Nucleic Acids Research, 2001, Vol. 29, No. 22 4518-4529
© 2001 Oxford University Press
Box C/D RNA guides for the ribose methylation of archaeal tRNAs. The tRNATrp intron guides the formation of two ribose-methylated nucleosides in the mature tRNATrp
Laboratoire de Biologie Moléculaire Eucaryote, UMR5099 du CNRS, Université Paul Sabatier, 118 Route de Narbonne, 31062 Toulouse, France and 1Laboratoire de Biométrie et Intelligence Artificielle, INRA, 31326 Castanet-Tolosan, France
Received September 6, 2001; Revised and Accepted October 3, 2001.
DDBJ/EMBL/GenBank accession nos AY047489AY047495.
| ABSTRACT |
|---|
|
|
|---|
Following a search of the Pyrococcus genomes for homologs of eukaryotic methylation guide small nucleolar RNAs, we have experimentally identified in Pyrococcus abyssi four novel box C/D small RNAs predicted to direct 2'-O-ribose methylations onto the first position of the anticodon in tRNALeu(CAA), tRNALeu(UAA), elongator tRNAMet and tRNATrp, respectively. Remarkably, one of them corresponds to the intron of its presumptive target, pre-tRNATrp. This intron is predicted to direct in cis two distinct ribose methylations within the unspliced tRNA precursor, not only onto the first position of the anticodon in the 5' exon but also onto position 39 (universal tRNA numbering) in the 3' exon. The two intramolecular RNA duplexes expected to direct methylation, which both span an exonintron junction in pre-tRNATrp, are phylogenetically conserved in euryarchaeotes. We have experimentally confirmed the predicted guide function of the box C/D intron in halophile Haloferax volcanii by mutagenesis analysis, using an in vitro splicing/RNA modification assay in which the two cognate ribose methylations of pre-tRNATrp are faithfully reproduced. Euryarchaeal pre-tRNATrp should provide a unique system to further investigate the molecular mechanisms of RNA-guided ribose methylation and gain new insights into the origin and evolution of the complex family of archaeal and eukaryotic box C/D small RNAs.
| INTRODUCTION |
|---|
|
|
|---|
Ribose methylations of eukaryotic rRNAs are directed to the appropriate rRNA nucleotides by a family of box C/D antisense small nucleolar RNAs (snoRNAs), through the formation of a specific RNA duplex at each rRNA modification site (reviewed in 13). Box C/D antisense snoRNAs contain two short conserved sequence motifs, box C (5'-PuUGAUGA-3') and box D (5'-CUGA-3'), always located a few nucleotides away from the 5' and 3' ends, respectively, and one or occasionally two antisense elements (4,5). Antisense elements correspond to 1020 nt long, phylogenetically conserved complementarities to sites of rRNA ribose methylation extending immediately upstream from box D (or box D, another CUGA motif in the snoRNA 5' half). Each antisense element with its adjacent box D (or D) is the sole determinant of the site-specificity of the methylation: the reaction is targeted to the rRNA nucleotide paired to the fifth snoRNA nucleotide upstream from the CUGA and is dependent upon the integrity of the box motif (6,7). Box C/D antisense snoRNAs also contain in the central region of their sequence a C box, carrying up to two deviations from the consensus C box, also important for methylation guide function (8).
Members of the same snoRNA family carrying appropriate antisense elements also direct snRNA ribose methylations in vertebrates, presumably through a very similar mechanism (912). Intriguingly, an increasing number of box C/D snoRNAs devoid of rRNA or snRNA antisense elements have been recently identified (1215), suggesting this large snoRNA family might include guides for the 2'-O-ribose methylation of other cellular RNAs, in addition to rRNAs and snRNAs. Eukaryotic rRNAs exhibit
50100 2'-O-ribose methylations per ribosome (16). Whereas the Escherichia coli ribosome contains only four ribose-methylated nucleotides (17), the sole archaeon examined so far, hyperthermophile Sulfolobus solfataricus, exhibits a large number of rRNA ribose methylations, similar to eukaryotes (18). Homologs of eukaryotic box C/D snoRNAs (19,20) and their cognate snoRNP proteins (2125) have been detected in Archaea. The more complex structural signatures of the C/D sRNAs in some archaea, together with the small size of archaeal genomes, provides the opportunity to look for new members of this RNA family that might target additional cellular RNA species for ribose methylation. The 46 groups of C/D sRNAs carrying rRNA antisense elements detected previously in the Pyrococcus (19) exhibit a structural homogeneity largely exceeding what has been observed for the entire repertoire of yeast Saccharomyces cerevisiae rRNA methylation guide snoRNAs or for the large sets identified in mammals (1,8,12,26). All known Pyrococcus C/D RNAs have very similar sizes and their box C and C consensus are more extended and more strictly observed than in eukaryotic homologs (19,20). Moreover, unlike the vast majority of their yeast or vertebrate homologs, they generally contain two (instead of one) 1013 nt long rRNA antisense elements. In the present study, following further searches of the Pyrococcus genomes, we have experimentally identified four novel C/D sRNAs which, according to the criteria established previously for eukaryotic methylation guides (57,9), are predicted to direct tRNA 2'-O-ribose methylations in archaea. The four C/D box sRNAs were recently predicted, but not experimentally detected, in an independent search of the Pyrococcus genomes (20). Strikingly, one of them corresponds to the intron of its predicted tRNA target, pre-tRNATrp. This intron displays the structural hallmarks of a double guide for two ribose methylations in the pre-tRNATrp exons. We have first set out to test the validity of the two presumptive intramolecular guide RNA duplexes on a phylogenetic basis, through a comparative analysis of pre-tRNATrp sequences in a wide range of archaeal species. In the next stage, we have experimentally tested the predicted function of the pre-tRNATrp intron, using an in vitro splicing/modification system in halophile Haloferax volcanii (27,28). Taken together, our observations indicate that the processing of archaeal pre-tRNATrp could represent an outstanding model system to decipher the molecular mechanisms of RNA-guided ribose methylation, which has not been faithfully reproduced in vitro in eukaryotes so far. They also raise intriguing questions as to the evolutionary origin and genetic mobility of methylation guide snoRNAs.
| MATERIALS AND METHODS |
|---|
|
|
|---|
All procedures used for manipulating nucleic acids and oligodeoxynucleotides were as described by Sambrook et al. (29). All constructions were checked by sequence analysis.
Oligonucleotides
The following oligodeoxynucleotides were used:
A, CGCGGATCCGGGGNCGCNGGGATTTGAACCC;
B, CCGGAATTCGGGGCC/TGTGGC/TGTAGCCNGG;
C, GATCCGATCCTGGTGGGGCCGGAGGGATTTGAAC-CCCCGATCGACTGATCTGGAGTCAGTCGCCATGCCG-GGCTTGGCCACAGCCCCCTATAGTGAGTCGTATTAG;
D, AATTCTAATACGACTCACTATAGGGGGCTGTGGC-CAAGCCCGGCATGGCGACTGACTCCAGATCAGTCG-ATCGGGGGTTCAAATCCCTCCGGCCCCACCAGGAT-CG;
E, CTCCGGTGGGCACCTTTCGGCGCCAAGCCTCTGG;
F, CCGAAAGGTGCCCACCGGAGATATCAGTCGATCG-GGGG;
G, CTCCAGAGGGTCGTGGAGTGTCGTCCCGGGCGCC;
H, CGACACTCCACGACCCTCTGGAGTTCCGAGGTGC-CC;
I, CGACCCTCTGGAGTTGGTGCCCACCGGAG;
J, CTCCGGTGGGCACCAACTCCAGAGGGTCG;
K, CGACACTCCAGCTGATATAGCGACCGACTGATCA-TCGG;
L, CCGATGATCAGTCGGTCGCTATATCAGCTGGAGT-GTCG;
M, GCGACCGACTGATCATCGTGTTGACGACCC;
N, GGGTCGTCAACACGATGATCAGTCGGTCGC;
O, CCGGAATCTAATACGACTCACTATAGGGGCTGTG-GCCAAGCCCGGC;
P, CGCGGATCCTGGTGGGGCCGGAGGGATTTG;
Q, CCGGAATTCTAATACGACTCACTATAGGCGACTG-ACTCCAGAGGCT;
R, CGCGGATCCCGACTGATATCTCCGGTGGGC.
Cloning of pre-tRNATrp in different archaeal species
After centrifugation of 1 ml of culture, cells were lyzed with 1% SDS1% sarcosyl. After proteinase K treatment (1 mg/ml, 3 h at 50°C), DNA was extracted twice with phenolchloroform and ethanol precipitated. After RNase A treatment (1 h, 37°C), DNA was then extracted with phenolchloroform, ethanol precipitated and dissolved in water. PCR amplification was carried out with oligos A and B (25 cycles: 1 min at 95°C, 1 min at 50°C, 1 min at 72°C, followed by a last elongation cycle: 5 min at 72°C). EcoRIBamHI-digested PCR fragments were cloned in an EcoRIBamHI digested pBluescript.
Construction of plasmid carrying mutated pre-tRNATrp
All constructions were cloned in EcoRIBamHI-digested pUC18. The H.volcanii tRNATrp gene was PCR amplified from genomic DNA using oligonucleotides O and P. The series of mutants was obtained by PCR amplification using pairs of appropriate mutagenic oligonucleotides (E/F, G/H, I/J, K/L and M/N on the pre-tRNATrp gene as template, for mutants Del1, Del2,
D,
D and
D", respectively; M/N on the mutant
D gene, for mutant
D
D") in combination with either a common 5' or 3' end-specific oligonucleotide (oligo O or P, respectively). Mutant ExDel carrying 5' and 3' exonic deletions was obtained by using oligonucleotides Q and R. To generate a mature tRNATrp construct, 10 pmol of oligonucleotides C and D (purified on acrylamide gel) were resuspended in ligase 1x buffer (Gibco BRL), denatured (5 min at 100°C), cooled down to 50°C, then added to the ligation mix containing EcoRIBamHI-digested pUC18 and 1 U of T4 DNA ligase (Gibco BRL) in 20 mM dithiothreitol (DTT) and incubated for 3 h at 37°C.
Splicing and in vitro tRNA modification
Wild-type and mutant pre-tRNATrp were in vitro transcribed using 15 U of T7 RNA polymerase (Promega) in the presence of 50 µCi of either [
-32P]ATP (400 Ci/mmol), [
-32P]CTP (800 Ci/mmol) or [
-32P]UTP (800 Ci/mmol). Transcripts were purified on acrylamide gel, eluted in 500 mM NH4acetate, 1 mM EDTA and precipitated with glycogen (25 mg/ml, Quantum-Appligene). A S100 extract of H.volcanii grown in liquid medium was prepared as described (27). About 1 g of cell paste was resuspended in 1.5 ml of TMK buffer (40 mM TrisHCl, pH 7.5, 20 mM MgCl2, 50 mM KCl, 10% glycerol) and passed twice through a French Press at 20 000 s.p.i. The lysate was then centrifuged at 10 000 g for 15 min and the resulting supernatant re-centrifuged at 100 000 g for 1 h. A sample (1 pmol) of 32P-labeled transcript was mixed with 1 µl of 10x buffer (400 mM TrisHCl, pH 7.5, 200 mM MgCl2, 20% glycerol, v/v), heated for 1 min at 90°C and cooled down to room temperature for
30 min before adding 20 U of RNase inhibitor (Promega), AdoMet (0.02 mM final) and 2 µl of S100 extract. After 2 h incubation at 37°C, the transcript and its processing products were separated on 8% denaturing acrylamide gel. Uncleaved pre-tRNATrp and unspliced 5' and 3' exons were eluted from the gel as above and precipitated with glycogen (25 mg/ml).
Analysis of modified nucleotides
RNase T1 digestion. Each purified exon was completely digested in 10 µl with 10 U of RNase T1 in 10 mM TrisHCl, pH 7.6, 1 mM EDTA for 1 h at 37°C. The 7 or 14 nt long RNase T1 oligonucleotides obtained from the 5' or 3' exon, respectively, were isolated by electrophoresis on a denaturing 20% polyacrylamide gel.
P1 nuclease and RNase T2 digests. The purified pre-tRNA or unspliced exon in 10 µl of 50 mM Naacetate (pH 5.2) was completely digested with either 0.1 mg/ml P1 nuclease or 0.05 U/ml RNase T2, for 24 h at 37°C. Digestion products were analyzed by two-dimensional thin layer chromatography (2D-TLC) on cellulose plates (20 cm x 20 cm, Merck) using chromatographic systems B and C (30). Nucleotide 5'-monophosphates were analyzed with system C [(first dimension: isobutyric acid/NH4OH/H2O (66:1:33, v/v/v); second dimension: 0.1 M sodium phosphate (pH 6.8)/ammonium sulfate/n-propanol (100:60:2, v/w/v)] and nucleotide 3'-monophosphates with system B [first dimension: isobutyric acid/NH4OH/H2O (577:38:385 v/v/v); second dimension: ter-butanol/HCl/H2O (14:3:3, v/v/v)]. Radiolabeled spots were identified by autoradiography or UV-shadowing using standard 2D-TLC maps (31,32). The yield of modified nucleotides, in mol/mol, was evaluated by the quantification of 2D-TLC spot intensities by a Fuji Bas-1000 imager, taking into account the nucleotide composition of the pre-tRNA transcripts.
Genomic search of presumptive guides for tRNA ribose methylation
In previously reported Pyrococcus sRNAs, the box C/box D and box C/box D intervals both generally span 12 nt and the box C and C consensus motifs are more extended (5'-RAUGAUGA and 5'-RUGAUGA-3', instead of 5'-RUGAUGA and 5'-UGAUGA-3', respectively) and more strictly observed than in eukaryotic homologs (19). Moreover, for each sRNA group, nucleotide changes and insertions/deletions among homologs in the three Pyrococcus mostly map within the 310 nt-long D/C interval. Assuming that members of the same family that may target RNA species distinct from rRNA would fit the same pattern, we performed a genomic search using a constraint satisfaction approach implemented in the PALINGOL program (33; F.Chétouani and C.Gaspin, unpublished results). Given that sequences of the three Pyrococcus genomes are only moderately divergent from each other, concurrent homology searches were used to select the most likely candidates.
| RESULTS |
|---|
|
|
|---|
Detection of C/D RNAs predicted to guide tRNA ribose methylations in the Pyrococcus
Using genomic search, we identified four C/D RNA-like sequences devoid of rRNA antisense elements (Fig. 1A), which were independently predicted by Dennisgroup (20). Remarkably, each novel sequence, termed sR4750, harbors one (or occasionally two) antisense element(s) directed at a tRNA (instead of rRNA), tRNALeu(CAA), tRNALeu(UAA), elongator tRNAMet and tRNATrp, respectively. According to the D/D box-plus-5 nt rule applying to eukaryotic methylation guide snoRNAs (13,57), each novel presumptive RNA is expected to direct ribose methylation onto the first position of the anticodon of its cognate tRNA target, in every case through its 3'-AE (3' antisense element) (Fig. 1B). This tRNA position is frequently 2'-O-ribose methylated in eukaryotes (34). Moreover, sR48 and sR50 could direct through their 5'-AE (5' antisense element) an additional ribose methylation onto a second nucleotide position of the same tRNA target, G47 in tRNALeu(UAA) and C39 in tRNATrp, respectively (Fig. 1B), which is reminiscent of the pairs of rRNA antisense elements present in most Pyrococcus C/D sRNAs (19,20). For sR49 and sR50, the presumptive methylation guide duplexes involve precursors of elongator tRNAMet and tRNATrp, respectively (Fig. 1B), i.e. the sole intron-containing pre-tRNAs in the Pyrococcus. In a previous genomic search (20), the same target predictions were done for sR47 and sR50, but the first position of the anticodon in tRNALeu(UAA) was not mentioned as a potential target of sR48, whereas sR49 remained without any predicted target. sR4750 were detected in Pyrococcus abyssi through northern hybridizations and primer extensions and their boundaries delineated (Fig. 1A). Their sequences are largely conserved among the Pyrococcus, with the few nucleotide differences mostly mapping within the short D/C interval (Fig. 1A), similar to previously reported Pyrococcus C/D sRNAs (19). For sR49, however, nucleotide differences are also found over the C/D interval, suggesting this RNA might be devoid of a functional 5'-AE (Fig. 1A). Based on similar 3'-AE, potential homologs of Pyrococcus sR47 and sR49 are predicted in Archaeoglobus fulgidus, and in Methanococcus jannaschii and Methanobacterium thermoautotrophicum, respectively, and the corresponding RNA duplexes with tRNALeu(CAA) and pre-tRNAMet, respectively, are supported by a few compensatory changes (Fig. 1B). Remarkably, sR50 corresponds to the intron of its presumptive target, pre-tRNATrp, as noted previously (20), with the two intramolecular guide duplexes both spanning an exon/intron junction in pre-tRNATrp (Fig. 1B). We therefore set out to test phylogenetically its predicted function by a comparative analysis of archaeal tRNATrp gene sequences.
|
Antisense box C/D hallmarks are phylogenetically conserved in the tRNATrp intron of most euryarchaeotes
We examined all tRNATrp gene sequences in GenBank. The tRNATrp intron exhibits C/D RNA hallmarks in all euryarchaea but one, M.jannaschii. These hallmarks are absent in the two crenarchaeotes in GenBank, Aeropyrum pernix and S.solfataricus, and in eukaryotic tRNATrp introns. The two presumptive antisense elements in the euryarchaeal intron are strongly conserved among closely related species but display several nucleotide differences among distantly related euryarchaea (Fig. 2A). Remarkably, the intramolecular RNA duplexes predicted in the Pyrococcus are generally preserved despite sequence divergence (Fig. 2A). The duplex involving the 3'-AE shows compensatory changes at 6 of its 11 bp and retains an identical location relative to box D, reflecting a conserved potential to direct Cm34 formation. Likewise, the duplex involving the 5'-AE shows compensatory changes at 4 of its 8 bp and retains an identical location relative to box D, as predicted for its guiding ribose methylation onto position 39 of tRNATrp in all these species except, however, for the two thermoplasmales and the methanobacterium, suggesting the position is not ribose methylated in these euryarchaea (Fig. 2A). In line with our model, Cm34 and Um39 are found in tRNATrp of halophile H.volcanii, the sole archaeon in which modified nucleotides of tRNATrp have been identified (35).
|
We sequenced the intriguing tRNATrp intron in a few additional archaea. Another crenarchaeote, Sulfolobus shibatae, was devoid of the box C/D motifs, like S.solfataricus (data not shown, deposited in GenBank, accession number AY047494). Given that the sole euryarchaeal tRNATrp intron specimen in GenBank devoid of box C/D hallmarks was a methanococcale (M.jannaschii), we selected another methanococcale, Methanococcus infernus. Likewise, it did not exhibit the antisense and box motifs (data not shown, deposited in GenBank, accession number AY047495). However, these motifs were detected in the five other euryarchaea we analyzed, three halophiles, one archaeoglobale and a thermococcale (Fig. 2B). Within each set of closely related C/D intronic sequences, differences map mostly within the D/C interval, the most variable portion of the previously reported Pyrococcus box C/D RNAs (19), whereas a few semi-conservative GC
GU changes are detected over the presumptive guide duplexes. The enlarged size of the pre-tRNATrp intron in halophiles can be first ascribed to two complementary tracts, immediately upstream from box C and downstream from box D, which are able to form a conserved, 5 bp stembox C/D 5'3' terminal structure (Fig. 2B) typical of box C/D RNAs in eukaryotes and archaea (1,19). Enlargement of the halophile intron also results from the presence of an unusually long D/C interval containing an additional, conserved copy of the 5'-AE. Repetition of the 5'-AE could provide redundant guide elements for ribose methylation of position 39 in tRNATrp (see below). The panel of halobacteriale sequences (Fig. 2B) includes representatives of three halophile genera believed to have diverged from each other
600 x 106 years ago (36). Despite the considerable evolutionary distances, these tRNATrp intron sequences are remarkably similar to each other. As expected, termini of all box C/D tRNATrp introns can form the canonical BHB (bulgehelixbulge) motif recognized by the archaeal tRNA splicing endonuclease (Fig. 2).
Ribose methylation in vitro of the two presumptive target nucleotides in the pre-tRNATrp transcript
We tested experimentally the predicted function of the intron in halophile H.volcanii, for which tRNATrp nucleotide modifications have been characterized. Haloferax volcanii pre-tRNATrp can be spliced in vitro by incubation with a S100 extract (27,28). The splicing endoribonuclease cuts at symmetrical positions within the 3 nt bulges separated by a 4 bp stem, the BHB motif, yielding 2',3'-cyclic phosphate and 5'-hydroxyl termini (37,38). To examine whether natural ribose methylations of tRNATrp were occurring in these conditions, we used an [
-32P]NTP-labeled H.volcanii pre-RNATrp transcript and a H.volcanii S100 extract supplemented with S-adenosyl methionine, the presumptive methyl group donor. After a 1 or 3 h incubation, most of the pre-tRNATrp transcript was cleaved (Fig. 3). Unspliced 5' and 3' exons and the linear 105 nt long intron accumulated while only a low level of mature tRNA was detected, reflecting inefficient religation at low monovalent cation concentration (39). A small fraction of the pre-tRNA transcript remained intact, however, which could reflect its trapping in alternative, splicing-incompetent conformers. An additional, previously unreported form of the entire intron (denoted by an asterisk in Fig. 3) accumulated with kinetics consistent with its corresponding to a conversion product of the linear intron (the relative intensity of this band, compared with the linear intron, increases with incubation times). Its electrophoretic mobility relative to the linear intron was dramatically affected by acrylamide concentration (data not shown) and it was not 5' end-labeled by [
-32P]ATP and polynucleotide kinase, suggesting it could correspond to a circularized form of the intron. Although circularization through a normal 5'3' phosphodiester bond has been reported for archaeal large rRNA introns (40), there is no precedent for an archaeal tRNA intron. Assignment of ribose methylations was performed on unspliced exons by 2D-TLC after digestion with either P1 nuclease, which generates nucleoside 5'-monophosphates and is not inhibited by 2'-O-methylation at high concentration, or RNase T2, which generates nucleoside 3'-monophosphates but cannot cleave phosphodiester linkages adjacent to a 2'-O-ribose methylation. Consistent with the formation of Cm34 and Um39, pCm and pUm spots were detected in P1 nuclease digests of the [
-32P]CTP-labeled 5' exon and [
-32P]UTP-labeled 3' exon, respectively (Fig. 4A). In addition,
and m1
were detected in the P1 digest of the UTP-labeled 3' exon (Fig. 4A, right), reflecting natural modification of H.volcanii tRNATrp U54 and U55 (Fig. 4E). In the case of U55 modification, this was confirmed by analysis of RNase T2 digests (Fig. 4C, left, and data not shown). Formation of Cm34 was established by detection of a single labeled dinucleotide spot, CmCp, in RNase T2 digests prepared not only from an [
-32P]CTP- or [
-32P]ATP-labeled 5' exon (Fig. 4B, left and center, respectively) but also from the 7 nt long RNase-T1 oligonucleotide spanning positions 3137, which was purified from an [
-32P]ATP-labeled 5' exon (Fig. 4B, right). In contrast, Cm32 did not form in vitro, as reflected by the absence of labeled CmpUp in the RNase T2 digest of either an [
-32P]CTP- or an [
-32P]UTP-labeled 5' exon (Fig. 4B, and data not shown). Formation of Um39 was established by detection of a single labeled dinucleotide spot, UmpCp, in the RNase T2 digest of an [
-32P]CTP- or [
-32P]ATP-labeled 3' exon (Fig. 4C and E), and by the absence of UmpCp in the RNase T2 digest of the 14 nt long RNase-T1 oligonucleotide spanning U55, which was purified from an [
-32P]ATP-labeled 3' exon (data not shown). As for the five other modified nucleotides of H.volcanii tRNATrp, m22G26, m1G37, m5C48, Cm56 and m1I57 (Fig. 4E), their formation in vitro was not established conclusively, generally because assignment of the corresponding spots remained ambiguous in our 2D-TLC systems. Thus, while the spot found just below Ap after RNase T2 digestion of an [
-32P]ATP-labeled 3' exon (Fig. 4C) could well correspond to Cm56pm1I57p, its identity was not further established in this study.
|
|
The pre-tRNATrp still unspliced after a 2 h incubation was assayed in parallel. The two labeled dinucleotides reflecting formation of Cm34 and Um39, CmpCp and UmpCp, respectively, were also readily detected in the RNase T2 digest of an [
-32P]CTP-labeled uncleaved transcript. As their molar ratios were very similar to the values determined for unspliced 5' and 3' exons, respectively, this suggests the ribose-methylated form of the pre-tRNA transcript is not a preferential substrate for the splicing endonuclease in the in vitro assay. We observed that in vitro formation of Cm34 and Um39 could proceed without added S-adenosyl methionine, probably because of a sufficient endogenous concentration in the extract. However, the two methylations were completely blocked by addition of homocysteine, an inhibitor of S-adenosyl-L-methionine-dependent transmethylations, in line with the notion that S-adenosyl methionine is the methyl group donor for the reaction (data not shown).
In vitro formation of Cm34 and Um39 in pre-tRNATrp is dependent on predicted guide elements in the intron
Consistent with our model, Cm34 and Um39 did not form on an in vitro synthesized, mature H.volcanii tRNATrp during incubation with the extract, unlike
55 (Fig. 5C). To identify intronic elements important for the two-ribose methylations, a series of pre-tRNATrp transcripts harboring intron alterations, which preserve the terminal nucleotides forming the canonical BHB motif, were used as in vitro substrates (Fig. 5A and B). Formation of Cm34 and Um39 was again assessed by 2D-TLC analysis of RNase T2 digests of the purified exons. Deletion of a 76 nt long central portion spanning all box C/D hallmarks of the 105 nt long intron completely abolished Cm34 and Um39 (mutant Del2, Fig. 5A). A less thorough deletion, leaving only box C, the 3'-AE and box D (Del1, Fig. 5A) also totally suppressed both ribose methylations. In contrast, formation of
55 remained at control level, i.e. at 0.30 mol/mol pre-tRNA, in both mutants (Fig. 5C). The observation that the intronic region spanning the two copies of 5'-AE plus downstream boxes D, D" and C may control the methylation guide activity of the 3'-AE was rather unexpected. In eukaryotic snoRNAs, in which D and C boxes act in concert in the methylation guided by the 5'-AE, alteration of boxes D and C does not hamper methylation guided by the 3'-AE (8). All the mutants we examined were still faithfully and efficiently cleaved by the splicing endonuclease, except for one,
D, which harbors a box D deletion (Fig. 5B and C). Whereas BHB nucleotides remained intact in this mutant, formation of the BHB motif is unlikely on a thermodynamical basis (data not shown). Moreover, not only Cm34, as expected, but also Um39, were not formed on the
D splicing-incompetent transcript, probably reflecting its trapping into a stable non-functional conformer (Fig. 5C). The separate deletion of box D or box D", both located immediately downstream from one of the two copies of the 5'-AE targeting Um39, was without effect not only on Cm34 as expected, but also on Um39, while
55 formation remained at control level with those mutants (Fig. 5C). Consistent with a redundant guide function of the two copies of 5'-AE, concurrent deletion of D and D" completely abolished Um39, while a substantial level of Cm34, 0.06 mol/mol pre-tRNA, was still formed (Fig. 5C). A small decrease in
55 formation was also observed with this mutant. Finally, a pre-tRNATrp transcript, ExDel (Fig. 5B), containing an intact intron and still able to form the canonical BHB but exhibiting dramatic exonic deletions (23 and 31 nt at the 5' and 3' ends of the 5' and 3' exons, respectively), still sustained Cm34 and Um39 formation. This is in line with the notion that the two ribose methylations do not depend on specific features of the pre-tRNA architecture outside the intron and splice junctions. No
formation was detected for the ExDel mutant, in agreement with the assignment of U55 as the single site of pre-tRNATrp pseudouridylation in vitro.
|
| DISCUSSION |
|---|
|
|
|---|
Box C/D RNAs that are able to target ribose methylations onto tRNAs have been predicted recently in archaea on the basis of genomic searches (20,41). Our present study strongly supports this notion through phylogenetic and experimental evidence. Among the growing list of eukaryotic C/D box snoRNAs devoid of likely rRNA or snRNA targets (1215), none of them exhibits this potential exclusively found so far in the Euryarchaeota kingdom of Archaea. One of the four novel archaeal C/D RNAs characterized in this study, the pre-tRNATrp intron, is outstanding in every respect. Whereas intron-encoded C/D snoRNAs are widespread in vertebrates, this is so far the sole archaeal intron in GenBank that harbors C/D small RNA hallmarks. Moreover, among the scores of C/D small RNAs reported in archaea or eukaryotes, this is the first specimen with a presumably cis-acting methylation guide activity and the first case to our knowledge of a guide function faithfully reproduced in vitro.
We have been able to test the formation of five nucleotide modifications of H.volcanii tRNATrp in our in vitro assay. Two of them, m1
54 and
55, shared by almost all H.volcanii tRNA species (35), appear insensitive to the intron structure (Fig. 5C). Likewise, modifications of positions 54 and 55 can occur on minisubstrates comprised of only the T
loop of E.coli, yeast or H.volcanii tRNAs in the presence of a cell-free extract of Pyrococcus furiosus (42). Moreover, formation of these two modifications in eukaryotic tRNAs is also insensitive to the presence of an intron (43). Conversely, in vitro formation of Cm34 and Um39 in H.volcanii tRNATrp is strictly dependent on the presence and integrity of the pre-tRNATrp intron (Fig. 5). However, analysis of the ExDel mutant shows the two methylations do not require any specific feature of the mature tRNA three-dimensional conformation, unlike another ribose methylation widespread in archaeal tRNAs, Cm56 (42). Although a few cases of intron-dependent tRNA modifications have been reported in eukaryotes, none of them involves a ribose methylation (reviewed in 43; 4446). Moreover, the ribose methylation of position 34 in yeast tRNAPhe requires the absence of the cognate intron, pointing to an entirely different biosynthetic process in eukaryotes (47). This is in line with our negative searches of the yeast genome for presumptive box C/D RNAs, which could guide ribose methylations of yeast pre- or mature tRNAs. Among H.volcanii tRNAs, tRNATrp is the only species in which position 39 is ribose methylated but ribose methylation of position 34 is found in a single additional tRNA, tRNAMet (35). Based on phylogenetic evidence among euryarchaea (Fig. 1B), formation of tRNAMet Cm34 in the Pyrococcus could also involve a C/D small RNA guide, sR49, which remains without a known homolog in H.volcanii so far. The fifth tRNATrp modification we have tested in vitro, Cm32, was not catalyzed by the H.volcanii extract. Although a box C/D sRNA able to guide in trans Cm32 formation in Pyrococcus tRNATrp, through a 10 bp long duplex, has been predicted (20), its potential homolog has not been identified in H.volcanii, leaving open the possibility that an entirely different process is involved in halophiles.
In the two phylogenetically supported, intramolecular RNA duplexes (Figs 1B and 2), ribose-methylated positions 34 and 39 are each at the fifth position upstream from box D or D, pointing to a nucleotide targeting mechanism closely related to the snoRNA-guided methylation of eukaryotic rRNAs or snRNAs (57,9). In agreement with this notion, analysis of the various mutants shows the key importance for ribose methylation of the box D (or D) motif downstream from each antisense element in the intron (Fig. 5). Moreover, we have observed (B.Clouet dOrval and B.Charpentier, unpublished results) that the H.volcanii pre-tRNATrp intron specifically binds in vitro the archaeal homolog of the 15.5 kDa human protein that selectively recognizes the hallmark stem-internal loopstem structural motif involving boxes C and D in C/D snoRNAs (25,48). This is in line with the presence of two copies of the C/D (or C/D) motif within the splicing-competent structure of the pre-tRNATrp intron (Fig. 5B). Intriguingly, the presumably cis-acting intronic C/D guide has the additional potential, in the Pyrococcus but not in halophiles, to direct in trans a ribose methylation on C1252 in 16S rRNA, possibly after intron excision (20). Many questions remain concerning the molecular mechanisms of the intramolecularly guided methylations and their potential coupling with tRNA splicing. Both types of reactions, RNA-guided ribose methylation and tRNA splicing, depend on mutually exclusive folding patterns of the pre-tRNA intron and its stepwise structural rearrangements during processing (Fig. 6). Accordingly, the cognate canonical signals, i.e. an antisense element associated with a downstream box D (or D) and a BHB motif, respectively, cannot be the sole determinants of each type of reaction and pleiotropic effects of intronic mutations can be observed. Thus, box D deletion, which inhibits formation not only of Cm34 as predicted but also of Um39, in addition blocks splicing, probably through an altered folding of BHB nucleotides. Functional dissection of the intron is also hampered by the presence of redundant guide elements for formation of Um39 in halophiles. Methylation- and splicing-competent foldings of the halophilic pre-tRNATrp intron share two elementary, phylogenetically conserved stems and have similar overall free energies (Fig. 6, and data not shown). Concurrent formation of the two methylation guide duplexes involves formation of at least one pseudoknot (two if the intronic 5'3' terminal stem is formed). However, the two methylation reactions can be uncoupled in vitro: Cm34 was still formed at a substantial level when Um39 formation was completely blocked by concomittent deletion of boxes D and D" (Fig. 5).
|
Ribose methylations are thought to play a general role in stabilizing overall RNA structure in hyperthermophilic conditions (49). Consistent with this notion, they are present in increasing numbers in rRNAs of S.solfataricus grown at increasing temperatures (18). Conversely, only a few C/D small RNAs have been detected in the genomes of mesophiles or moderate thermophiles (20,41). Ribose methylations at positions 34 and 39 in H.volcanii tRNATrp, i.e. in stem portions of the BHB, might obviously modulate pre-tRNA splicing in vivo by stabilizing the BHB splicing motif, although pre-tRNATrp cleavage in vitro does not seem to depend on the presence of Cm34 and Um39. Interestingly, the H.volcanii splicing endonuclease is unable to function in vitro in high salt conditions, an environment native to the enzyme, suggesting this enzyme might interact in vivo with other proteins, possibly not only the ligase (27) but also the ribose methylation apparatus. A major deletion within the H.volcanii pre-tRNATrp intron (which retained only 22 nt preserving BHB formation) did not abolish processing in vitro (27). However, intron cleavage was less efficient in vivo (50), suggesting structural elements in the intron core might mediate splicing efficiency, possibly through the formation of Cm34 and Um39. Obviously, ribose methylation of position 34 might also affect codonanticodon recognition in tRNATrp and tRNAMet, which are unique among all euryarchaeal tRNA species because of their recognizing a single codon.
The relationship, in terms of guiding ribose methylation, between previously reported trans-acting box C/D small RNAs and the novel, presumably cis-acting tRNATrp C/D intron is not without precedent. It is clearly reminiscent of the relationship identified in terms of splicing between the nuclear spliceosomal introns and group II introns: whereas the RNA sequences required for excision and ligation are provided in trans by snRNAs for nuclear pre-mRNA splicing, they are provided in cis in group II introns, widely believed to have been ancestors of spliceosomal introns. At this stage, multiple evolutionary scenarii could account for the origin of the outstanding euryarchaeal tRNATrp intron. Instead of reflecting common ancestry, methylation guide hallmarks in the intron might result from convergent evolution, driven by box-binding proteins of trans-acting C/D small RNPs and the selective advantage provided by long intramolecular RNA duplexes for appropriate folding and splicing of the pre-tRNA. At the other extreme, one might envision that the ribose methylation of tRNATrp positions 34 and 39 was originally directed by a trans-acting C/D RNA guide. This guide might have been later inserted within the tRNATrp intron, in a common ancestor of euryarchaea, possibly as the result of an erroneous tRNATrp-splicing event, in relation with the close mechanistic interaction of the two RNA molecules during splicing. This would be somewhat reminiscent of the hypothesis proposed for the origin of mRNA-type introns into the catalytic site of U6 snRNA through reverse splicing (51). However, for the various archaea with a tRNATrp intron devoid of cis-acting C/D guide hallmarks, our genomic searches for a cognate, trans-acting C/D RNA were negative. In a variant version of the previous scenario, insertion within the tRNATrp gene could have involved not the cognate C/D RNA guide but another, unrelated trans-acting C/D RNA. Antisense elements of this unrelated guide, which could have been originally directed to tRNA or rRNA targets, could have later converged gradually, through the accumulation of nucleotide substitutions, on tRNATrp ribose methylation targets. In any way, the C/D hallmarks might also have emerged earlier, in the tRNATrp intron of a common ancestor to Archaea and Eukarya and later been lost in crenarchaeotes and in eukaryotes, possibly due to lack of functional constraint. In this assumption, the C/D tRNATrp intron might even represent a common ancestor of the trans-acting C/D methylation guides now widespread in archaea and eukaryotes. Characterization, in a broader range of archaeal phylogeny, of the tRNATrp intron, together with the identification of additional, trans-acting C/D guides for tRNA ribose methylations, might provide support for one of these scenarii. In any case, this experimental system provides a unique opportunity to substantially further our knowledge of the enzymology of RNA-guided ribose methylations, not only in archaea but in eukaryotes as well, and allow us to better distinguish between the inherently linked functions of chaperones and methylation guides of antisense C/D RNAs (13,5).
| ACKNOWLEDGEMENTS |
|---|
We are grateful to Jérôme Cavaillé for discussions and for contributing to the experimental detection of P.abyssi small C/D RNAs, to Audrey Estampes-Barthélémie for construction of mutants. We thank P. Forterre, G. Erauso and C. Jeanthon for providing P.abyssi, Archaeoglobus profundus and Thermococcus barophilus cells, respectively, and P. López-García for the gift of halophile Halorubrum sodomense, Halobacterium salinarium and Haloarcula hispanica cells. Y. De Préval is thanked for oligodeoxynucleotide synthesis. This work was supported by laboratory funds from the Centre National de la Recherche Scientifique, Institut National de la Recherche Agronomique and Université Paul Sabatier, Toulouse, and by a grant from the Ministère de lEducation Nationale, de la Recherche et de la Technologie to J.P.B. (Programme de Recherche Fondamentale en Microbiologie et Maladies Infectieuses et Parasitaires, 20012002).
| FOOTNOTES |
|---|
* To whom correspondence should be addressed. Tel: +33 5 61 33 59 34; Fax: +33 5 61 33 58 86; Email: bachel{at}ibcg.biotoul.fr
| REFERENCES |
|---|
|
|
|---|
-
1 Bachellerie,J.P. and Cavaille,J. (1997) Guiding ribose methylation of rRNA. Trends Biochem. Sci., 22, 257261.[ISI][Medline]
2 Smith,C.M. and Steitz,J.A. (1997) Sno storm in the nucleolus: new roles for myriad small RNPs. Cell, 89, 669672.[ISI][Medline]
3 Bachellerie,J.P. and Cavaillé,J. (1998) Small nucleolar RNAs guide the ribose methylations of eukaryotic rRNAs. In Grosjean,H. and Benne,R. (eds), Modification and Editing of RNA: The Alteration of RNA Structure and Function. ASM Press, Washington, DC, pp. 255272.
4 Bachellerie,J.P., Michot,B., Nicoloso,M., Balakin,A., Ni,J. and Fournier,M.J. (1995) Antisense snoRNAs: a family of nucleolar RNAs with long complementarities to rRNA. Trends Biochem. Sci., 20, 261264.[ISI][Medline]
5 Nicoloso,M., Qu,L.H., Michot,B. and Bachellerie,J.P. (1996) Intron-encoded, antisense small nucleolar RNAs: the characterization of nine novel species points to their direct role as guides for the 2'-O-ribose methylation of rRNAs. J. Mol. Biol., 260, 178195.[ISI][Medline]
6 Kiss-Laszlo,Z., Henry,Y., Bachellerie,J.P., Caizergues-Ferrer,M. and Kiss,T. (1996) Site-specific ribose methylation of preribosomal RNA: a novel function for small nucleolar RNAs. Cell, 85, 10771088.[ISI][Medline]
7 Cavaillé,J., Nicoloso,M. and Bachellerie,J.P. (1996) Targeted ribose methylation of RNA in vivo directed by tailored antisense RNA guides. Nature, 383, 732735.[Medline]
8 Kiss-Laszlo,Z., Henry,Y. and Kiss,T. (1998) Sequence and structural elements of methylation guide snoRNAs essential for site-specific ribose methylation of pre-rRNA. EMBO J., 17, 797807.[ISI][Medline]
9 Tycowski,K.T., You,Z.H., Graham,P.J. and Steitz,J.A. (1998) Modification of U6 spliceosomal RNA is guided by other small RNAs. Mol. Cell, 2, 629638.[ISI][Medline]
10 Ganot,P., Jady,B.E., Bortolin,M.L., Darzacq,X. and Kiss,T. (1999) Nucleolar factors direct the 2'-O-ribose methylation and pseudouridylation of U6 spliceosomal RNA. Mol. Cell. Biol., 19, 69066917.
11 Jady,B.E. and Kiss,T. (2001) A small nucleolar guide RNA functions both in 2'-O-ribose methylation and pseudouridylation of the U5 spliceosomal RNA. EMBO J., 20, 541551.[ISI][Medline]
12 Hüttenhofer,A., Kiefmann,M., Meier-Ewert,S., OBrien,J., Lehrach,H., Bachellerie,J.P. and Brosius,J. (2001) RNomics: an experimental approach that identifies 201 candidates for novel, small, non-messenger RNAs in mouse. EMBO J., 20, 29432953.[ISI][Medline]
13 Cavaillé,J., Buiting,K., Kiefmann,M., Lalande,M., Brannan,C.I., Horsthemke,B., Bachellerie,J.P., Brosius,J. and Hüttenhofer,A. (2000) Identification of brain-specific and imprinted small nucleolar RNA genes exhibiting an unusual genomic organization. Proc. Natl Acad. Sci. USA, 97, 1431114316.
14 Jady,B.E. and Kiss,T. (2000) Characterisation of the U83 and U84 small nucleolar RNAs: two novel 2'-O-ribose methylation guide RNAs that lack complementarities to ribosomal RNAs. Nucleic Acids Res., 28, 13481354.
15 Cavaillé,J., Vitali,P., Basyuk,E., Hüttenhofer,A. and Bachellerie,J.P. (2001) A novel brain-specific box C/D small nucleolar RNA processed from tandemly-repeated introns of a non-coding RNA gene in rat. J. Biol. Chem., 276, 2637426383.
16 Maden,B.E.H. (1990) The numerous modified nucleotides in eukaryotic ribosomal RNA. Prog. Nucleic Acid Res. Mol. Biol., 39, 241301.[Medline]
17 Ofengand,J. and Rudd,K. (2000) Bacterial, archaea, and organellar RNA pseudouridines and methylated nucleosides and their enzymes. In Garrett,R., Douthwaite,S., Liljas,A., Matheson,A., Moore,P.B. and Noller,H. (eds), Ribosome: Structure, Function, Antibiotics, and Cellular Interaction. ASM Press, Washington, DC, pp. 175190.
18 Noon,K.R., Bruenger,E. and McCloskey,J.A. (1998) Posttranscriptional modifications in 16S and 23S rRNAs of the archaeal hyperthermophile Sulfolobus solfataricus. J. Bacteriol., 180, 28832888.
19 Gaspin,C., Cavaille,J., Erauso,G. and Bachellerie,J.P. (2000) Archaeal homologs of eukaryotic methylation guide small nucleolar RNAs: lessons from the Pyrococcus genomes. J. Mol. Biol., 297, 895906.[ISI][Medline]
20 Omer,A.D., Lowe,T.M., Russell,A.G., Ebhardt,H., Eddy,S.R. and Dennis,P.P. (2000) Homologs of small nucleolar RNAs in Archaea. Science, 288, 517522.
21 Amiri,K.A. (1994) Fibrillarin-like proteins occur in the domain Archaea. J. Bacteriol., 176, 21242127.
22 Wu,P., Brockenbrough,J.S., Metcalfe,A.C., Chen,S. and Aris,J.P. (1998) Nop5p is a small nucleolar ribonucleoprotein component required for pre-18 S rRNA processing in yeast. J. Biol. Chem., 273, 1645316463.
23 Lafontaine,D.L. and Tollervey,D. (1998) Birth of the snoRNPs: the evolution of the modification-guide snoRNAs. Trends Biochem. Sci., 23, 383388.[ISI][Medline]
24 Lafontaine,D.L. and Tollervey,D. (1999) Nop58p is a common component of the box C+D snoRNPs that is required for snoRNA stability. RNA, 5, 455467.[Abstract]
25 Watkins,N.J., Segault,V., Charpentier,B., Nottrott,S., Fabrizio,P., Bachi,A., Wilm,M., Rosbash,M., Branlant,C. and Lührmann,R. (2000) A common core RNP structure shared between the small nucleoar box C/D RNPs and the spliceosomal U4 snRNP. Cell, 103, 457466.[ISI][Medline]
26 Lowe,T.M. and Eddy,S.R. (1999) A computational screen for methylation guide snoRNAs in yeast. Science, 283, 11681171.
27 Thompson,L.D. and Daniels,C.J. (1988) A tRNA(Trp) intron endonuclease from Halobacterium volcanii. Unique substrate recognition properties. J. Biol. Chem., 263, 1795117959.
28 Armbruster,D.W. and Daniels,C.J. (1997) Splicing of intron-containing tRNATrp by the archaeon Haloferax volcanii occurs independent of mature tRNA structure. J. Biol. Chem., 272, 1975819762.
29 Sambrook,J., Fritsch,E.F. and Maniatis,T. (1989) Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.
30 Filipowicz,W. and Shatkin,A.J. (1983) Origin of splice junction phosphate in tRNAs processed by HeLa cell extract. Cell, 32, 547557.[ISI][Medline]
31 Hashimoto,S.M. and Muramatsu,M. (1975) 2'-O-Methylated oligonucleotides in ribosomal 18S and 28S RNA of a mouse hepatoma, MH134. Biochemistry, 14, 19561964.[Medline]
32 Keith,G. (1995) Mobilities of modified ribonucleotides on two-dimensional cellulose thin-layer chromatography. Biochimie, 77, 142144.[Medline]
33 Billoud,B., Kontic,M. and Viari,A. (1996) Palingol: a declarative programming language to describe nucleic acids secondary structures and to scan sequence database. Nucleic Acids Res., 24, 13951403.
34 Sprinzl,M., Horn,C., Brown,M., Ioudovitch,A. and Steinberg,S. (1998) Compilation of tRNA sequences and sequences of tRNA genes. Nucleic Acids Res., 26, 148153.
35 Gupta,R. (1984) Halobacterium volcanii tRNAs. Identification of 41 tRNAs covering all amino acids, and the sequences of 33 class I tRNAs. J. Biol. Chem., 259, 94619471.
36 Dennis,P.P. and Shimmin,L.C. (1997) Evolutionary divergence and salinity-mediated selection in halophilic archaea. Microbiol. Mol. Biol. Rev., 61, 90104.[Abstract]
37 Zofallova,L., Guo,Y. and Gupta,R. (2000) Junction phosphate is derived from the precursor in the tRNA spliced by the archaeon Haloferax volcanii cell extract. RNA, 6, 10191030.[Abstract]
38 Lykke-Andersen,J., Aagaard,C., Semionenkov,M. and Garrett,R.A. (1997) Archaeal introns: splicing, intercellular mobility and evolution. Trends Biochem. Sci., 22, 326331.[ISI][Medline]
39 Gomes,I. and Gupta,R. (1997) RNA splicing ligase activity in the archaeon Haloferax volcanii. Biochem. Biophys. Res. Commun., 237, 588594.[ISI][Medline]
40 Kjems,J. and Garrett,R.A. (1988) Novel splicing mechanism for the ribosomal RNA intron in the archaebacterium Desulfurococcus mobilis. Cell, 54, 693703.[ISI][Medline]
41 Dennis,P.P, Omer,A. and Lowe,T. (2001) A guided tour: small RNA function in Archaea. Mol. Microbiol., 40, 509519.[ISI][Medline]
42 Constantinesco,F., Motorin,Y. and Grosjean,H. (1999) Transfer RNA modification enzymes from Pyrococcus furiosus: detection of the enzymatic activities in vitro. Nucleic Acids Res., 27, 13081315.
43 Grosjean,H., Szweykowska-Kulinska,Z., Motorin,Y., Fasiolo,F. and Simos,G. (1997) Intron-dependent enzymatic formation of modified nucleosides in eukaryotic tRNAs: a review. Biochimie, 79, 293302.[Medline]
44 Johnson,P.F. and Abelson,J. (1983) The yeast tRNATyr gene intron is essential for correct modification of its tRNA product. Nature, 302, 681687.[Medline]
45 Strobel,M.C. and Abelson,J. (1986) Effect of intron mutations on processing and function of Saccharomyces cerevisiae SUP53 tRNA in vitro and in vivo. Mol. Cell. Biol., 6, 26632673.
46 Szweykowska-Kulinska,Z., Senger,B., Keith,G., Fasiolo,F. and Grosjean,H. (1994) Intron-dependent formation of pseudouridines in the anticodon of Saccharomyces cerevisiae minor tRNA(Ile). EMBO J., 13, 46364644.[ISI][Medline]
47 Jiang,H.Q., Motorin,Y., Jin,Y.X. and Grosjean,H. (1997) Pleiotropic effects of intron removal on base modification pattern of yeast tRNAPhe: an in vitro study. Nucleic Acids Res., 25, 26942701.
48 Vidovic,I., Nottrott,S., Hartmuth,K., Lührmann,R. and Ficner,R. (2000) Crystal structure of the spliceosomal 15.5kD protein bound to a U4 snRNA fragment. Mol. Cell, 6, 13311342.[ISI][Medline]
49 Davis,D.R. (1998) Biophysical and conformational properties of modified nucleotides in RNA (nuclear magnetic resonance studies). In Grosjean,H., and Benne,R. (ed), Modification and Editing of RNA: The Alteration of RNA Structure and Function. ASM Press, Washington DC, pp. 85102.
50 Nieuwlandt,D.T., Carr,M.B. and Daniels,C.J. (1993) In vivo processing of an intron-containing archaeal tRNA. Mol. Microbiol., 8, 9399.[ISI][Medline]
51 Tani,T. and Ohshima Y. (1991) mRNA-type introns in U6 small nuclear RNA genes: implications for the catalysis in pre-mRNA splicing. Genes Dev., 5, 10221031.
This article has been cited by other articles:
![]() |
S. K. Singh, P. Gurha, and R. Gupta Dynamic guide-target interactions contribute to sequential 2'-O-methylation by a unique archaeal dual guide box C/D sRNP RNA, July 1, 2008; 14(7): 1411 - 1423. [Abstract] [Full Text] [PDF] |
||||
![]() |
C.-L. Chen, C.-J. Chen, O. Vallon, Z.-P. Huang, H. Zhou, and L.-H. Qu Genomewide Analysis of Box C/D and Box H/ACA snoRNAs in Chlamydomonas reinhardtii Reveals an Extensive Organization Into Intronic Gene Clusters Genetics, May 1, 2008; 179(1): 21 - 30. |







