Skip Navigation

This Article
Right arrow Abstract Freely available
Right arrow Print PDF (523K) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (12)
Right arrowRequest Permissions
Right arrow Commercial Re-use Guidelines
for Open Access NAR Content
Google Scholar
Right arrow Articles by Hellmuth, K.
Right arrow Articles by Simos, G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Hellmuth, K.
Right arrow Articles by Simos, G.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Nucleic Acids Research, 2000, Vol. 28, No. 23 4604-4610
© 2000 Oxford University Press

Cloning and characterization of the Schizosaccharomyces pombe tRNA:pseudouridine synthase Pus1p

Klaus Hellmuth, Henri Grosjean1, Yuri Motorin1, Karina Deinert, Ed Hurt and George Simos*

BZH, Biochemie-Zentrum Heidelberg, Im Neuenheimer Feld 328, D-69120 Heidelberg, Germany and 1CNRS, Laboratoire d’Enzymologie et de Biochimie Structurales, 1 Avenue de la Terrasse, F-91198 Gif-sur-Yvette, France

Received September 8, 2000; Revised and Accepted October 4, 2000.

DDBJ/EMBL/GenBank accession no. AJ251329.


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Saccharomyces cerevisiae cells that carry deletions in both the LOS1 (a tRNA export receptor) and the PUS1 (a tRNA:pseudouridine synthase) genes exhibit a thermosensitive growth defect. A Schizosaccharomyces pombe gene, named spPUS1, was cloned from a cDNA library by complementation of this conditional lethal phenotype. The corresponding protein, spPus1p, shows sequence similarity to S.cerevisiae and murine Pus1p as well as other known members of the pseudouridine synthase family. Accordingly, recombinant spPus1p can catalyze in vitro the formation of pseudouridines at positions 27, 28, 34, 35 and 36 of yeast tRNA transcripts. The sequence and functional conservation of the Pus1p proteins in fungi and mammalian species and their notable absence from prokaryotes suggest that this family of pseudouridine synthases is required for a eukaryote-specific step of tRNA biogenesis, such as nuclear export.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
The modified nucleoside pseudouridine ({Psi}) is present in rRNAs and tRNAs in both prokaryotes and eukaryotes. In the yeast Saccharomyces cerevisiae it is found in at least 15 different locations of tRNA. Uridines at positions 13, 27, 28, 31, 32, 38, 39 and 55 are almost always or frequently modified to pseudouridines, while other positions, including 1, 26, 34, 35, 36, 65 and 67, are rarely modified (1). A family of enzymes, the tRNA:pseudouridine synthases, catalyzes the conversion of uridine into pseudouridine residues in tRNA molecules. In S.cerevisiae {Psi}13, {Psi}32 and {Psi}55 are formed by three distinct activities (2), whereas a single enzyme (Pus1p) is responsible for {Psi} formation at positions 27, 28, 34 and 36, both in vitro and in vivo (3,4). In addition, Pus1p is implicated in the formation of {Psi} at positions 26, 65 and 67 in vivo and at position 35 in vitro (3,4). Saccharomyces cerevisiae (sc) Pus1p, together with scPus2p and mouse (m)Pus1p (5), form a subfamily of pseudouridine synthases that is related in sequence to scPus3p/Deg1p, the enzyme responsible for the formation of {Psi}38 and {Psi}39 and the true homolog of Escherichia coli synthase TruA (6). scPus1p and mPus1p have similar substrate specificities while the target RNAs of scPus2p have not yet been determined. Surprisingly, scPus1p also converts uridines at position 44 in U2 small nuclear (sn)RNA and is therefore the first yeast pseudouridine synthase characterized so far which exhibits a dual substrate specificity, acting both on tRNA and snRNA (7). Furthermore, it has been shown that scPus1p contains a zinc atom that is essential for tRNA binding, the structural requirements of which have also been investigated (8,9). The other {Psi} synthases that have been characterized so far in S.cerevisiae include Pus4p, a member of the TruB family that catalyzes the formation of {Psi}55 in both cytoplasmic and mitochondrial tRNAs (10), Pus5p, a member of the RluA family that modifies yeast mitochondrial 21S rRNA (11), and Cbf5p, a component of snoRNPs involved in the formation of the {Psi} residues in 18S and 25S rRNAs (1214).

Despite the abundance of {Psi} residues in yeast tRNAs, the function of these modifications remains unclear and none of the four known yeast tRNA {Psi} synthases (Pus1p–Pus4p) is essential for viability, at least under normal growth conditions. However, genetic experiments have implicated scPus1p in the nuclear export of tRNA. PUS1 was originally identified by its ability to complement a mutation that was synthetically lethal to a thermosensitive allele of the essential nucleoporin Nsp1p (4). The synthetic lethality of the mutant strain had actually been due to a combination of mutations in three genes: NSP1, LOS1 und PUS1. Los1p, as well as its human homolog Xpo-t, associates with the nuclear pores and acts as an exportin for tRNA, i.e. it can mediate the nuclear export of tRNA (4,1521). A deletion of either LOS1 or PUS1 does not result in a growth defect for yeast cells, whereas combined disruption of both genes causes slow cell growth at 30°C as well as a thermosensitive phenotype, i.e. lack of viability at 37°C (4). This genetic interaction suggests that pseudouridinylation of tRNA residues by Pus1p could be a prerequisite for efficient nuclear export of tRNA molecules.

Pus1p has so far been characterized in only two species, S.cerevisiae and mouse, and this makes sequence as well as phylogenetic analysis of this enzyme difficult. In order to identify a functional homolog in an additional organism we took advantage of the thermosensitive phenotype of the los1{Delta} pus1{Delta} double mutant and searched for Schizosaccharomyces pombe genes that could act as high copy suppressors of this phenotype. With this approach we expected to identify S.pombe orthologs of either scPus1p or scLos1p. Indeed, we were able to clone the cDNA of a protein that represents, as shown by sequence homology and functional analysis, the S.pombe (sp)Pus1p.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Yeast strains, media and plasmids
The following yeast strains were used in this work: Y572 (MATa ade2 his3 leu2 trp1 ura3 pus1::HIS3); Y680 (MATa ade2 his3 leu2 trp1 ura3 los1::HIS3 pus1::HIS3) (4). Cells were grown in YPD rich medium or synthetic SDC medium containing the necessary amino acids and nutrients. For counter selection of cells containing URA3 plasmids 5-fluoroorotic acid (FOA) (Toronto Research Chemicals) was used at 1 µg/ml. The following plasmids were used: pFL61 (2µ, URA3) contains a cDNA insert of S.pombe under control of the S.cerevisiae PGK1 promoter and terminator (22); pRS315 (CEN/ARS, LEU2); pRS426 (2µ, URA3) (23). Vectors containing the precursor of yeast tRNAIle (anticodon UAU), yeast tRNATrp (anticodon CCA) and yeast tRNATyr (anticodon GUA), as used in the present work, were described previously (3,24).

Cloning of the S.pombe cDNA encoding spPus1p
An aliquot of 100 OD600 units of an overnight culture of the thermosensitive yeast strain Y680 (los1{Delta} pus1{Delta}) in YPD liquid medium was transformed with 10 µg S.pombe cDNA library inserted into pFL61, according to the lithium acetate method (25). Transformed cells were streaked on 20 SDC-ura plates and incubated for 5 h at room temperature and for 6 days at 37°C. Growing colonies were re-streaked on SDC-ura plates and incubated for 3 days at 37°C. After two rounds of selection, the remaining clones were made ura by growth on 5-FOA-containing plates and tested for reappearance of the thermosensitive phenotype. The plasmid DNA of all the positive clones was isolated and the cDNA insert size was determined by restriction analysis with NotI. The screening strain was transformed with the recovered plasmids in order to confirm complementation of the thermosensitive phenotype. Three complementing plasmids (SP79, SP88 and SP130) with NotI cDNA inserts of identical length (1.9 kb) and identical restriction patterns were further analyzed. The cDNA insert was subcloned into vector pRS315 and sequenced by the dideoxy method. The obtained sequence was compared to the S.pombe nucleotide sequence available from the Sanger Centre (http://www.sanger.ac.uk/Projects/S_pombe/) and found to be part of cosmid c126 on chromosome III (accession no. AL034490). Introns in the genomic sequence were reported by Genefinder (http://sciclio.cshl.org/genefinder/Pombe/pombe.htm). Proteins with sequence similarities were identified by FASTA and aligned using the ClustalW and Boxshade programs.

Preparation of recombinant His-tagged S.pombe and S.cerevisiae Pus1p
The spPUS1 open reading frame (ORF) was amplified by PCR from vector pRS315-spPUS1 using two primers that created a XhoI restriction site at the ATG start codon and a MluI restriction site in the 3'-untranslated region of the gene (sense, TTTTTCTCGAGCGGACGTGGTGGTAAACGC; antisense, TTTTTACGCGTGTATATTGCACCATACGGTC; restriction sites underlined). This manipulation allowed cloning of the ORF into a modified pET (pET-HIS6/pET8c) (26) vector cut with XhoI–MluI and created an in-frame fusion protein of six histidine residues joined by a Ser-Ser spacer dipeptide to the amino acid immediately after the start methionine. The vector containing the fusion gene was transformed into E.coli BL21 cells. A 1 l culture was grown in minimal medium at 37°C to OD 0.7 and induced by addition of 1 mM IPTG. The bacterial cell pellet was lysed by sonication in 10 ml of lysis buffer (LB) [50 mM Tris–HCl pH 8.0, 150 mM NaCl, 0.1% Triton X-100, 1 mM DTT, containing a cocktail of protease inhibitors (Complete, EDTA-free; Boehringer Mannheim)]. The lysate was cleared by centrifugation and applied to a Ni–NTA resin column (Qiagen, Hilden, Germany) which was then washed with lysis buffer lacking Triton X-100 but containing 20 mM imidazole. spPus1p was purified to near homogeneity by elution with 250 mM imidazole in lysis buffer lacking Triton X-100. To ensure further removal of contaminants the Ni–NTA eluate was dialysed against Mono Q buffer (20 mM Tris–HCl, 1 mM MgCl2, 1 mM DTT, 10% glycerol, pH 8.0) and applied to a Mono Q HR 5/5 column (Pharmacia) equilibrated in the same buffer. spPus1p was eluted with ~250 mM NaCl, peak fractions were concentrated to 1 mg/ml, glycerol was added to 50% and aliquots were frozen and kept at –80°C. In all purification steps the identity of the purified protein band was verified by western blotting using monoclonal antibodies (BAbCO, CA) against the His6 tag. The enzyme was used for 3 months without apparent loss of activity. Recombinant His-tagged scPus1p was prepared as described earlier (3,8).

Pseudouridine formation assay in vitro
Pseudouridine synthase activity of purified recombinant spPus1p was tested at 30°C and compared under identical experimental conditions to that of recombinant scPus1p. The incubation mixture (50 µl) contained 100 mM Tris–HCl, pH 8.0, 100 mM ammonium acetate, 5 mM MgCl2, 2 mM DTT, 0.1 mM EDTA, 2–5 fmol appropriate 32P-radiolabeled T7 run-off transcripts as substrate and purified enzyme as indicated in the legends to the figures. Prior to the enzymatic assay the purified enzymes were diluted at appropriate concentrations in 50 mM Tris–HCl buffer, pH 7.5, containing 1 mM MgCl2, 2 mM DTT, 1 mg/ml bovine serum albumin and 10% glycerol. After incubation the pseudouridine content in the radiolabeled transcripts was analyzed as described previously (3). In brief, the RNA was extracted with phenol/chloroform, precipitated with ethanol and then completely hydrolyzed to 3'-nucleotide monophosphates by RNase T2 (‘nearest neighbor’ analysis). Each hydrolyzate was chromatographed on 2-dimensional thin layer chromatography (TLC) plates and radioactivity in the spots was evaluated after exposure to a PhosphorImager screen.

Tagging of spPus1p with green fluorescent protein (GFP) and localization in yeast cells
To tag spPus1p with GFP at the N-terminus, the spPUS1 ORF was amplified by PCR from vector pRS315-spPUS1 using two primers that created an in-frame PstI restriction site after the ATG start codon and a HindIII restriction site in the 3'-untranslated region of the gene (sense, TTTTTCTGCAGGGACGTGGTGGTAAACGC; antisense, TTTTTAAGCTTGTATATTGCACCATACGGTC; restriction sites underlined). The PCR product, after digestion with PstI–HindIII, was ligated to the vector pRS315-PNOP1-GFP-scPUS1 (15) previously cut with the same enzymes to remove the scPUS1 ORF. This resulted in the plasmid pRS315-PNOP1-GFP-spPUS1, which expressed GFP-tagged spPus1p under control of the constitutive NOP1 promoter. This plasmid was then transformed in yeast cells and expression of the full-length GFP–spPus1p fusion protein was confirmed by western blotting of whole cell extracts using polyclonal antibodies (Clontech) against the GFP moiety. The localization of the GFP-tagged protein in living yeast cells was examined in the fluorescein channel of a Zeiss Axioskop fluorescence microscope. Pictures were obtained with a Xillix Microimager CCD camera and processed with Improvison Openlab 1.7 software


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Cloning of S.pombe PUS1 by complementation of the S.cerevisiae los1{Delta} pus1{Delta} double disrupted strain
The fact that disruption of both LOS1 and PUS1 in the yeast S.cerevisiae causes a synergistic growth arrest at 37°C (4) makes possible the cloning of putative homologs of Los1p or Pus1p from other organisms by functional complementation. Therefore, the thermosensitive los1{Delta} pus1{Delta} strain was transformed with a S.pombe-derived cDNA library and thermoresistant clones were isolated and analyzed by plasmid recovery. After passing all false positive tests (see Materials and Methods), three complementing plasmids with S.pombe cDNA inserts were obtained that were capable of restoring the viability of the los1{Delta} pus1{Delta} strain at 37°C (Fig. 1A). Restriction analysis of these three clones (SP79, SP88 and SP130) showed that they contained identical cDNA inserts of ~1.9 kb. The nucleotide sequence of the SP79 insert was determined by dideoxy sequencing and primer walking. The 1902 bp long cDNA insert could be completely aligned with a part of cosmid c126 derived from chromosome III of S.pombe. Two predicted introns for the uncharacterized genomic sequence could be confirmed, the first 65 bp and the second 39 bp long, at positions 1116 and 1472 of the cDNA, respectively. Both introns have the typical 5'- and 3'-splice consensus elements (GTAAGTA and TAG) and are absent in the cDNA fragment we cloned. Starting at position 40, the cDNA contains a complete 1605 bp long ORF that codes for a 534 amino acid long polypeptide (EMBL ID/accession no. SPO251329/AJ251329). This protein was named spPus1p (for S.pombe pseudouridine synthase 1), because of its sequence homology to two previously characterized eukaryotic tRNA modification enzymes, S.cerevisiae pseudouridine synthase 1 (scPus1p) (4) and mouse pseudouridine synthase 1 (mPus1p) (5). An alignment of these three proteins is shown in Figure 1B. This sequence comparison shows that there are two blocks of high sequence identity. The first one, containing 124 amino acids (42–165 in spPus1), defines an N-terminal domain which is positively charged in all three proteins, with a pI between 9.2 and 10. The second one, containing 160 amino acids (314–473 in spPus1), comprises a C-terminal domain and is also very basic, at least in the case of the two yeast proteins (pI 10.1–10.3). The two highly conserved N- and C-termimal domains are separated by a non-conserved linker sequence of variable length which is short in the mammalian protein (11 amino acids) but long and acidic (pI 4.6) in the cases of scPus1p and spPus1p (90 and 148 amino acids, respectively). SpPus1 also shares significant homology with other uncharacterized ORFs in S.pombe and other species (see below).



View larger version (60K):
[in this window]
[in a new window]
 
Figure 1. (A) The S.pombe cDNA that encodes spPus1p can complement the thermosensitive los1{Delta} pus1{Delta} double disrupted S.cerevisiae strain. This strain was transformed with the indicated plasmids (pFL61-spPUS1, clones SP79, SP88 and SP130) and incubated on YPD plates at the indicated temperatures. Untransformed cells and cells transformed with an empty plasmid served as negative controls. (B) Sequence alignment between S.cerevisiae (sc), S.pombe (sp) and mouse (m) homologs of Pus1p. Invariant amino acids are indicated as white letters in dark gray boxes, partially conserved amino acids are in light gray boxes.

 
Recombinant spPus1p exhibits tRNA:pseudouridine synthase activity
The fact that spPus1p can complement the thermosensitive phenotype of the S.cerevisiae los1{Delta} pus1{Delta} strain as well its sequence homology to scPus1p indicate that spPus1p may have pseudouridine synthase activity. To show this experimentally, we tested whether recombinant spPus1p exhibits a similar enzymatic activity to recombinant scPus1p. The spPUS1 ORF was tagged at its N-terminal end with six histidines and expressed in E.coli. A single protein with the expected molecular weight of His6–spPusp1 could be purified from E.coli whole cell lysates by two chromatographic steps (Fig. 2A). The activity of this recombinant spPus1p, as well as recombinant scPus1p, was tested in parallel using various transcripts of S.cerevisiae tRNA as substrates. From earlier experiments with recombinant scPus1p we knew that the precursor of yeast tRNAIle (which contains a 60 nt long intron) allowed intron-dependent formation of {Psi}34 and {Psi}36 as well as intron-independent formation of {Psi}27 (3,4). Taking advantage of the fact that both uridines U34 and U36 are followed by A, while {Psi} at position 27 is followed by C in the sequence of pre-tRNAIle, the formation of pseudouridines at position 27 and positions 34 and 36 can be monitored independently by using appropriate [32P]AMP- or [32P]CMP-radiolabeled transcripts and T2 digestion prior to TLC (see Material and Methods). To monitor the formation of {Psi}28 we used [32P]CMP-radiolabeled yeast tRNATrp and to monitor the formation of intron-dependent {Psi}35 we used [32P]AMP-radiolabeled yeast tRNATyr bearing a 14 nt long intron (for the structures of the tRNA substrates see 3).



View larger version (45K):
[in this window]
[in a new window]
 
Figure 2. Recombinant His6–spPus1p has tRNA:pseudouridine synthase activity. (A) Purification of His6–spPus1p from E.coli. Aliquots of soluble cell extract (lane 2), Ni–NTA column flow-through (lane 3), Ni–NTA column eluate with 250 mM imidazole (lane 4) and eluate of the Mono Q column (lane 5) were analyzed by SDS–PAGE followed by Coomassie Blue staining. Lane 1, 10 kDa ladder molecular weight markers, the arrowhead indicates the position of the 50 kDa band. The position of the His6–spPus1p band is indicated by an arrow. (B) Autoradiograms of cellulose TLC plates obtained after chromatography of RNase T2 hydrolyzates of in vitro radiolabeled [32P]CMP-labeled tRNATrp and [32P]AMP-labeled tRNAIle transcripts incubated for 1 h at 30°C with 100 ng recombinant His6–spPus1p, demonstrating the formation of {Psi}27 and {Psi}34/{Psi}36, respectively. (C) Enzymatic formation of pseudouridine in different yeast tRNA transcripts incubated for 1 h at 30°C in the presence of increasing amounts of recombinant S.pombe Pus1p (open squares) or recombinant S.cerevisiae Pus1p (filled circles). (a) [32P]CMP-labeled tRNAIle lacking the 60 nt intron was used as substrate, allowing monitoring of the selective formation of {Psi}27. (b) [32P]CMP-labeled tRNATrp (lacking its natural intron) was used to monitor the formation of {Psi}28. (c) Formation of {Psi}34 and {Psi}36 was monitored using intron-containing tRNAIle labeled with [32P]AMP. (d) Formation of {Psi}35 was monitored using intron-containing tRNATyr labeled with [32P]AMP. After incubation, 32P-radiolabeled tRNA was extracted with phenol/chloroform, ethanol precipitated and subjected to complete digestion with RNase T2. Each hydrolyzate was subjected to 2-dimensional TLC and the amount of [32P]{Psi}MP relative to radiolabeled AMP, CMP, GMP and UMP was evaluated as indicated in Materials and Methods.

 
The formation of {Psi}28, {Psi}34 and {Psi}36 by recombinant spPus1p is shown in Figure 2B, while Figure 2C shows the quantitation of all the results as the molar amount of pseudouridine formed per mole of tRNA, in the presence of increasing amounts of recombinant scPus1p or spPus1p and using as substrates the tRNAs mentioned above. Control experiments with yeast tRNAAsp or yeast tRNAPhe, which normally contain {Psi} residues at positions 13, 32 and 55 or 39 and 55, respectively, but are not modified by recombinant scPus1 (3), gave no trace of pseudouridine formation even at the highest concentration of recombinant spPus1p tested (data not shown). These results demonstrate that spPus1p is capable of forming {Psi} at positions 27, 28, 34, 35 and 36, the efficiency of the modification being dependent on the position of the uridine in the tRNA molecules. While formation of {Psi}27 in yeast tRNAIle is catalyzed very efficiently by both spPus1p and scPus1p even at low enzyme concentrations (Fig. 2C, panel a), the formation of {Psi}28, {Psi}34+36 and {Psi}35 in yeast tRNATrp, yeast tRNAIle and yeast tRNATyr, respectively, is catalyzed less efficiently by spPus1p than by scPus1p (Fig. 2C, panels b–d, respectively). This difference in efficiency most likely reflects the fact that the S.pombe enzyme is acting on S.cerevisiae tRNAs, which may therefore be recognized and bound less strongly. The ability of spPus1p to form {Psi} at position 27 was also confirmed by testing cell extracts of the S.cerevisiae pus1{Delta} strain transformed with a plasmid expressing spPus1p (data not shown). In summary, our results demonstrate that spPus1p, as predicted from its sequence, has tRNA:pseudouridine synthase activity and exhibits a substrate specificity which is identical in vitro to the substrate specificity of scPus1p. Therefore, spPus1p can be considered as the true ortholog of scPus1p.

spPus1p is imported efficiently into the nucleus of S.cerevisiae
The finding that scPus1p, which is an exclusively intranuclear protein (4,15), could be functionally replaced by the S.pombe enzyme indicated that spPus1p could also enter the nucleus when expressed in S.cerevisiae cells. In order to show that, we localized spPus1p in budding yeast cells that lacked endogenous scPus1p. To facilitate the localization, spPus1p was tagged at the N-terminus with GFP. This fusion protein could be expressed stably in S.cerevisiae, as shown by western blot analysis of total cell extracts using antibodies against the GFP moiety, and was functional because it could complement thermosensitive growth of the los1{Delta} pus1{Delta} budding yeast strain (data not shown). As shown in Figure 3, when GFP–spPus1p was expressed in pus1{Delta} budding yeast cells the fluorescence signal was restricted to an area that corresponded to the nucleus, while the cytoplasm and the vacuole, which were clearly discernable by phase contrast, were devoid of signal. Similar nuclear localization was also observed when GFP–spPus1p was expressed in wild-type S.cerevisiae cells (data not shown). Therefore, it can be concluded that the Pus1p nuclear localization signal and import pathway are conserved between budding and fission yeast cells and that nuclear residence is an integral property of a functional Pus1p enzyme.



View larger version (48K):
[in this window]
[in a new window]
 
Figure 3. Subcellular localization of GFP-tagged spPus1p expressed in S.cerevisiae cells lacking endogenous Pus1p. (Left) Fluorescence image of living cells; (middle) corresponding phase contrast image; (right) a merge of the fluorescence and phase contrast images.

 

    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
In this report we have identified the S.pombe Pus1p, which is now the third tRNA:pseudouridine synthase 1 to be characterized experimentally after the S.cerevisiae (3,4) and mouse (5) enzymes. The cDNA coding for spPus1p was found in a screen for fission yeast proteins that can rescue the thermosensitive los1{Delta} pus1{Delta} budding yeast strain. Enzymatic assays in vitro confirmed the ability of spPus1p to function as a tRNA:pseudouridine synthase and demonstrated that its substrate specificity for S.cerevisiae tRNAs matches those of the other two previously identified homologs from S.cerevisiae and mouse. All enzymes display multisite specificity and are capable of modifying residues in at least two different regions of the tRNA molecule and in an intron-dependent (positions 34 and 36) or intron-independent (positions 27 and/or 28) mode. Finally, the two yeast homologs localize exclusively inside the nucleus.

Comparison of the sequences of the three Pus1p orthologs allows certain conclusions to be drawn concerning their structural organization and their relationship to the other pseudouridine synthases. Pus1p was originally grouped in the TruA family because of its sequence similarity to the founding member of this family, E.coli pseudouridine synthase I or TruA (4). However, TruA modifies positions 38, 39 and/or 40 in tRNA and its true eukaryotic ortholog is apparently yeast Pus3/Deg1p, which has a similar substrate specificity (6). It can therefore be suggested that spPus1p, scPus1p and mPus1p constitute what can be now called the Pus1 family, which is related to but distinct from TruA. The members of the Pus1 family differ from the TruA-like proteins not only in their substrate specificity but also in the fact that they are only encountered in one kingdom, i.e. eukaryotes. Indeed, databank sequence searches and comparisons revealed a number of other eukaryotic Pus1p-like proteins that can be distinguished from the TruA-like enzymes on the basis of sequence similarity. An alignment of the most conserved areas as well as a phylogenetic tree of eukaryotic Pus1-like and TruA (Pus3)-like proteins is shown in Figure 4. In addition to spPus1p (this work), scPus1p (3,4) and mPus1p (5), potential members of the Pus1 family include human Pus1p (5), S.cerevisiae Pus2p (4), two additional S.pombe ORFs (T40736 and CAA20745) and one ORF each in Arabidopsis thaliana (AAF17648), Caenorhabditis elegans (T26253) and Drosophila melanogaster (AAF55785). Unique sequence elements of the Pus1-like family that can be easily identified include the invariable alanine residue before the conserved RTD motif and the characteristic sequence HNFHNFT that is found with small variations in all Pus1 sequences, as well as Pus2, which can therefore be considered a member of this family (Fig. 4A). Other, more distantly related polypeptides appear to be eukaryotic members of the TruA (Pus3) family, such as scPus3p itself (6) and ORFs in S.pombe (CAB61771), A.thaliana (AAF26999 and possibly O22928) and C.elegans (Q09524). Of course, the sequence analysis shown in Figure 4 has only predictive value but, nevertheless, it may act as a guide for the experimentation required for the definite classification of a protein in one or the other family, according to catalytic activity and substrate specificity.



View larger version (52K):
[in this window]
[in a new window]
 
Figure 4. Sequence alignment of the conserved blocks (A) and bootstrapped phylogenetic tree (B) of eukaryotic proteins related to spPus1p. The following abbreviations of organism names are used: sc, S.cerevisiae; sp, S.pombe; ce, C.elegans; at, A.thaliana; dm, D.melanogaster; m, mouse; h, human. In the case of uncharacterized ORFs, the organism name is followed by the accession number in the GenBank or SwissProt database. (A) The horizontal line separates potential members of the Pus1 family (top) from potential members of the Pus3/TruA family (bottom). The conserved sequence RTDKGV, which is found in both families and contains the aspartate residue essential for catalysis (28), as well as the sequence HNFHNFT, which is characteristic for the members of the Pus1 family, are indicated by brackets. The alanine residue conserved in all Pus1-like proteins is also indicated by an asterisk. The numbers at the top correspond to the amino acid positions in scPus1 (first line). Identical or conserved residues are shaded by dark or light gray, respectively. (B) The bootstrapped phylogenetic tree was constructed using ClustalW software and the alignment of the proteins excludes positions with gaps. Numbers show the percent occurrence of nodes in 1000 bootstrap replications.

 
As shown in Figures 1B and 4, Pus1-like enzymes contain two highly conserved, positively charged domains which may represent the catalytic core and the basic recognition machinery for the common structure of the tRNA substrates. This two-domain organization is reminiscent of the E.coli enzyme TruA, which is the only pseudouridine synthase with a known 3-dimensional structure (27). The TruA monomer consists of two distinct domains with similar folding topology, the union of which generates a RNA-binding cleft. Therefore, Pus1-like proteins may be structured in an analogous way to TruA. However, in the Pus1-like proteins the two conserved domains are connected via a species-specific linker sequence of variable length. A possible function of this idiosyncratic sequence may be involvement in recognition of the tRNA intron, which, although required for modification at positions 34 and 36 in the anticodon of tRNAIle(UAU), varies in length between different species. For example, while the intron of S.cerevisiae pre-tRNAIle(UAU) is 60 nt long, analysis of the S.pombe and human genomic sequences indicates the presence of tRNAIle(UAU) genes containing a shorter intron, of 25 and 20 nt, respectively. The differences in the substrate pre-tRNA structure may also explain the fact that spPus1p modifies positions 34 and 36 in budding yeast tRNAIle(UAU) less efficiently than the homologous scPus1p. In addition to its capability of modifying tRNAs, S.cerevisiae Pus1p was shown previously to catalyze U->{Psi} conversion at position 44 in U2 snRNA (7). However, the analysis of RNA extracted from a S.cerevisiae pus1{Delta} strain complemented by spPus1p showed that U2 snRNA does not contain {Psi} at position 44 (I.Ansmant and Y.Motorin, unpublished observations). These results suggest an additional difference in RNA recognition between S.cerevisiae and S.pombe Pus1p.

The modifications catalyzed by the Pus1 enzymes are a unique feature of eukaryotic tRNAs and they may therefore be required for a process that occurs only in eukaryotes, such as nuclear export of tRNA. Indeed, scPus1p becomes essential for optimal cell growth in the absence of the tRNA nuclear export factor Los1p (4). The fact that spPus1p can replace scPus1p effectively suggests that this genetic interaction may be conserved between species. We have recently reported that two distinct but redundant nuclear export pathways for tRNA exist in budding yeast: one depends on Los1p while the second one is Los1p-independent but requires tRNA aminoacylation and function of the essential translation elongation factor eEF-1A (21). Therefore, it is likely that Pus1p-mediated modifications can facilitate interaction of the tRNAs with the aminoacyl-tRNA synthetases, EF-1A or other factors of the same pathway. In the absence of Pus1p this interaction may be weakened, causing a reduction in the rate of nuclear tRNA export, which, however, can be compensated for by the Los1p-dependent export mechanism. However, when both Pus1p and Los1p are missing the rate of nuclear tRNA export may become limiting for cell growth. We hope that the identification of Pus1p in fission yeast will help to address these issues further.


    ACKNOWLEDGEMENTS
 
We would like to thank M. Wigler (Cold Spring Harbor Laboratory) for providing the S.pombe cDNA library, C. Simon for technical assistance and H. Grosshans for useful comments on the manuscript. This work was supported by a grant from the DFG to G.S. and E.H. (SFB352-B11).


    FOOTNOTES
 
* To whom correspondence should be addressed. Tel: +49 6221 546757; Fax: +49 6221 544369; Email: cg2{at}ix.urz.uni-heidelberg.de Present addresses: Klaus Hellmuth, Arimedes Biotechnology GmbH, Robert-Rössle-Straße 10, D-13125 Berlin, Germany Yuri Motorin, Maturation des ARN et Enzymologie Moléculaire, UMR 7567 CNRS-UHP, Faculté des Sciences, BP 239, 54506 Vandoeuvre-les-Nancy Cédex, France Back


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

    1 Sprinzl,M., Horn,C., Brown,M., Ioudovitch,A. and Steinberg,S. (1998) Nucleic Acids Res., 26, 148–153.[Abstract/Free Full Text]

    2 Samuelsson,T. and Olsson,M. (1990) J. Biol. Chem., 265, 8782–8787.[Abstract/Free Full Text]

    3 Motorin,Y., Keith,G., Simon,C., Foiret,D., Simos,G., Hurt,E. and Grosjean,H. (1998) RNA, 4, 856–869.[Abstract]

    4 Simos,G., Tekotte,H., Grosjean,H., Segref,A., Sharma,K., Tollervey,D. and Hurt,E.C. (1996) EMBO J., 15, 2270–2284.[Web of Science][Medline]

    5 Chen,J. and Patton,J.R. (1999) RNA, 5, 409–419.[Abstract]

    6 Lecointe,F., Simos,G., Sauer,A., Hurt,E.C., Motorin,Y. and Grosjean,H. (1998) J. Biol. Chem., 273, 1316–1323.[Abstract/Free Full Text]

    7 Massenet,S., Motorin,Y., Lafontaine,D.L., Hurt,E.C., Grosjean,H. and Branlant,C. (1999) Mol. Cell. Biol., 19, 2142–2154.[Abstract/Free Full Text]

    8 Arluison,V., Hountondji,C., Robert,B. and Grosjean,H. (1998) Biochemistry, 37, 7268–7276.[Medline]

    9 Arluison,V., Buckle,M. and Grosjean,H. (1999) J. Mol. Biol., 289, 491–502.[Web of Science][Medline]

    10 Becker,H.F., Motorin,Y., Planta,R.J. and Grosjean,H. (1997) Nucleic Acids Res., 25, 4493–4499.[Abstract/Free Full Text]

    11 Ansmant,I., Massenet,S., Grosjean,H., Motorin,Y. and Branlant,C. (2000) Nucleic Acids Res., 28, 1941–1946.[Abstract/Free Full Text]

    12 Watkins,N.J., Gottschalk,A., Neubauer,G., Kastner,B., Fabrizio,P., Mann,M. and Luhrmann,R. (1998) RNA, 4, 1549–1568.[Abstract]

    13 Lafontaine,D.L.J., Bousquet-Antonelli,C., Henry,Y., Caizergues-Ferrer,M. and Tollervey,D. (1998) Genes Dev., 12, 527–537.[Abstract/Free Full Text]

    14 Zebarjadian,Y., King,T., Fournier,M.J., Clarke,L. and Carbon,J. (1999) Mol. Cell. Biol., 19, 7461–7472.[Abstract/Free Full Text]

    15 Hellmuth,K., Lau,D.M., Bischoff,F.R., Künzler,M., Hurt,E.C. and Simos,G. (1998) Mol. Cell. Biol., 18, 6374–6386.[Abstract/Free Full Text]

    16 Arts,G.J., Fornerod,M. and Mattaj,I.W. (1998) Curr. Biol., 8, 305–314.[Web of Science][Medline]

    17 Arts,G.J., Kuersten,S., Romby,P., Ehresmann,B. and Mattaj,I.W. (1998) EMBO J., 17, 7430–7441.[Web of Science][Medline]

    18 Kutay,U., Lipowsky,G., Izaurralde,E., Bischoff,F.R., Schwarzmaier,P., Hartmann,E. and Görlich,D. (1998) Mol. Cell, 1, 359–369.[Web of Science][Medline]

    19 Lipowsky,G., Bischoff,F.R., Izaurralde,E., Kutay,U., Schäfer,S., Gross,H.J., Beier,H. and Görlich,D. (1999) RNA, 5, 539–549.[Abstract]

    20 Sarkar,S. and Hopper,A.K. (1998) Mol. Biol. Cell, 9, 3041–3055.[Abstract/Free Full Text]

    21 Grosshans,H., Hurt,E. and Simos,G. (2000) Genes Dev., 14, 830–840.[Abstract/Free Full Text]

    22 Minet,M., Dufour,M.E. and Lacroute,F. (1992) Plant J., 2, 417–422.[Web of Science][Medline]

    23 Sikorski,R.S. and Hieter,R. (1989) Genetics, 122, 19–27.[Abstract/Free Full Text]

    24 Szweykowska-Kulinska,Z., Senger,B., Keith,G., Fasiolo,F. and Grosjean,H. (1994) EMBO J., 13, 4636–4644.[Web of Science][Medline]

    25 Schiestl,R.H. and Gietz,R.D. (1989) Curr. Genet., 16, 339–346.[Web of Science][Medline]

    26 Schlaich,N.L. and Hurt,E.C. (1995) Eur. J. Cell Biol., 67, 8–14.[Web of Science][Medline]

    27 Foster,P.G., Huang,L., Santi,D.V. and Stroud,R.M. (2000) Nature Struct. Biol., 7, 23–27.[Web of Science][Medline]

    28 Gu,X., Liu,Y. and Santi,D.V. (1999) Proc. Natl Acad. Sci. USA, 96, 14270–14275.[Abstract/Free Full Text]


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
RNAHome page
I. Behm-Ansmant, S. Massenet, F. Immel, J. R. Patton, Y. Motorin, and C. Branlant
A previously unidentified activity of yeast and mouse RNA:pseudouridine synthases 1 (Pus1p) on tRNAs
RNA, August 1, 2006; 12(8): 1583 - 1593.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
C. Marck, R. Kachouri-Lafond, I. Lafontaine, E. Westhof, B. Dujon, and H. Grosjean
The RNA polymerase III-dependent family of genes in hemiascomycetes: comparative RNomics, decoding strategies, transcription and evolutionary implications.
Nucleic Acids Res., January 1, 2006; 34(6): 1816 - 1835.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J. R. Patton, Y. Bykhovskaya, E. Mengesha, C. Bertolotto, and N. Fischel-Ghodsian
Mitochondrial Myopathy and Sideroblastic Anemia (MLASA): MISSENSE MUTATION IN THE PSEUDOURIDINE SYNTHASE 1 (PUS1) GENE IS ASSOCIATED WITH THE LOSS OF tRNA PSEUDOURIDYLATION
J. Biol. Chem., May 20, 2005; 280(20): 19823 - 19828.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. Steiner-Mosonyi, D. M. Leslie, H. Dehghani, J. D. Aitchison, and D. Mangroo
Utp8p Is an Essential Intranuclear Component of the Nuclear tRNA Export Machinery of Saccharomyces cerevisiae
J. Biol. Chem., August 22, 2003; 278(34): 32236 - 32245.
[Abstract] [Full Text] [PDF]


Home page
RNAHome page
Y. KAYA and J. OFENGAND
A novel unanticipated type of pseudouridine synthase with homologs in bacteria, archaea, and eukarya
RNA, June 1, 2003; 9(6): 711 - 721.
[Abstract] [Full Text] [PDF]


Home page
Genes Dev.Home page
A. K. Hopper and E. M. Phizicky
tRNA transfers to the limelight
Genes & Dev., January 15, 2003; 17(2): 162 - 180.
[Full Text] [PDF]


Home page
J. Biol. Chem.Home page
H. Gro{beta}hans, F. Lecointe, H. Grosjean, E. Hurt, and G. Simos
Pus1p-dependent tRNA Pseudouridinylation Becomes Essential When tRNA Biogenesis Is Compromised in Yeast
J. Biol. Chem., November 30, 2001; 276(49): 46333 - 46339.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Print PDF (523K) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (12)
Right arrowRequest Permissions
Right arrow Commercial Re-use Guidelines
for Open Access NAR Content
Google Scholar
Right arrow Articles by Hellmuth, K.
Right arrow Articles by Simos, G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Hellmuth, K.
Right arrow Articles by Simos, G.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?