Skip Navigation

This Article
Right arrow Abstract Freely available
Right arrow Print PDF (310K) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrowRequest Permissions
Right arrow Commercial Re-use Guidelines
for Open Access NAR Content
Google Scholar
Right arrow Articles by Oberacher, H.
Right arrow Articles by Huber, C. G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Oberacher, H.
Right arrow Articles by Huber, C. G.
Related Collections
Right arrow Polymorphism/mutation detection
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Nucleic Acids Research, 2002, Vol. 30, No. 14 e67
© 2002 Oxford University Press

Re-sequencing of multiple single nucleotide polymorphisms by liquid chromatography–electrospray ionization mass spectrometry

H. Oberacher, P. J. Oefner1, G. Hölzl, A. Premstaller1, K. Davis1 and C. G. Huber*,2

Institute of Analytical Chemistry and Radiochemistry, Leopold-Franzens-University, Innrain 52a, A-6020 Innsbruck, Austria, 1 Stanford Genome Technology Center, 855 California Avenue, Palo Alto, CA 94304, USA and 2 Instrumental Analysis and Bioanalysis, Saarland University, Im Stadtwald, 66123 Saarbrücken, Germany

*To whom correspondence should be addressed. Tel: +49 681 302 2433; Fax: +49 681 302 2963; Email: christian.huber{at}mx.uni-saarland.de

Received February 6, 2002; Revised April 30, 2002; Accepted May 19, 2002


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS AND DISCUSSION
 CONCLUSIONS
 REFERENCES
 
Allelic discrimination of single nucleotide polymorphisms (SNPs) and, particularly, determination of the phase of multiple variations are of utmost importance in genetics. The physicochemical separation of alleles by completely denaturing ion-pair reversed-phase high-performance liquid chromatography and their on-line sequence determination by electrospray ionization mass spectrometry is demonstrated. Simultaneous genotyping of two and three simple sequence polymorphisms contained within 73–114 bp was accomplished with low femtomolar amounts of unpurified amplicons from polymerase chain reaction. Determination of allelic composition is enabled by the high accuracy (better than 0.019%) of intact mass measurements or by comparative sequencing using gas-phase fragmentation and tandem mass spectrometry in combination with fully automated, computer-aided data interpretation.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS AND DISCUSSION
 CONCLUSIONS
 REFERENCES
 
The high frequency of single nucleotide polymorphisms (SNPs) in the human genome makes them a valuable source of genetic markers for identity testing, mapping of simple and complex traits, genotype–phenotype association studies and reconstruction of human evolution. Numerous methods have been introduced for determining the allelic state of individual SNPs and these have been reviewed recently (1,2). During the past years, mass spectrometry (MS) (3), specifically matrix-assisted laser desorption-ionization mass spectrometry (MALDI-MS) and electrospray ionization mass spectrometry (ESI-MS), have emerged as powerful analytical tools for the genotyping of SNPs. While MALDI-MS is predominantly utilized for the high-throughput analysis of short products of primer extension mini-sequencing reactions (46), ESI-MS is applicable to the mass analysis of single- and double-stranded nucleic acids ranging in size from a few nucleotides to >500 bp (79).

Moreover, tandem mass spectrometry (MS/MS), which is based on the gas phase collision-induced fragmentation of nucleic acids, has been shown to yield sequence information for oligomers up to 100mer (8,10,11). One of the major prerequisites for successful characterization of femtomolar amounts of nucleic acids by MS is high purity of the sample and comprehensive removal of cationic adducts (3) in order to obtain mass spectra of high quality from which the molecular masses can be deduced with high accuracy. In due consequence, purification of nucleic acids prior to mass spectrometric investigation by suitable off-line or on-line techniques such as ethanol precipitation (12), solid-phase extraction (13), affinity purification (14), or liquid chromatography (15) is indispensable.

The information content of SNPs increases considerably when several SNPs are combined to form haplotypes. Haplotypes are usually inferred from individual unphased SNP genotypes. Although the accuracy of such inferences tends to be excellent (16), experimental confirmation is still desirable. This is traditionally accomplished by cloning or allele-specific polymerase chain reaction (PCR), followed by Sanger sequencing (1). Here we demonstrate the ability of completely denaturing ion-pair reversed-phase high-performance liquid chromatography (ion-pair reversed-phase HPLC) (17) to purify the different alleles and to determine their sequence on-line by ESI-MS or ESI-MS/MS. This will have broad applicability in clinical, microbial, forensic and population genetics. The method constitutes an inexpensive and rapid alternative to conventional Sanger sequencing with sample pre-treatment being limited to PCR only.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS AND DISCUSSION
 CONCLUSIONS
 REFERENCES
 
Chemicals and materials
Acetonitrile (HPLC gradient-grade) and water (HPLC grade) were obtained from Merck (Darmstadt, Germany). Butyldimethylamine (analytical reagent grade) was purchased from Fluka (Buchs, Switzerland). A stock solution of butyldimethylammonium bicarbonate was prepared by passing carbon dioxide gas (AGA, Vienna, Austria) through a 0.50 M aqueous solution of the amine at 5°C until pH 8.4–8.9 was reached.

Discovery of SNPs in sequence tag sites (STSs)
STS sequences were provided by the Stanford Human Genome Center. Using denaturing HPLC and conventional sequencing, STSs were screened for the presence of SNPs in a nested subset of 24 individuals from the DNA Polymorphism Discovery Resource assembled by the National Human Genome Research Institute (18). STSs containing two or more SNPs were blasted against the human genome draft sequence to confirm that they represent unique sequences.

Polymerase chain reaction
PCR reactions were performed in a 50 µl volume containing 45 ng of genomic DNA, 25 µl of PCR Master Mix (Qiagen, Hilden, Germany), and 0.4 µM of each primer (G-109954f, TTAAAAATAGAACAGCATGAAGGAG; G-109954r, GT TCCATATTCTAGGTCTTCCAAG; G-107827f, ACCCT GGTGGAGCTATGTAGTTC; G-107827r, CGTGAGCTT GACTATGAGGTCTC; G-101769f, GATTTCAAGTTTT GTCTTCTTCCT; G-101769r, GGGAGCAGAGCACC ATCAT; all primers were obtained from Life Technologies, Rockville, MD; the indexes r and f are used to distinguish between the reverse and forward primers, respectively). Amplification was carried out in a thermocycler (Mastercycler Personal; Eppendorf, Hamburg, Germany) comprising 35 cycles of 94°C denaturation for 60 s, 54–56°C annealing for 60 s, and 72°C extension for 60 s. Prior to amplification the enzyme was activated by a 95°C incubation for 15 min. Following a final extension step at 72°C for 10 min, samples were chilled to 4°C.

Ion-pair reversed-phase HPLC-ESI-MS
The scheme of an instrumental set-up suitable for the direct analysis of PCR amplicons is illustrated in Figure 1A. In brief, a primary flow of 100–150 µl/min was delivered by a gradient micropump (Model Rheos 2000; Flux Instruments, Basel, Switzerland) and split by means of a tee-piece and a restriction capillary (1 m length, 375 µm o.d., 50 µm i.d.) to generate a constant secondary flow of 2.0 µl/min through the separation column. All separations were performed in monolithic, poly-(styrene/divinylbenzene) polymer-based capillary columns (60 x 0.20 mm i.d.) prepared according to a published protocol (15). The column temperature was held at 70°C with a heat-jacket thermostated by a circulating water bath (model K 20 KP, Lauda, Lauda-Königshofen, Germany). 500 nl volumes of PCR products were injected onto the column through a nano-injection valve (model C4-1004; Valco Instruments Co., Inc., Houston, TX). Separation and purification of the PCR products was accomplished by ion-pair reversed-phase HPLC using 25 mM butyldimethylammonium bicarbonate as ion-pair reagent and acetonitrile as gradient former.



View larger version (41K):
[in this window]
[in a new window]
 
Figure 1. (A) Schematic of an analytical system suitable for genotyping by liquid chromatography-mass spectrometry. (1) Low pressure binary gradient micropump; (2) splitting tee-piece; (3) restriction capillary; (4) 500 nl injector; (5) syringe for sample introduction; (6) ground; (7) column thermostat; (8) monolithic capillary column; (9) syringe pump pumping sheath liquid; (10) tee-piece for adding organic solvent; (11) metal union for applying high voltage; (12) tee-piece for adding sheath gas; (13) quadrupole ion trap mass spectrometer; (14) atmospheric pressure ion source; (15) ion optics; (16) ion trap; (17) ion detector; (18) vacuum system; (19) inlet for helium gas. The illustrations in (BF) outline the steps of haplotype identification by ESI-MS or ESI-MS/MS; see text for details.

 
Separated nucleic acids were detected and mass analyzed by ESI-MS in an ion trap mass spectrometer (LCQ Finnigan, San Jose, CA). In order to enhance detection sensitivity, a flow of 3.0 µl/min acetonitrile was added post-column by means of a syringe pump and a tee-piece (19). Mass calibration and auto tuning were performed in the positive ion mode by direct infusion of a solution of caffeine (Sigma, St Louis, MO), methionyl-arginyl-phenylalanyl-alanine (Thermo Finnigan), and Ultramark 1621 (Thermo Finnigan). Fine tuning for ESI-MS of oligodeoxynucleotides in the negative ion mode was performed by infusion of 3.0 µl/min of a 10 pmol/µl solution of a 50mer of mixed sequence in 25 mM aqueous butyldimethylammonium bicarbonate containing 20% acetonitrile (v/v).

Comparative sequencing by MS/MS
For MS/MS experiments, a multiply charged precursor ion was isolated in the ion trap and subsequently fragmented upon energetic gas-phase collisions with the atoms of a collision gas. The isolation width and the relative collision energy were set to 4.0 and 18%, respectively. Helium, present in the ion trap at a pressure of 0.1 Pa, served as collision gas. The MS/MS spectra were interpreted by a comparative sequencing algorithm described in detail elsewhere (11). A copy of the program for academic use is available upon request from the corresponding author and a web-interface for data evaluation is in preparation at http://insertion.stanford.edu/sequencing.


    RESULTS AND DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS AND DISCUSSION
 CONCLUSIONS
 REFERENCES
 
Strategies for the determination of haplotypes by mass spectrometry
Figure 1A schematically outlines the instrumentation required for genotyping by ion-pair reversed-phase HPLC-ESI-MS and ion-pair reversed-phase HPLC-ESI-MS/MS. The PCR-amplified genomic sequences are chromatographed as single strands in a capillary column under completely denaturing conditions (70°C, Fig. 1B) and subsequently characterized on-line by ESI-MS or ESI-MS/MS in a quadrupole ion trap mass spectrometer. Since variable numbers of protons can dissociate from the sugar–phosphate backbone of the nucleic acids, the raw mass spectra show a series of multiply charged ions each representing the molecular mass of the intact molecule (Fig. 1C). The m/z values for the individual charge states are deconvoluted by an algorithm yielding the intact molecular mass (Fig. 1D) with typical relative mass deviations of 0.01–0.02% (20). This high mass accuracy is a consequence of the multiple representation of the molecular mass in the mass spectrum and enables the discrimination of nucleic acid sequences that differ in molecular mass by as little as 3–6 Da in a total mass of 31 000 Da (~100 nt). Moreover, the resolving power of quadrupole ion trap mass analyzers is sufficient to differentiate two oligodeoxynucleotides having a mass difference of 9 Da (the mass difference between an adenosine and a thymine) up to a length of ~75 nt.

For sequence determination by MS/MS, a precursor ion is selected from the series of multiply charged ions and subsequently fragmented by collision induced dissociation. The experiment yields fragment ion mass spectra that become increasingly complex with increasing length of the fragmented oligonucleotide (Fig. 1E). Manual interpretation of such mass spectra is rather complicated and time-consuming. However, a computer-based algorithm (11), which compares the measured spectrum with the m/z values predicted from a reference sequence (e.g. the sequence of one of the haplotypes) employing established fragmentation pathways, enables the fully automated interpretation of fragment ion spectra of oligodeoxynucleotides ranging in size from a few to >80 nt.

The closeness of matching between the experimental spectrum and the predicted set of fragment ions is characterized by a value FS for the fitness, where smaller FS values stand for a better match. In order to identify the sequence most closely matching the experimental spectrum, e.g. alternative haplotypes, the first reference sequence is sequentially varied by incorporating each of the four possible nucleotides at all positions in the reference sequence and recalculating the fitness. The result is presented in a diagram, where the FS values for the first reference sequence as well as those of the sequences containing the alternative nucleotides, distinguished by the letters A, C, G and T, are plotted versus the position in the sequence (Fig. 1F and G). A perfect match between the reference sequence and the investigated sequence is indicated in a diagram, where the fitness for the reference sequence is lowest throughout the sequence (Fig. 1F). Mutations are spotted at positions where the fitness values for alternative nucleotides are lower than that of the reference sequence (Fig. 1G, a C->T mutation is indicated by the lowest fitness value at position 2).

Determination of multiple SNPs by intact molecular mass measurements
The identification of SNPs in a 76-bp amplicon containing two polymorphic sites, namely A->T and A->G, located at positions 26 and 40, respectively, from the 5' end of the forward primer, is depicted in Figure 2. Chromatography was performed under completely denaturing conditions. The reverse and forward strands of the double-stranded PCR product were partly separated. Though it is feasible to resolve the two strands completely, as chromatography on a poly-(styrene/divinylbenzene) matrix separates single-stranded DNA fragments as a function of base composition rather than size (17), this is not necessary because the masses of the eluting single-stranded DNA fragments can be determined unambiguously even if eluted in a single peak. Mass spectra for both single strands were extracted from the reconstructed ion chromatogram (Fig. 2A) and deconvoluted to yield intact molecular masses of 23 915 and 23 218 Da, respectively (Fig. 2B and C). The measured molecular masses corresponded excellently with the theoretical masses inferred from the forward and reverse sequences of the A,A allele (Table 1) and, thus, clearly identified the sample as a homozygous A,A haplotype.



View larger version (26K):
[in this window]
[in a new window]
 
Figure 2. Determination of multiple SNPs in a homozygous 76-bp amplicon of STS G-109954 by ion-pair reversed-phase HPLC-ESI-MS [(A) reconstructed ion chromatogram, deconvoluted mass spectrum of (B) the forward single strand and (C) the reverse single strand]. Column, PS-DVB monolith, 60 x 0.20 mm i.d.; mobile phase, (A) 25 mM butyldimethylammonium bicarbonate, pH 8.40, (B) 25 mM butyldimethylammonium bicarbonate, pH 8.40, 40% acetonitrile; linear gradient, 5–70% B in 10 min, flow-rate, 2.0 µl/min; temperature, 70°C; scan, 500–2000; post-column addition of 3.0 µl/min acetonitrile; sample, 500 nl PCR product.

 

View this table:
[in this window]
[in a new window]
 
Table 1. Measured and theoretical molecular masses Mr used for the determination of haplotypes by ion-pair reversed-phase HPLC-ESI-MS

 
The 312 Da higher than expected molecular mass of the forward strand is the result of the commonly observed non-template addition of an extra deoxyadenosine by Taq polymerase (20,21). The haplotypes A,G and T,G were found in a heterozygous sample that was analyzed under the same conditions as in Figure 2 (chromatogram and spectra not shown). Table 1 summarizes the theoretical and measured masses of the three haplotypes observed for STS G-109954 in a total of 24 individuals. The same three haplotypes had been inferred by a maximum-parsimony approach (22) using the individual genotype data. As a consequence, the occurrence of recombination or recurrent mutation could be ruled out. This example clearly demonstrates that the mass resolution of the quadrupole ion trap mass analyzer is sufficient to resolve PCR amplicons having a mass difference as small as 9 Da in a molecular mass of 23 000 Da.

The genotyping of a heterozygous 114-bp PCR amplicon with three polymorphic loci (STS G-107827, A->C at position 34, G->A at position 35, and A->T at position 87 from the 5' end of the forward primer) is shown in Figure 3. Deconvolution of the mass spectra extracted from the two partly resolved peaks (Fig. 3A) gave four different molecular masses, indicating that the analyzed sample is heterozygous (Fig. 3B and C). Indeed, comparison of the measured molecular masses with the theoretical masses calculated from the sequences of the possible haplotypes readily characterized the sample as heterozygous C,A,T/A,G,A (Table 1). A third haplotype (A,A,T), predicted by inference from individual SNP genotypes using a maximum-parsimony approach (22) was identified in another heterozygous sample (Table 1). It can be deduced from Table 1 that the mass deviations in all measurements did not exceed ±0.019%, irrespective of the size of the PCR product. This high accuracy is a prerequisite for distinguishing the different alleles. Potential ambiguities due to the compatibility of the measured molecular mass of one single strand with more than one haplotype can be usually unequivocally resolved by the molecular mass of the complementary strand (Table 1).



View larger version (23K):
[in this window]
[in a new window]
 
Figure 3. Determination of multiple SNPs in a heterozygous 114-bp amplicon of STS G-107827 by ion-pair reversed-phase HPLC-ESI-MS [(A) reconstructed ion chromatogram, deconvoluted mass spectrum of (B) the forward single strands and (C) the reverse single strands]. Column, PS-DVB monolith, 60 x 0.20 mm i.d.; mobile phase, (A) 25 mM butyldimethylammonium bicarbonate, pH 8.40, (B) 25 mM butyldimethylammonium bicarbonate, pH 8.40, 40% acetonitrile; linear gradient, 5–70% B in 10 min, flow-rate, 2.0 µl/min; temperature, 70°C; scan, 500–2000; post-column addition of 3.0 µl/min acetonitrile; sample, 500 nl PCR product.

 
Determination of multiple SNPs by comparative DNA sequencing
The two polymorphic loci present in a 73-bp fragment of STS G-101769 were utilized to investigate the feasibility of genotyping by MS/MS. Although the haplotypes in this case could have been determined unequivocally by mass measurement in the MS mode only, there are instances in which this is not possible such as when both substitutions are of identical nature yielding either an A,G or a G,A haplotype of identical mass. In such cases, fragmentation of the DNA strands by means of collisions with helium atoms allows effective re-sequencing and determination of the order of bases.

For the 73-bp fragment of STS G-101769, the 18– charge state of the on-line ion-pair reversed-phase HPLC-purified reverse strand was isolated in the ion trap and fragmented at 18% relative collision energy. The polymorphic sequence comprised a C->T and a G->T at positions 42 and 48, respectively, from the 5' end. The m/z values and relative signal intensities in the fragment ion spectrum served as input for the comparative sequencing algorithm. Figure 4 depicts the fitness diagrams using the reverse strand sequences of the three inferred haplotypes as reference sequences.



View larger version (28K):
[in this window]
[in a new window]
 
Figure 4. Comparative sequencing and determination of haplotype in a 73-bp amplicon of STS G-101769 by ion-pair reversed-phase HPLC-ESI-MS/MS. Experimental conditions: column, PS-DVB monolith, 60 x 0.20 mm i.d.; mobile phase, (A) 10 mM butyldimethylammonium bicarbonate, pH 8.40, (B) 10 mM butyldimethylammonium bicarbonate, pH 8.40, 40% acetonitrile; linear gradient, 5–70% B in 10 min, flow-rate, 2.0 µl/min, reduced to 250 nl/min at 5.2 min; temperature, 70°C; product ions of the 18– charged species at m/z 1882.2, 4.0 isolation width, 18% relative collision energy; scan, 340–2000; post-column addition of 250 nl/min acetonitrile; sample, 500 nl PCR product. The fragment ion spectra obtained were compared computationally (11) with the theoretical ion spectra of the three haplotypes expected by inference from individual SNP genotype data using a maximum-parsimony approach. The resulting fitness diagrams are shown for the haplotypes (A) C,G, (B) T,G and (C) T,T.

 
For clarity of presentation, only the nucleotides between the two primers from position 20–49 are included in the diagrams. It becomes clear from Figure 4A that the sequence of the C,G haplotype did not match the experimental data. A T at position 42 is most likely the correct base, because the fitness of a sequence containing a T at position 42 is most significantly lower than that of the reference sequence, having a G at position 42 (Fig. 4A). In fact, incorporation of the T instead of the G into position 42 of the sequence, essentially giving the T,G haplotype, showed a perfect match between the fragment ion spectrum and the reference sequence (Fig. 4B). The fitness diagram of the T,T haplotype, shown in Figure 4C, suggested a G rather than a T at position 48, yielding again the T,G haplotype. Hence, all three fitness diagrams positively confirmed the identity of the investigated haplotype as T,G in the reverse strand.


    CONCLUSIONS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS AND DISCUSSION
 CONCLUSIONS
 REFERENCES
 
Intact molecular mass measurements by ESI-MS and gas-phase sequencing by ESI-MS/MS of PCR amplicons represent rapid and less expensive alternatives to traditional genotyping by means of cloning and conventional sequencing. Computer-based algorithms enable the fully automated analysis and interpretation of data. The major advantage of on-line sample preparation by liquid chromatography is not only the efficient removal of impurities and cationic adducts but also the possibility to denature the double strand to examine individually both single strands of a PCR-amplified DNA fragment. Both ESI-MS and ESI-MS/MS yield information about the phase of the individual SNP as an inherent property of the measured molecular mass or the fragment ion spectra, respectively. Although genotyping is currently limited to fragments not longer than 120 bp, genomes are known to contain hypervariable regions that lend themselves among other things to the elucidation of the evolutionary history of modern humans (22) and molecular fingerprinting of microorganisms (23).


    ACKNOWLEDGEMENTS
 
This work was financially supported by the Austrian Science Fund (P-14133-PHY) and the National Institutes of Health (HG01932). A.P. is the recipient of an Erwin Schrödinger stipend (J1922) awarded by the Austrian Science Fund.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS AND DISCUSSION
 CONCLUSIONS
 REFERENCES
 

  1. Kristensen,V.N., Kelefiotis,D., Kristensen,T. and Borresen-Dale,A.L. (2001) High-throughput methods for detection of genetic variation. Biotechniques, 30, 318–322.[Web of Science][Medline]

  2. Gut,I.G. (2001) Automation in genotyping of single nucleotide polymorphisms. Hum. Mutat., 17, 475–492.[Web of Science][Medline]

  3. Nordhoff,E., Kirpekar,F. and Roepstorff,P. (1996) Mass spectrometry of nucleic acids. Mass Spectrom. Rev., 15, 76–138.

  4. Haff,L.A. and Smirnov,I.P. (1997) Single-nucleotide polymorphism identification assays using a thermostable DNA polymerase and delayed extraction MALDI-TOF mass spectrometry. Genome Res., 7, 378–388.[Abstract/Free Full Text]

  5. Sauer,S., Lechner,D., Berlin,K., Lehrach,H., Escary,J.-L., Fox,N. and Gut,I.G. (2000) A novel procedure for efficient genotyping of single nucleotide polymorphisms. Nucleic Acids Res., 28, e13.[Abstract/Free Full Text]

  6. Buetow,K.H., Edmonson,M., MacDonald,R., Clifford,R., Yip,P., Kelley,J., Little,D.P., Strausberg,R., Koester,H., Cantor,C.R. et al. (2001) High-throughput development and characterization of a genomewide collection of gene-based single nucleotide polymorphism markers by chip-based matrix-assisted laser desorption/ionization time-of-flight mass spectrometry. Proc. Natl Acad. Sci. USA, 98, 581–584.[Abstract/Free Full Text]

  7. Muddiman,D.C., Null,A.P. and Hannis,J.C. (1999) Precise mass measurement of a double-stranded 500 base-pair (309 kDa) polymerase chain reaction product by negative ion electrospray ionization Fourier transform ion cyclotron resonance mass spectrometry. Rapid Commun. Mass Spectrom., 13, 1201–1204.[Web of Science][Medline]

  8. Krahmer,M.T., Walters,J.J., Fox,K.F., Fox,A., Creek,K.E., Pirisi,L., Wunschel,D.S., Smith,R.D., Tabb,D.L. and Yates,J.R. (2000) MS for identification of single nucleotide polymorphisms and MS/MS for discrimination of isomeric PCR products. Anal. Chem., 72, 4033–4040.[Medline]

  9. Oberacher,H., Oefner,P.J., Parson,W. and Huber,C.G. (2001) On-line liquid chromatography–mass spectrometry: a useful tool for the detection of DNA sequence variation. Angew. Chem. Int. Ed., 40, 3828–3830.

  10. Little,D.P., Aaserud,D.J., Valaskovic,G.A. and McLafferty,F.W. (1996) Sequence information from 42–108-mer DNAs (complete for a 50-mer) by tandem mass spectrometry. J. Am. Chem. Soc., 118, 9352–9359.

  11. Oberacher,H., Wellenzohn,B. and Huber,C.G. (2001) Comparative sequencing of nucleic acids by liquid chromatography–tandem mass spectrometry. Anal. Chem., 73, 211–218.

  12. Tsuneyoshi,T., Ishikawa,K., Koga,Y., Naito,Y., Baba,S., Terunuma,H., Arakawa,R. and Prockop,D.J. (1997) Mass spectrometric gene diagnosis of one-base substitution from polymerase chain reaction amplified human DNA. Rapid Commun. Mass Spectrom., 11, 719–722.[Web of Science][Medline]

  13. Brezinschek,H.P., Brezinschek,R.I. and Lipsky,P.E. (1995) Analysis of the heavy chain repertoire of human eripheral B cells using single-cell polymerase chain reaction. J. Immunol., 155, 190–202.[Abstract]

  14. Ross,P.L. and Belgrader,P. (1997) Analysis of short tandem repeat polymorphisms in human DNA by matrix-assisted laser desorption/ionization mass spectrometry. Anal. Chem., 69, 3699–3972.

  15. Premstaller,A., Oberacher,H. and Huber,C.G. (2000) High-performance liquid chromatography–electrospray ionization mass spectrometry of single- and double-stranded nucleic acids using monolithic capillary columns. Anal. Chem., 72, 4386–4393.[Medline]

  16. Fallin,D. and Schork,N.J. (2000) Accuracy of haplotype frequency estimation for biallelic loci via the excpectation-maximization algorithm for unphased diploid genotype data. Am. J. Hum. Genet., 67, 947–959.[Web of Science][Medline]

  17. Oefner,P.J. (2000) Allelic discrimination by denaturing high-performance liquid chromatography. J. Chromatogr. B, 739, 345–355.

  18. Collins,F.S., Brooks,L.D. and Chakravarti,A. (1998) A DNA polymorphism discovery resource for research on human genetic variation. Genome Res., 281, 1194–1197.

  19. Huber,C.G. and Krajete,A. (2000) Sheath liquid effects in capillary high-performance liquid chromatography–electrospray mass spectrometry of oligonucleotides. J. Chromatogr. A, 870, 413–424.[Web of Science][Medline]

  20. Oberacher,H., Parson,W., Mühlmann,R. and Huber,C.G. (2001) Analysis of polymerase chain reaction products by on-line liquid chromatography–mass spectrometry for genotyping of polymorphic short tandem repeat loci. Anal. Chem., 73, 5109–5115.[Medline]

  21. Null,A.P., Hannis,J.C. and Muddiman,D.C. (2000) Preparation of single-stranded PCR products for electrospray ionization mass spectrometry using the DNA repair enzyme lamda exonuclease. Analyst, 125, 619–626.[Medline]

  22. Jin,L., Underhill,P.A., Doctor,V., Davis,R.W., Shen,P., Cavalli-Sforza,L.L. and Oefner,P.J. (1999) Distribution of haplotypes from a chromosome 21 region distinguishes multiple prehistoric migrations. Proc. Natl Acad. Sci. USA, 96, 3796–3800.[Abstract/Free Full Text]

  23. Raghava,G.P., Solanki,R.J., Soni,V. and Agrawal,P. (2000) Fingerprinting method for phylogenetic classification and identification of microorganisms based on variation in 16S rRNA gene sequences. Biotechniques, 29, 108–116.[Web of Science][Medline]


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?



This Article
Right arrow Abstract Freely available
Right arrow Print PDF (310K) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrowRequest Permissions
Right arrow Commercial Re-use Guidelines
for Open Access NAR Content
Google Scholar
Right arrow Articles by Oberacher, H.
Right arrow Articles by Huber, C. G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Oberacher, H.
Right arrow Articles by Huber, C. G.
Related Collections
Right arrow Polymorphism/mutation detection
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?