats had a length of 436 bases. The GC content of these sequences is linearly related to the reaction temperature and ranges from 0 to 83% depending upon the reaction temperature (2426,28,29).
Based upon the above findings we thought that oligoDNA having such a repetitive motif sequence might be elongated to long DNA with the same tandem repeat sequence structure in the complete absence of a primertemplate complex when added to a DNA polymerase reaction mixture. As expected, we demonstrate in this paper that such oligoDNA, added to a reaction mixture of Tth DNA polymerase, strongly enhances DNA synthesis, due to elongation, by a unique reaction mechanism different from the common replicative DNA synthesis reaction. We further demonstrate that the presence of a palindromic sequence and defined GC content in the oligoDNA are important in this reaction. As DNA synthesis (predominantly elongation of the added oligoDNA) occurs around the hairpincoil transition temperature of the added oligoDNA, we speculate that elongation of the oligoDNA occurs through a hairpincoil transition. The implication of this DNA elongation mechanism, in terms of expansion of primordial genetic material, is discussed.
| MATERIALS AND METHODS |
|---|
|
|
|---|
DNA synthesis reaction by Tth and
Tth DNA polymerasesDNA synthesis by Tth DNA polymerase (Boehringer Mannheim, Mannheim, Germany) or recombinant
Tth DNA polymerase (Toyobo, Osaka, Japan), a mutant of Tth DNA polymerase in which 5'
3' exonuclease activity is lacking (30), was carried out essentially as described previously (26). The standard reaction mixture (20 µl) consisted of 50 mM KCl, 10 mM TrisHCl buffer (pH 9.0 at 25°C, pH 7.5 at 74°C), 1.5 mM MgCl2, 200 µM each of four dNTPs and 25 U/ml of either Tth or
Tth DNA polymerase. The dNTPs were unlabeled or labeled at the
position with 32P, the final specific activity being 110 µCi/µmol (4.0 MBq/µmol). OligoDNA was added at a concentration of 1 µg/ml, unless specified otherwise. The oligoDNA most frequently used was (TACATGTA)6; it is referred to as the standard oligoDNA. (The DNA sequence is always written 5'
3'.) Other oligoDNAs had similar but slightly different sequences from the standard oligoDNA. As a negative control a 48mer single-stranded DNA having the sequence GAATTATTTTTGATGGCGTTAACTCGGCGTTTCATCTGTGGTGCAACG was used; this sequence was derived from the sequence (nt 17051752) of the ß-galactosidase gene of Escherichia coli (31). All oligoDNAs were purchased from Amersham Pharmacia Biotech (Tokyo, Japan) and their 5'-end was phosphorylated. Except for the time course study, the DNA synthesis reaction was carried out at 74°C for 30 min. The DNA synthesis reaction was terminated by the addition of 0.8 µl of 500 mM EDTA (pH adjusted to 8.0 with NaOH). An aliquot (2 µl) of the reaction mixture was next transferred to another tube containing a solution (98 µl) of 1 mg/ml salmon testis DNA (Sigma, St Louis, USA) in 10 mM TrisHCl buffer (pH 8.0) and 1 mM EDTA. Next, 500 µl of a solution containing 6% (w/v) trichloroacetic acid and 1.2% (w/v) pyrophosphoric acid was added to the mixture. The acid-insoluble material thus formed was next collected on a glass microfibre filter disc (24 mm diameter GF/C filter; Whatman, Maidstone, UK) by gentle aspiration. The filter disc was washed immediately four times with 5 ml of 5% (w/v) trichloroacetic acid containing 1% (w/v) pyrophosphoric acid and finally with 5 ml of ethanol. The filter disc was dried and radioactivity was counted using a liquid scintillation counter. The coefficient of variation of the assay was 5%.
Analysis by electrophoresis
The DNA synthesis reaction mixture (20 µl) was electrophoresed on a 1% (w/v) agarose gel (Seakem GTG; FMC, Rockland, USA) under non-denaturing conditions as described (32). The gel was stained with 0.5 µg/ml ethidium bromide and photographed under UV illumination (32). In another experiment an aliquot (4 µl) of the DNA synthesis reaction mixture containing four [
-32P]dNTPs was electrophoresed on a 6% (w/v) polyacrylamide gel under denaturing conditions (8 M urea) and the gel was visualized by autoradiography.
Characterization of the product of the DNA synthesis reaction
3'-End-labeling of the standard oligoDNA was performed by extending the 47mer oligoDNA (TACATGTA)5TACATGT by 1 nt with [
-32P]dATP with
Tth DNA polymerase at 74°C for 30 min, as in the so-called fill-in reaction of DNA having a 5'-overhang end (32) making use of the repetitive and palindromic nature of the sequence of the oligoDNA. We expected that the oligoDNA strand would fold back and its 5'-arm would serve as an intramolecular template for incorporation of [
-32P]dATP at the 3'-end. The labeled oligoDNA was next treated with phenol/chloroform and recovered by ethanol precipitation (32).
The amount of DNA chains before and after the reaction with DNA polymerase was measured as the amount of [
-32P]dNTP incorporated as 1 nt at the 3'-end, based upon the mechanism described above for 3'-end-labeling. However, because of uncertainty as to the 3'-end sequence of the DNA obtained after the elongation reaction with DNA polymerase, the DNA product was divided into four portions and each portion was incubated with one of the four [
-32P]dNTPs individually.
Spectroscopic measurement of thermal melting temperature
The thermal melting temperature (Tm) of each oligoDNA was determined from a temperature versus absorbance curve at 260 nm, using a spectrophotometer (Ubest-50; Jusco, Tokyo, Japan) equipped with a cell holder connected to a temperature controlled water circulator (F-25; Julabo, Seelbach, Germany) which was provided with a computer controlled temperature programmer. The absorbance curve was obtained at an oligoDNA concentration of 10 µg/ml by increasing the temperature from 20 to 100°C at a rate of 0.25°C/min in a 700 µl solution containing 10 mM KCl, 10 mM (NH4)2SO4, 6 mM MgSO4 and 20 mM TrisHCl buffer (pH 8.8). The cuvette containing the sample solution was layered with mineral oil and was capped loosely during the measurement of absorbance to prevent evaporation. The Tm was measured from the peak of the derivative of the temperature versus absorbance curve. The concentrations of oligoDNA were determined using an extinction coefficient of 7000 M1 cm1 for pyrimidine bases and 14 000 M1 cm1 for purine bases. The coefficient of variation of Tm measurement was 0.1%.
| RESULTS |
|---|
|
|
|---|
Enhancement of DNA synthesis by oligoDNA: its elongation by Tth and
Tth DNA polymerasesWhen Tth DNA polymerase was incubated for 30 min with the four dNTPs, DNA synthesis occurred, as measured by the amount of radioactive deoxyribonucleoside monophosphate (dNMP) incorporated in acid-insoluble material, at 74°C without a primertemplate complex (Fig. 1A). The result confirmed our previous observation of ab initio DNA synthesis by Tth DNA polymerase (26). The amount of DNA synthesized was 12 pmol by Tth DNA polymerase and <1 pmol by
Tth DNA polymerase, a mutant Tth DNA polymerase lacking 5'
3' exonuclease activity (30), when no oligoDNA was added to the reaction mixture (Table 1). On the other hand, when the 48mer standard palindromic oligoDNA (TACATGTA)6 was added to the reaction mixture DNA synthesis increased markedly, with both Tth DNA polymerase (recombinant and native forms from five manufacturers) and
Tth DNA polymerase (Fig. 1A and Table 1). This result indicates that the oligoDNA can enhance DNA synthesis catalyzed by Tth and
Tth DNA polymerase and that the endogenous 5'
3' exonuclease activity of Tth DNA polymerase is not required for this phenomenon. At a concentration of 1 µg/ml oligoDNA the amount of DNA synthesized in 30 min (
600 ng) was
30 times greater than the amount of oligoDNA added to the reaction mixture (20 ng). This means that the reaction is not a result of DNA synthesis in which the added oligoDNA merely served as a primertemplate complex, an element required for common replicative DNA synthesis (27). If this were the case, the maximum amount of DNA synthesized would be about the same as the amount of added oligoDNA. A 48mer DNA fragment derived from the ß-galactosidase gene, used as a control, showed no activity in increasing DNA synthesis (Table 1), indicating that the activity found in the above 48mer standard oligoDNA is not a general phenomenon found in any DNA.
|
|
The time course of DNA synthesis with and without 1 µg/ml oligoDNA was examined next; the initial rate of synthesis by Tth DNA polymerase was 3.3 pmol/min without oligoDNA (Fig. 1A, open circles). This result confirmed our previous finding of ab initio DNA synthesis (2426), where DNA synthesis was observed without adding a primertemplate complex. The initial rate of synthesis increased markedly (130 pmol/min) when the 48mer standard oligoDNA (TACATGTA)6 was added (Fig. 1A, filled circles). The result suggests that the added standard oligoDNA acted as a precursor for DNA synthesis. As the oligoDNA has a palindromic sequence, it is self-complementary. Therefore, it is possible that it merely formed a bimolecular homoduplex structure and worked as a primertemplate complex (27). An alternative possibility is that each molecule of the oligoDNA formed a hairpin structure (3340). We will discuss these possibilities later.
Essentially the same result was found in the reaction catalyzed by
Tth DNA polymerase in the presence of the standard oligoDNA, but the initial rate of synthesis was greater (300 pmol/min) (Fig. 1A, filled triangles) than the initial rate by Tth DNA polymerase. The maximum amount of DNA synthesized was 5.2 nmol after 24 h. This corresponds to 32.5% of the theoretically possible maximal amount of DNA that could be synthesized if all four dNTPs present in the reaction mixtures were converted to DNA (16 nmol). No DNA synthesis was seen with
Tth DNA polymerase when the standard oligoDNA was absent from the reaction mixture (Fig. 1A, open triangles). The size of DNA synthesized with and without the standard oligoDNA was >7 kb, as demonstrated by gel electrophoresis (Fig. 1B). These results strongly suggest that the oligoDNA added to the reaction mixture served as precursor DNA for DNA synthesis and that it was elongated by Tth and
Tth DNA polymerases. Elongation of the added oligoDNA was confirmed by the increase in the size of 3'-end-labeled oligoDNA after the reaction (Fig. 1C).
The effect of the added oligoDNA on the amount of the DNA synthesized was further examined by changing the length of oligoDNA of the (TACATGTA)n series. An enhancing effect of the oligoDNA added to the Tth DNA polymerase reaction mixture was observed for oligoDNAs having lengths of (TACATGTA)3 to (TACATGTA)15, but was maximal with the 48mer (TACATGTA)6 (data not shown). The same trend was observed for DNA synthesis by
Tth DNA polymerase.
Effect of the nucleotide sequence of oligoDNA on DNA synthesis: importance of GC content and a palindromic sequence
We next examined the effect of nucleotide sequence of the oligoDNA added to the reaction mixture by changing its repetitive motif sequence without changing its length or the number of repeats from those of the standard oligoDNA, (TACATGTA)6 (data not shown). For instance, when palindromic oligoDNA (GACATGTC)6 (nucleotides different from the standard oligoDNA are shown in bold) was added to the reaction mixture in place of the standard oligoDNA, DNA synthesis was 0.02 nmol with Tth DNA polymerase compared to 1.8 nmol for the standard oligoDNA. With the exception of (AGGTACCT)6, DNA synthesis decreased when the GC content of the oligoDNA was different from that of the standard oligoDNA, whose GC content was 25%, although all the oligoDNAs examined had a palindromic sequence and were the same length. The results indicate that the GC content of the oligoDNA is important for oligoDNA elongation.
The standard oligoDNA has a palindromic structure in its repetitive motif sequence. (Note that the entire sequence of tandem repetitive DNA also has a palindromic structure if its repetitive motif sequence has a palindromic structure.) We next addressed the question of whether destruction of the palindromic structure in oligoDNA had an effect on DNA synthesis by Tth and
Tth DNA polymerases. For instance, when the repetitive motif sequence TACATGTA in the standard oligoDNA was replaced by TACATGTT, which had a quasi-palindromic structure due to substitution of T for A, DNA synthesis by Tth DNA polymerase decreased markedly (0.4 nmol, Table 1). The same effect of destruction of the palindromic structure was also found for
Tth DNA polymerase, but the effect was much more marked than for Tth DNA polymerase (0.001 nmol, Table 1).
Characterization of DNA products synthesized by Tth and
Tth DNA polymerases
The nucleotide sequences of the reaction products of Tth and
Tth DNA polymerases in the presence of oligoDNA were analyzed by treating them with various restriction enzymes. As shown in Figure 2, the product DNA was digested by restriction enzymes having a recognition sequence that was found in the oligoDNA added to the DNA synthesis reaction. For instance, AccI has a recognition sequence GTATAC and the standard oligoDNA added to the DNA synthesis reaction had the sequence (TACATGTA)6, which contains five AccI recognition sequences. As shown in Figure 2 (lanes 2 and 4), the product DNAs made by Tth DNA polymerase (lane 1) and
Tth DNA polymerase (lane 3) were completely digested by AccI, indicating that the product DNAs have many GTATAC sequences. The results suggest that the product DNAs have the same sequence as the oligoDNA added to the reaction mixture. The finding that the sequence of the oligoDNA added to the reaction mixture was also present in the product DNA was further confirmed by molecular cloning of the product DNA. As expected, the cloned DNA had the same sequence as the oligoDNA added to the DNA synthesis reaction (data not shown).
|
The amount of DNA chains measured by the 3'-end-labeling method was 1.26 pmol before the reaction, which was consistent with 20 ng (1.35 pmol) of 48mer oligoDNA added to the reaction mixture. On the other hand, the amounts of DNA chains were 3.16 and 1.60 pmol after the reaction with Tth and
Tth DNA polymerase, respectively. While there was a slight increase in the amount of DNA chains after the reaction, this increase was much smaller than the increase in the amount of total DNA synthesized in terms of dNMP incorporation (30-fold increase). This means that the DNA synthesis found in the standard reaction predominantly reflects elongation of the added oligoDNA. We also found that DNA polymerases from the hyperthermophilic eubacterium Thermus flavus and two hyperthermophilic archaea Pyrococcus furiosus and Pyrococcus kodakaraensis could also elongate repetitive palindromic oligoDNA at 74°C (data not shown).
Thermal melting temperature of oligoDNA
Repetitive palindromic oligoDNA, for instance (TACTAGTA)6, can potentially make a hairpin structure (3341). It is also possible that it forms a bimolecular homoduplex structure, because the sequence is self-complementary. When a solution of repetitive palindromic oligoDNA (TACTAGTA)6 was heated, the absorbance of the solution at 260 nm increased, a phenomenon known as hyperchromicity of DNA (Fig. 3). There were two temperatures at which an abrupt increase in the absorbance occurred, namely 27.4 and 71.0°C. The first abrupt increase in absorbance was caused by a duplexhairpin transition (transition 1), the second abrupt increase by a hairpincoil transition (transition 2), as pointed out by Xodo et al. in various palindromic DNAs (3537,39,41). (The coil is defined as unstructured single-stranded DNA having no specific secondary structure.) Such a biphasic absorbance profile of palindromic DNAs has also been confirmed by other investigators (33,34,38).
|
We next examined whether there was any difference in the Tm of the hairpincoil transition (transition 2) of various 48mer repetitive oligoDNAs having a palindromic structure and 25% GC content in a repetitive motif sequence. All the oligoDNAs having these characteristics had Tm values of the hairpincoil transition in the range 70.974.6°C (72.6 ± 1.4°C, mean ± SD of seven oligoDNAs). The fact that the reaction temperature (74°C) is very close to the Tm of the hairpincoil transition strongly suggests that the DNA synthesis reaction, as shown by elongation of the added oligoDNA (Fig. 1), involves hairpincoil transitions and that the duplexhairpin transition is not involved in this elongation reaction, because it is hardly possible for the oligoDNA added to the reaction mixture to take a duplex conformation at 74°C. Note that the Tm of the duplexhairpin transition is much lower (25.7 ± 3.3°C) than 74°C, which means that almost no duplex DNA exists at 74°C. Based on these results, we conclude that short repetitive sequence DNA having a palindromic or quasi-palindromic sequence motif can be elongated by Tth DNA polymerase at high temperature through hairpincoil transitions.
| DISCUSSION |
|---|
|
|
|---|
Based upon the above results, we propose a novel mechanism for the elongation of tandem repetitive DNA. As the standard oligoDNA has a repetitive structure and its motif sequence is palindromic, there are many potential (11 in the standard oligoDNA) fold-back points to form a hairpin structure (Fig. 4). For instance, as shown in Figure 4, the oligoDNA can form a hairpin structure by folding back at one of the potential fold-back points. DNA polymerase next extends the hairpin oligoDNA from its 3'-end until the growing 3'-end reaches the 5'-end. The extended oligoDNA then melts completely or partially and again forms a hairpin structure. When the hairpin again forms a 5'-end overhang structure (Fig. 4), it will be extended. DNA elongation proceeds by repeating the cycle of melting (complete or partial) and hairpin formation.
|
Kornberg et al. reported elongation of oligo(dAT) using DNA polymerase I of E.coli at 37°C (42). Regarding this work, Elson suggested that the reaction occurred by a slippage mechanism (43). According to his model, oligo(dAT) is elongated by repeated slipping of the oligo(dAT) along the product strand to expose template sites; the rate of synthesis is proportional to the equilibrium concentration of either exposed template sites or template sites occupied by substrate molecules. The Elson model indicates that oligo(dAT) is elongated by a mechanism involving a duplexcoil transition, but not involving a hairpincoil transition. This is in agreement with the duplexcoil transition temperature (Tm) of oligo(dAT), which is between 10 and 40°C. This Tm value is within the range of the optimal reaction temperature of E.coli DNA polymerase I.
Schlotterer and Tautz reported elongation of oligo(dTCC)/oligo(dGGA) using the Klenow fragment of E.coli DNA polymerase I at 37°C (44). They also suggested a slippage mechanism for the elongation of oligo(dTCC)/oligo(dGGA) (44). In the DNA synthesis model of Kornberg et al. (42) and Schlotterer and Tautz (44) the authors postulated the presence of bimolecular duplex DNA having a 5'-overhang. Such bimolecular duplex DNA is commonly known as a primertemplate complex, and it is required for DNA synthesis (27). As demonstrated in Figure 3, the melting temperature of duplex oligoDNA is 25.7 ± 3.3°C, which is much lower than the reaction temperature employed in our reaction (74°C), whereas the reaction temperature employed by Kornberg et al. (42) and Schlotterer and Tautz (44) was 37°C. This means that a hairpincoil transition (transition 2, Fig. 3) could not be involved in their reaction, whereas a duplexhairpin transition (transition 1, Fig. 3) [in the case of oligo(dAT), as it is palindromic and can form a hairpin structure] or duplexcoil transition may well be involved, judging from the temperature of 37°C employed in their reactions. In the reaction shown in our present work the reaction temperature (74°C) was too high for a duplex structure to stably exist (Fig. 3); we need to introduce a reaction mechanism of elongation in a hairpincoil transitional state as an alternative mechanism of elongation (Fig. 4). According to this mechanism, a hairpincoil transitional state is required for elongation of simple repetitive oligoDNA having a palindromic or quasi-palindromic sequence.
Vallone et al. found an increase in the Tm of the hairpincoil transition in oligoDNA when its GC content increased (38). It is plausible that elongation of the oligoDNA occurs at or near the equilibrium condition of the hairpincoil transition and that if the Tm of the hairpincoil transition of a certain oligoDNA is close to the reaction temperature, the oligoDNA is elongated, whereas if the Tm is far from the reaction temperature, because of increased or decreased GC content, it is not elongated, exactly as we found. This view is consistent with our previous finding that DNA synthesized ab initio by the DNA polymerase of T.litoralis had a GC content which is dependent upon the reaction temperature: there was a good linear correlation between the GC content and the reaction temperature (25).
A tandem repetitive sequence is one of the major components of the genomes of modern organisms (1123). Although it is believed that they originated from short sequences, the process involved in elongation (expansion) remains unclear. When we searched the GenBank DNA database for a tandem repetitive sequence of (8mer)2 structure, where the nucleotide sequence of the 8mer motif was chosen arbitrarily, to determine the frequency of a palindromic structure in natural genes, we found that 2.3% of matched sequences were palindromic for the 8mer motif sequence. This value is 6.0 times higher (P < 0.05, t-test) than that expected if palindromic sequences are found at random. When we further searched the database for the presence of a matched sequence of 25% GC palindromic (8mer)2, which has the potential ability to be elongated in the standard assay (eight sequences examined), we found matched sequences in six species of eubacteria, four species of eukaryotes and no species of archaea. Our present finding that a short repetitive sequence is elongated at high temperature by the DNA polymerase of a hyperthermophilic bacterium in a hairpincoil transitional state suggests that a repetitive array could have been created by this mechanism at an early stage of the evolution of primordial genetic material in high temperature environments.
| ACKNOWLEDGEMENT |
|---|
The authors acknowledge Mr T. Miura for the measurement of thermal melting temperatures.
| FOOTNOTES |
|---|
* To whom correspondence should be addressed. Tel: +81 6 6382 3100; Fax: +81 6 6382 1152; Email: ogata145@pearl.ocn.ne.jp
| REFERENCES |
|---|
|
|
|---|
-
1 Smith,G.P. (1976) Science, 191, 528535.
2 McLachlan,A.D. (1987) Cold Spring Harbor Symp. Quant. Biol., 52, 411420.[ISI][Medline]
3 Ohno,S. (1981) Proc. Natl Acad. Sci. USA, 78, 76577661.
4 Ohno,S. and Epplen,J.T. (1983) Proc. Natl Acad. Sci. USA, 80, 33913395.
5 Ohno,S. (1984) Proc. Natl Acad. Sci. USA, 81, 24212425.
6 Ohno,S. (1987) J. Mol. Evol., 25, 325329.[ISI][Medline]
7 Go,M. (1983) Proc. Natl Acad. Sci. USA, 80, 19641968.
8 Blake,C. (1983) Nature, 306, 535537.[Medline]
9 McAllister,B.F. and Werren,J.H. (1999) J. Mol. Evol., 48, 469481.[ISI][Medline]
10 Willand,H.F. (1989) Genome, 31, 737744.[Medline]
11 Warburton,P.E., Waye,J.S. and Willard,H.F. (1993) Mol. Cell. Biol., 13, 65206529.
12 Walsh,J.B. (1987) Genetics, 115, 553567.
13 Stephan,W. (1989) Mol. Biol. Evol., 6, 198212.[Abstract]
14 Hogan,N.C., Slot,F., Traverse,K.L., Garbe,J.C., Bendena,W.G. and Pardue,M.-L. (1995) Genetics, 139, 16111621.[Abstract]
15 Fletcher,H.L. (1994) Genetics, 138, 511518.[Abstract]
16 Elder,J.F.,Jr and Turner,B.J. (1995) Q. Rev. Biol., 70, 297320.[Medline]
17 Cabot,E.L., Doshi,P., Wu,M.-L. and Wu,C.-I. (1993) Genetics, 135, 477487.[Abstract]
18 Charlesworth,B., Langley,C.H. and Stephan,W. (1986) Genetics, 112, 947962.
19 Charlesworth,B., Sniegowski,P. and Stephan,W. (1994) Nature, 371, 215220.[Medline]
20 Cooper,K.F., Fisher,R.B. and Tyler-Smith,C. (1993) J. Mol. Biol., 230, 787799.[ISI][Medline]
21 Sen,S., Dasgupta,A., Roychudhuri,A., Mittra,B. and Majumder,H.K. (1999) Indian J. Exp. Biol., 37, 839842.[Medline]
22 Fu,G. and Barker,D.C. (1998) Nucleic Acids Res., 26, 21612167.
23 Wellinger,R.J., Ethier,K., Labrecque,P. and Zakian,V.A. (1996) Cell, 85, 423433.[ISI][Medline]
24 Ogata,N. and Miura,T. (1997) Biochem. J., 324, 667671.
25 Ogata,N. and Miura,T. (1998) Nucleic Acids Res., 26, 46524656.
26 Ogata,N. and Miura,T. (1998) Nucleic Acids Res., 26, 46574661.
27 Kornberg,A. and Baker,T.A. (1992) DNA Replication, 2nd Edn. Freeman, New York, NY.
28 Ogata,N. and Miura,T. (1998) GenBank accession nos Y17475Y17498.
29 Ogata,N. and Miura,T. (1998) GenBank accession nos Y17520Y17551.
30 Arakawa,T., Jongsareejit,B., Tatsumi,Y., Tanaka,K., Ikeda,K., Komatsubara,H., Inoue,H., Kawakami,B., Oka,M., Emi,S. et al. (1996) DNA Res., 3, 8792.[Abstract]
31 Kalnins,A. (1993) GenBank accession no. J01636.
32 Sambrook,J., Fritsch,E.F. and Maniatis,T. (1989) Molecular Cloning: A Laboratory Manual, 2nd Edn. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.
33 Hilbers,C.W., Haasnoot,C.A., de Bruin,S.H., Joordens,J.J., van der Marel,G.A. and van Boom,J.H. (1985) Biochimie, 67, 685695.[Medline]
34 Haasnoot,C.A., Hilbers,C.W., van der Marel,G.A., van Boom,J.H., Singh,U.C., Pattabiraman,N. and Kollman,P.A. (1986) J. Biomol. Struct. Dyn., 3, 843857.[ISI][Medline]
35 Xodo,L.E., Manzini,G., Quadrifoglio,F., van der Marel,G.A. and van Boom,J.H. (1986) Nucleic Acids Res., 14, 53895398.
36 Xodo,L.E., Manzini,G., Quadrifoglio,F., van der Marel,G.A. and van Boom,J.H. (1988) Biochemistry, 27, 63216326.[Medline]
37 Xodo,L.E., Manzini,G., Quadrifoglio,F., van der Marel,G.A. and van Boom,J.H. (1991) Nucleic Acids Res., 19, 15051511.
38 Vallone,P.M., Paner,T.M., Hilario,J., Lane,M.J., Faldasz,B.D. and Benight,A.S. (1999) Biopolymers, 50, 425442.[ISI][Medline]
39 Xodo,L.E., Manzini,G., Quadrifoglio,F., Yathindra,N., van der Marel,G.A. and van Boom,J.H. (1989) J. Mol. Biol., 205, 777781.[ISI][Medline]
40 de Gennes,P.-G. (1968) Biopolymers, 6, 715729.[ISI][Medline]
41 Xodo,L.E., Manzini,G., Quadrifoglio,F., van der Marel,G.A. and van Boom,J.H. (1989) Biochimie, 71, 793803.[Medline]
42 Kornberg,A., Bertsch,L.L., Jackson,J.F. and Khorana,H.G. (1964) Proc. Natl Acad. Sci. USA, 51, 315323.
43 Elson,E. (1968) Biopolymers, 6, 269283.[ISI][Medline]
44 Schlotterer,C. and Tautz,D. (1992) Nucleic Acids Res., 20, 211215.
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||



