Skip Navigation

This Article
Right arrow Abstract Freely available
Right arrow Print PDF (380K) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (44)
Right arrow Commercial Re-use Guidelines
for Open Access NAR Content
Google Scholar
Right arrow Articles by Bundock, P.
Right arrow Articles by Hooykaas, P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Bundock, P.
Right arrow Articles by Hooykaas, P.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Nucleic Acids Research, 2002, Vol. 30, No. 15 3395-3400
© 2002 Oxford University Press

Increased telomere length and hypersensitivity to DNA damaging agents in an Arabidopsis KU70 mutant

Paul Bundock*, Haico van Attikum and Paul Hooykaas

Institute of Molecular Plant Sciences, Sectie 2A, Wassenaarseweg 64, 2333 AL Leiden, The Netherlands

*To whom correspondence should be addressed. Tel: +31 71 5274750; Fax: +31 71 5274999; Email: bundock{at}rulbim.leidenuniv.nl

Received April 4, 2002; Revised and Accepted May 23, 2002


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 CONCLUSIONS
 REFERENCES
 
We have identified a putative homologue of the KU70 gene (AtKU70) from Arabidopsis thaliana. In order to study its function in plants we have isolated an A.thaliana line that contains a T-DNA inserted into AtKU70. Plants homozygous for this insertion appear normal and are fertile. In other organisms the KU70 gene has been shown to play a role in the repair of DNA damage induced by ionising radiation (IR) and by radiomimetic chemicals such as methylmethane sulfonate (MMS). We show that AtKU70–/– plants are hypersensitive to IR and MMS, and thus the AtKU70 gene plays a similar role in DNA repair in plants as in other organisms. The KU70 gene also plays a role in maintaining telomere length. Yeast and mammalian cells deficient for Ku70 have shortened telomeres. When we studied the telomeres in the AtKU70–/– plants we found unexpectedly that they were significantly longer (>30 kb) than was found in wild-type plants (2–4 kb). We propose several hypotheses to explain this telomere lengthening in the AtKU70–/– plants.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 CONCLUSIONS
 REFERENCES
 
In a cell the presence of double strand breaks (DSB) in the DNA can be catastrophic. Repair of such damage, often caused by ionising radiation (IR) or DNA replication errors, is essential for the maintenance of genetic integrity and progression of the cell through the cell cycle. Cells have developed two major pathways for the repair of DSB, homologous recombination (HR) and non-homologous recombination (NHR). The predominant pathway of DSB repair in cells (HR or NHR) varies between organisms and cell type. For instance, lower eukaryotes and bacteria generally utilise HR, whereas in higher eukaryotes NHR is the dominant repair pathway. Our knowledge of the proteins involved in both HR and NHR has come to a large extent from the yeast Saccharomyces cerevisiae. Many genes involved in NHR in this organism have been identified, including MRE11, RAD50, XRS2, LIF1, NEJ1, LIG4, YKU70 and YKU80 (reviewed in 1,2). The Ku70 and Ku80 proteins form a heterodimer, which in mammalian cells form a ternary complex with the DNA-PKcs protein. In yeast, however, this protein is not present. The Ku heterodimer is probably an ancient structure as homologues of KU70 and KU80 have also been found in bacteria (3). The Ku heterodimer binds tightly and specifically to a variety of DNA end structures, suggesting that it serves as a primary sensor of broken chromosomal DNA (4). Once bound, Ku may recruit other factors to the break, for instance via its interactions with the ligase IV/XRCC4 complex (5) and Mre11 (6). Human or mouse cell lines lacking Ku70 are defective in DSB repair and are hypersensitive to IR and radiomimetic agents such as methylmethanesulfonate (MMS) (7). Mice lacking Ku70 or Ku80 are also proportional dwarfs (40–60% the size of normal littermates) (810) and have defects in V(D)J recombination (11). Furthermore, cells or animals lacking Ku70 have also been found to have shortened telomeres (reviewed in 12).

As part of our investigation into the role of plant proteins in DNA repair we have cloned an orthologue of the KU70 gene from the model dicotyledonous plant Arabidopsis thaliana (AtKU70). In order to study the function of this gene, we have identified an A.thaliana line containing a T-DNA insertion in the AtKU70 gene. Plants homozygous for the T-DNA insertion in AtKU70 are phenotypically normal but hypersensitive to DNA damaging agents. Furthermore, when we investigated the length of the telomeres in such plants we found that rather than being shortened they were much longer than found in wild-type Arabidopsis plants. The data show that AtKU70 plays a role in DNA repair and telomere maintenance in Arabidopsis. Plants seem to be able to tolerate mutations in NHR genes much more readily than mammalian cells. This makes plants an ideal system to investigate the roles of NHR genes in multicellular eukaryotes by studying lines containing multiple mutations in NHR genes as has been done in yeast previously.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 CONCLUSIONS
 REFERENCES
 
Identification of the AtKU70 gene and isolation of a mutant plant line
The 1.8 kb AtKU70 cDNA was amplified from a cDNA population synthesised from seedling total mRNA using the primers AKP (CATGCCATGGAATTGGACCCAGATGAT GTTTTC) and AK3' (CCCTCGAGGGTTATTTACCAA TGTGAGTCAGAATC) which contain the AtKU70 stop and start codons respectively (underlined), and cloned into pGEM-T Easy (Promega) for sequencing. The Arabidopsis Knockout Facility (AKF, WI) was screened using the AtKU70 specific primers AK1 (CTCACCA TTTGTTACGACGAGAAAGGTAT) or AK6 (GAGGAA CAGCCATTGACTCTCTCGATAA) and a T-DNA specific primer JL-202 (13). The screening primers were designed as suggested (http://www.biotech.wisc.edu/NewServicesAndResearch/Arabidopsis/Guidelines.asp). A 3026 bp PCR product was produced using AK1 + JL-202 on pooled DNA. These primers were used in subsequent rounds of PCR screening until individual positive plants were identified. To map the insertion point of the T-DNA right border (RB) end, PCR was done on DNA from the AtKU70-1 line using the primers JL-100 (TCCGCAGCGTTATTATAAAATGAAAGTAC) and AK6. The 4 kb PCR fragment produced was then sequenced. For the DNA blots, 4 µg total DNA isolated using the Nucleon Phytopure plant DNA extraction kit (Amersham Life Science) was digested overnight with EcoRI according to the manufacturer’s instructions. The probe used was a 1871 bp PCR fragment of the AtKU70 ORF generated using primers AK1 + AK3 (GGCGGTACTACACCTCCGAGATTGG) and was labelled with [{alpha}-32P]dCTP. Northern blots were done using 8 µg total RNA isolated using the Rneasy Plant Mini Kit (Qiagen), probed with a 1.8 kb fragment of the full length AtKU70 cDNA labelled with [{alpha}-32P]dCTP. The blots to measure telomere length were done as reported previously (14).

Hypersensitivity of AtKU70–/– plants to IR and MMS
Hypersensitivity to MMS was performed as described previously (15). Seeds from AtKU70-1–/– plants were germinated for 4 days on 1/2 MS plates and transferred to 1/2 MS liquid medium containing MMS (Sigma). The concentrations tested were 0, 0.006, 0.008 and 0.01% MMS. The seedlings were scored after 3 weeks growth. For X-ray sensitivity, 4-day-old seedlings in liquid 1/2 MS were irradiated with the stated dosage of X-rays at 6 Gy/min using a 225 SMART X-ray machine as a source (Andrex SA, Copenhagen, Denmark), operated at 200 kV and 4 mA with a 1 mm aluminium filter. Plants were scored after 3 weeks further growth.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 CONCLUSIONS
 REFERENCES
 
Isolation of an AtKU70 mutant
A partial length soybean cDNA (AW598752) showing high homology with the yeast KU70 sequence was found in a BLAST search of all higher plant sequences. This putative KU70 gene from soybean was then used to screen the available A.thaliana sequences and a single copy gene (AtKU70) was identified (AT1G16970). The AtKU70 cDNA was then amplified and sequenced. Comparison of the cDNA with the genomic sequence showed that this gene contains 18 exons. In Figure 1 the Ku70 proteins from Arabidopsis, yeast and humans are aligned.



View larger version (98K):
[in this window]
[in a new window]
 
Figure 1. The sequences of the A.thaliana (AtKU70), Homo sapiens (HsKU70) and S.cerevisiae (ScKu70) proteins were aligned using the ClustalW alignment program. Identical residues are marked with black shading, similar residues with grey shading. The position at which the AtKu70 protein is truncated by the T-DNA insertion is indicated with an asterisk. The AtKu70 protein shares 28% identiity with the HsKu70 protein and 16% identity with the ScKu70 protein, respectively.

 
In order to study the role of AtKU70 in plants, a screen was performed at the Arabidopsis Knockout Facility as described (13) to identify plant lines containing a T-DNA insertion in AtKU70. After several rounds of screening we identified four individual plants that gave a PCR product specific for a T-DNA insertion in AtKU70. A DNA blot was done on the four positive plants obtained (Fig. 2B). Three of the four plants (lanes 2, 3 and 5) were found to be heterozygous for the T-DNA insertion in AtKU70, as they showed both the original band from the AtKU70 locus plus an additional band. Interestingly, one plant (lane 4) only gave the mutant band on the DNA blot. This plant was thus homozygous for the T-DNA insertion in AtKU70. A detailed characterisation of the T-DNA insertion in the AtKU70 gene is shown in Figure 2D. The left border (LB) end of the T-DNA was mapped by sequencing the PCR fragment generated using the primers JL-202 + AK1. The LB end was integrated into intron 10 of the AtKU70 gene and had lost 9 bp during integration. The RB end of the T-DNA was mapped using the primers JL-100 + AK6. Sequencing of this PCR fragment showed the RB end had been heavily truncated. Approximately 4 kb had been lost from the T-DNA RB end. This resulted in loss of most of the NPTII ORF that is located on the T-DNA near the LB. We found that 234 bp of the 5' end of the NPTII ORF were linked to exon 10 of the AtKU70 gene (accession number AF283759, nucleotide 1038). Based on computer predictions, due to the T-DNA insertion a truncated AtKu70 protein of 351 amino acids (full length protein, 720 amino acids) may be produced. The last 22 amino acids of the truncated protein (LASHDSRAASSWSSFRHRTGRS*) are derived from the T-DNA before a stop codon is encountered. However, on a northern blot we were unable to detect a truncated AtKU70 mRNA in the plants homozygous for the T-DNA insertion in AtKU70 (AtKU70–/–), while an mRNA of the predicted size was detectable in wild-type seedlings (Fig. 2C). Therefore, we conclude that the T-DNA insertion in AtKU70 gives a ‘null’ phenotype. The T-DNA integrated into the AtKU70 gene does not carry a functional NPTII gene. However, the AtKU70 mutant line is resistant to the antibiotic kanamycin. The kanamycin resistant phenotype of the AtKU70 mutant line must therefore result from additional T-DNA copies. Indeed, a DNA blot on the mutant line using a NPTII probe showed that the line contains four T-DNA copies in total (data not shown). Mice lacking Ku70 have a dwarf phenotype so we were therefore interested in examining the phenotypes of AtKU70–/– plants. These plants showed no obvious phenotypic differences with wild-type plants. Wild-type and mutant plants were similar in size, flowered at the same time and were fertile (data not shown).



View larger version (36K):
[in this window]
[in a new window]
 
Figure 2. (A) Genomic organisation of the AtKU70 locus with the insertion point of the T-DNA indicated. The exons of AtKU70 are shown as boxes. The probe used for the DNA blots was a 1871 bp PCR fragment amplified using the primers AK1 + AK3 and is represented as a shaded box. X, XhoI restriction sites. LB, T-DNA left border. The truncated NPTII ORF on the T-DNA is shown as a hatched box. (B) DNA blot. Lane 1, wild-type (Ws) seedlings; lanes 2–5, individual plants containing a T-DNA in AtKU70. (C) Northern analysis: 8 µg total RNA from 12-day-old seedlings was blotted and probed using the 1.8 kb AtKU70 cDNA. Lane 1, Ws; lane 2, AtKU70–/– seedlings. (D) Integration site of the T-DNA. Upper line, the sequence of exon 10 of the AtKU70 gene is shown in uppercase letters. Intron 10 is indicated in lowercase italics. The sequence deleted due to the T-DNA insertion is in bold. Middle line, the ends of the T-DNA are shown. The left T-DNA border (LB) had lost 9 bp from its end and was integrated into intron 10. The T-DNA right border (RB) end was heavily truncated (~4 kb lost) resulting in part of the NPTII ORF being fused to AtKU70 exon 10.

 
AtKU70 deficient plants are hypersensitive to MMS and X-rays
Yeasts and mammalian cell lines lacking Ku70 are sensitive to DNA damaging agents such as the radiomimetic chemical MMS and X-rays (16,17). The sensitivity of AtKU70–/– and wild-type plants to these agents was compared. Seedlings (4 days old) were transferred to liquid medium containing MMS and grown for a further 3 weeks. For X-ray sensitivity, seedlings in liquid medium were exposed to the stated X-ray dosage and also then allowed to grow undisturbed for a further 3 weeks. As shown in Figure 3, AtKU70–/– plants are hypersensitive to both MMS and X-rays. A similar phenotype has also recently been reported in plants in which the AtRAD50 gene, also necessary for NHR, is inactivated (18). This suggests that, as in other organisms, the Ku70 protein in plants is involved in DNA repair processes. The MMS hypersensitivity phenotype was seen to co-segregate with the T-DNA insert in AtKU70. For this experiment, AtKU70-1–/– plants were crossed with the wild-type and 130 F2 seedlings were tested for their hypersensitivity to MMS (0.008% v/v). In total, 28 MMS hypersensitive seedlings were found. PCR was performed on 12 of these, all of which were homozygous for the T-DNA insertion at AtKU70. As a control, PCR was also performed on 12 randomly selected seedlings that showed wild-type MMS sensitivity. All these plants contained an intact AtKU70 locus ({chi}2 = 24, df = 1, P < 0.0001). This highly statistically significant result shows that the MMS hypersensitivity is strongly linked to the T-DNA insertion in AtKU70.



View larger version (40K):
[in this window]
[in a new window]
 
Figure 3. (A) MMS sensitivity of AtKU70–/– plants. Upper row, wild-type plants (ecotype Ws). Lower row, AtKU70–/– plants. MMS concentrations: i, 0%; ii, 0.006%; iii, 0.008%; iv, 0.01%. (B) X-ray sensitivity of AtKU70–/– plants. Upper row, wild-type plants (ecotype Ws). Lower row, AtKU70–/– plants. Seedlings were exposed to: i, 0 Gray; ii, 80 Gray; iii, 100 Gray.

 
Lengthened telomeres in AtKU70–/– plants
Telomeres are specialised structures at the ends of chromosomes that are essential for genomic stability. Telomeres are made up of short G-rich repeats conforming to the consensus sequence Tx(A)Gy. The length of the telomeres varies between organism and cell type. In Arabidopsis, telomeres are 2–4 kb in size and consist of repeats of the sequence TTTAGGGn. An Arabidopsis line deficient for the telomerase reverse transcriptase subunit (AtTERT) has been described (19). When several generations of AtTERT–/– plants were grown, a decrease of 500 bp of the telomeres per generation was observed. With this in mind, we measured the length of the telomeres in six successive generations of selfed AtKU70–/– plants to study any possible telomere shortening over several generations. Total DNA from 12-day-old seedlings was isolated and digested with the restriction enzyme MboI. This enzyme generates a series of heterogeneous terminal restriction fragments (TRFs) which are detected on the DNA blot as a classic telomere smear of 3–6 kb after hybridisation with a telomere probe [TTTAGGG]6. The results are shown in Figure 4. To our surprise, we saw that the telomeres in the AtKU70–/– plants were longer (>30 kb) in comparison to wild-type plants. This lengthening was apparent from the first generation of plants tested and remained stable in the subsequent generations. The telomere signal appears stronger in the AtKU70 mutant plants, but this is probably due to reduced migration of the DNA fragments through the agarose gel (0.8%). In AtTERT–/– plants the smear of heterogeneous TRFs is absent. It is replaced by a series of discrete bands corresponding to individual chromosome ends. A telomere smear, and therefore a heterogeneous mix of TRFs, is still apparent in the AtKU70–/– plants. We can therefore conclude that the mutation in AtKU70 seems to be affecting all the telomeres in the cell in a similar way.



View larger version (99K):
[in this window]
[in a new window]
 
Figure 4. Lengthened telomeres in AtKU70–/– plants. Lane 1, wild-type (ecotype Ws); lanes 2–7, successive generations of AtKU70–/– plants. The fragment sizes are shown in kilobase pairs.

 

    CONCLUSIONS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 CONCLUSIONS
 REFERENCES
 
In this study we describe the isolation and characterisation of the KU70 gene from the model plant A.thaliana. In order to study the function of this gene in plants we isolated a plant line in which the KU70 gene was inactivated through a T-DNA insertion. Plants homozygous for this mutation were viable but lacked the KU70 mRNA. No obvious differences in growth were observed between the AtKU70–/– plants and wild-type plants. Germination, plant size, flowering and senescence were unchanged. However, the plants did show a clear hypersensitivity to the DNA damaging agents MMS and X-rays. Therefore, as in other organisms in which the KU70 gene is mutated, it seems necessary in Arabidopsis for the repair of DNA damage.

The mouse is the only other multicellular organism in which the effects of inactivation of the KU70 or KU80 genes on the animal have been studied in detail. Mice lacking either of the genes are dwarf but fertile and have immuno-deficiencies due to defects in V(D)J recombination (9,10). Why do we not observe a dwarf phenotype in the plant line lacking AtKu70? The dwarf phenotype of these mice may not be linked with defects in DNA damage repair or V(D)J recombination given that mice lacking another component of the DNA-PK complex, the DNA-PKcs subunit, are defective in DNA repair, show severe immuno-deficiency but are normal in size (20). Thus, mammalian Ku70 must have another function that is necessary for normal development. Plant Ku70 may lack this function. Mammalian Ku70 is able to regulate transcription of other genes (21). Changed levels of transcription of these genes may be responsible for the mouse dwarf phenotype.

How can we explain that the telomeres of A.thaliana became much longer when the AtKU70 gene was mutated? In the cell, telomere length is thought to be governed by a homeostasis mechanism that operates via the influence of positive and negative factors on the enzyme telomerase. The reverse transcriptase telomerase is able to add telomere sequences to the end of chromosomes. In mammals telomerase is developmentally regulated in different cell types, and shows high expression in reproductive tissues but is inactivated in somatic tissue. One consequence of this inactivation in somatic tissue is that telomeres shorten during each cell division due to the end replication problem. This has led to the speculation that telomere shortening may be linked to cellular senescence. In plants, telomerase activity in different tissues has also been measured. The highest activity is found in proliferating tissues such as meristems, but telomerase activity is low or undetectable in non-meristematic tissues such as leaves (19,22). Telomere homeostasis in yeast has been found to be controlled by many factors including telomeric binding proteins (Rap1p, Rif1p, Rif2p and Cdc13p), components of telomerase, telomeric chromatin-associated proteins (Est1p and Est2p) and proteins involved in non-homologous end joining (NHEJ; YKu70p, YKu80p, Mre11p, Rad50p and Xrs2p). Yeast cells deficient for components of the NHEJ pathway for DNA repair have shortened telomeres (12). However, the effects of NHEJ proteins on telomere length are not always conserved between organisms. For instance, mammalian cells lacking Ku70 do have shortened telomeres (23) while mutations in Ku86, the human Ku80 homologue, or DNA-PKcs do not affect telomere length (2426). The fact that the AtKU70 mutation results in lengthened telomeres is unique and suggests that plants have a crucially different mechanism for telomere homeostasis. One possible role of AtKu70 at Arabidopsis telomeres may be its action on proteins that inhibit telomere elongation. In mammalian cells the telomere binding proteins TRF1 and TRF2 have been identified. These proteins are necessary for maintaining shortened telomeres. Cells expressing a truncated dominant negative form of the TRF1 protein have longer telomeres (27). In mammalian cells the Ku heterodimer binds to the telomere DNA binding proteins TRF1 and TRF2 (28,29). These proteins effect Ku localisation to the telomeres and are thought to inhibit telomere elongation by promoting the formation of a t-loop whereby the telomere is looped backwards so that the single-stranded tail invades duplex telomeric sequences, making it inaccessible to telomerase (30). In Arabidopsis a telomere binding protein (AtTRP1) homologous to TRF1 has been characterised (31). The AtKu70 protein may normally bind to AtTRP1 and regulate its proposed negative effect on telomere length. The fact that we observe that all the telomeres in the cell appear to be lengthened argues for such a model in which the telomere homeostasis has been affected.

Another hypothesis is that Arabidopsis may have different, recombination-based pathways for alternative lengthening of telomeres (ALT) (32,33). Evidence for this has been found in several studies. First, the effect of the AtRAD50 gene on telomere length has been reported (14). Plants lacking AtRAD50 are sterile, but do not show changes in their telomeres. However, cell cultures derived from such plants have no detectable telomeres after 8 weeks growth. The cell culture then undergoes a crisis from which only a fraction of the cells survive. The survivors have longer telomeres compared with wild-type cells. The data suggest that cultured Arabidopsis cells are able to maintain their telomeres by an ALT mechanism that does not require AtRAD50. Secondly, lengthened telomeres also have been detected in Arabidopsis plants lacking telomerase (34) suggesting that such an ALT mechanism also may be telomerase independent. Plants lacking telomerase show a stochastic shortening, and in some cases lengthening, of telomeres per generation. Telomeres that reach a critical minimum length may be subject to lengthening by recombination-based mechanisms. The AtKu70 protein may be involved in ALT mechanisms, for instance by preventing recombination between different telomeres, or AtKu70 may function as a regulator of the ALT pathways. It is also possible that AtKu70 achieves telomere lengthening in a more direct manner. For instance, the AtKu70 protein may also interact directly with telomerase, as has been suggested in yeast (35), perhaps down-regulating its activity. It will therefore be very interesting to study the telomeres of an Arabidopsis plant lacking both telomerase and AtKu70. Whatever the reason for the lengthened telomeres in AtKU70–/– plants, the phenotype is stable over the six generations tested. Moreover, no phenotypic differences were observed between the different generations, suggesting that longer telomeres do not influence plant development.

In conclusion, we have demonstrated that AtKU70 plays a role in DNA repair and telomere maintenance in Arabidopsis. Plants seem to be able to tolerate mutations in NHR genes much more readily than mammalian cells. This makes plants an ideal system to investigate the roles of NHR genes in higher eukaryotes by studying lines containing double and triple mutations in NHR genes as has been done in yeast previously.


    ACKNOWLEDGEMENTS
 
We would like to thank Peter Hock for assistance with the figures. This work was supported by the Stichting Binaire Vector System and EU project QLRT-2000-01397.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 CONCLUSIONS
 REFERENCES
 

  1. Haber,J.E. (2000) Recombination: a frank view of exchanges and vice versa. Curr. Opin. Cell Biol., 12, 286–292.[ISI][Medline]

  2. Kegel,A., Sjostrand,J.O. and Astrom,S.U. (2001) Nej1p, a cell type-specific regulator of nonhomologous end joining in yeast. Curr. Biol., 11, 1611–1617.[ISI][Medline]

  3. Doherty,A.J., Jackson,S.P. and Weller,G.R. (2001) Identification of bacterial homologues of the Ku DNA repair protein. FEBS Lett., 500, 186–188.[ISI][Medline]

  4. Featherstone,C. and Jackson,S.P. (1999) Ku, a DNA repair protein with multiple cellular functions? Mutat. Res., 434, 3–15.[ISI][Medline]

  5. McElhinney,S.A., Snowden,C.M., McCarville,J. and Ramsden,D.A. (2000) Ku recruits the XRCC4-ligase IV complex to DNA ends. Mol. Cell. Biol., 20, 2996–3003.[Abstract/Free Full Text]

  6. Goedecke,W., Eijpe,M., Offenberg,H.H., van Aalderen,M. and Heyting,C. (1999) Mre11 and Ku70 interact in somatic cells, but are differentially expressed in early meiosis. Nature Genet., 23, 130–131.[ISI][Medline]

  7. Gu,Y., Jin,S., Gao,Y., Weaver,D.T. and Alt,F.W. (1997) Ku70-deficient embryonic stem cells have increased ionizing radiation sensitivity, defective DNA end-binding activity and inability to support V(D)J recombination. Proc. Natl Acad. Sci. USA, 94, 8076–8081.[Abstract/Free Full Text]

  8. Nussenzwieg,A., Chen,C., da Costa Soares,V., Sanchez,M., Sokol,K., Nussenzweig,M.C. and Li,G.C. (1996) Requirement for Ku80 in growth and immunoglobulin V(D)J recombination. Nature, 382, 551–554.[Medline]

  9. Ouyang,H., Nussenzwieg,A., Kurimasa,A., Soares,V.C., Li,X., Cordon-Cardo,C., Li,W., Cheong,N., Nussenzweig,M., Iliakis,G. et al. (1997) Ku70 is required for DNA repair but not for T cell antigen receptor gene recombination in vivo. J. Exp. Med., 186, 921–999.[Abstract/Free Full Text]

  10. Gu,Y., Siedl,K.J., Rathbun,G.A., Zhu,C., Manis,J.P., van der Stoep,N., Davidson,L., Cheng,H.-L., Sekiguchi,J.M., Frank,K., Stanhope-Baker,P. et al. (1997) Growth retardation and leaky SCID phenotype of Ku70 deficient mice. Immunity, 7, 653–665.[ISI][Medline]

  11. Nussenzweig,A., Sokol,K., Burgman,P., Li,L. and Li,G.C. (1997) Hypersensitivity of Ku80-deficient cell lines and mice to DNA damage: the effects of ionizing radiation on growth, survival and development. Proc. Natl Acad. Sci. USA, 94, 13588–13593.[Abstract/Free Full Text]

  12. Bertuch,A. and Lundblad,V. (1998) Telomeres and double strand breaks: trying to make ends meet. Trends Cell Biol., 8, 339–342.[ISI][Medline]

  13. Krysan,P.J., Young,J.C. and Sussman,M.R. (1999) T-DNA as an insertional mutagen in Arabidopsis. Plant Cell, 11, 2283–2290.[Free Full Text]

  14. Gallego,M.E. and White,C.I. (2001) RAD50 function is essential for telomere maintenance in Arabidopsis. Proc. Natl Acad. Sci. USA, 98, 1711–1716.[Abstract/Free Full Text]

  15. Revenkova,E., Masson,J., Koncz,C., Afsar,K., Jakovleva,L. and Paszkowski,J. (1999) Involvement of Arabidopsis thaliana ribosomal protein S27 in mRNA degradation triggered by genotoxic stress. EMBO J., 18, 490–499.[ISI][Medline]

  16. Gu,Y., Jin,S., Gao,Y., Weaver,D.T. and Alt,F.W. (1997) Ku70-deficient embryonic stem cells have increased ionizing radiosensitivity, defective DNA end-binding activity and inability to support V(D)J recombination. Proc. Natl Acad. Sci. USA, 94, 8076–8081.[Abstract/Free Full Text]

  17. Milne,G.T., Jin,S., Shannon,K.B. and Weaver,D.T. (1996) Mutations in two Ku homologs define a DNA end-joining repair pathway in Saccharomyces cerevisiae. Mol. Cell. Biol., 16, 4189–4198.[Abstract]

  18. Gallego,M.E., Jeanneau,M., Granier,F., Bouchez,D., Bechtold,N. and White,C.I. (2001) Disruption of the Arabidopsis RAD50 gene leads to plant sterility and MMS sensitivity. Plant J., 25, 31–41.[ISI][Medline]

  19. Fitzgerald,M.S., Riha,K., Gao,F., Ren,S., McKnight,T.D. and Shippen,D.E. (1999) Disruption of the telomerase catalytic subunit gene from Arabidopsis inactivates telomerase and leads to a slow loss of telomeric DNA. Proc. Natl Acad. Sci. USA, 96, 14813–14818.[Abstract/Free Full Text]

  20. Kurimasa,A., Ouyang,H., Dong,L.-J., Wang,S., Li,X., Cordon-Cardo,C., Chen,D.J. and Li,G.C. (1999) Catalytic subunit of DNA-dependent protein kinase: impact on lymphocyte development and tumorigenesis. Proc. Natl Acad. Sci. USA, 96, 1403–1408.[Abstract/Free Full Text]

  21. Camara-Clayette,V., Thomas,D., Rahuel,C., Barbey,R., Cartron,J.-P. and Bertrand,O. (1999) The repressor which binds the –75 GATA motif of the GPB promoter contains Ku70 as the DNA binding subunit. Nucleic Acids Res., 27, 1656–1663.[Abstract/Free Full Text]

  22. Rhia,K., Fajkus,J., Siroky,J. and Vyskot,B. (1998) Developmental control of telomere lengths and telomerase activity in plants. Plant Cell, 10, 1691–1698.[Abstract/Free Full Text]

  23. d’Adda di Fagagna,F., Hande,M.P., Tong,W.M., Roth,D., Lansdorp,P.M., Wang,Z.Q. and Jackson,S.P. (2001) Effects of DNA nonhomologous end joining factors on telomere length and chromosomal stability in mammalian cells. Curr. Biol., 11, 1192–1196.[ISI][Medline]

  24. Samper,E., Goytisolo,F.A., Slijepcevic,P., van Buul,P.P.W. and Blasco,M.A. (2000) Mammalian Ku86 protein prevents telomeric fusions independently of the length of TTAGGG repeats and the G-strand overhang. EMBO Rep., 1, 244–252.[ISI][Medline]

  25. Gilley,D., Tanaka,H., Hande,M.P., Kurimasa,A., Li,G.C., Oshimura,M. and Chen,D.J. (2001) DNA-PKcs is critical for telomere capping. Proc. Natl Acad. Sci. USA, 98, 15084–15088.[Abstract/Free Full Text]

  26. Goytisolo,F.A., Samper,E., Edmonson,S., Taccioli,G.E. and Blasco,M.A. (2001) The absence of the dna-dependent protein kinase catalytic subunit in mice results in anaphase bridges and in increased telomeric fusions with normal telomere length and G-strand overhang. Mol. Cell. Biol., 11, 3642–3651.

  27. van Steensel,B. and de Lange,T. (1997) Control of telomere length by the human telomeric protein TRF1. Nature, 385, 740–742.[Medline]

  28. Hsu,H.-L., Gilley,D., Galande,S.A., Hande,M.P., Allen,B., Kim,S.-H., Li,G.C., Campisi,J., Kohwi-Shigematsu,T. and Chen,D.J. (2000) Ku acts in a unique way at the mammalian telomere to prevent end joining. Genes Dev., 14, 2807–2812.[Abstract/Free Full Text]

  29. Song,K., Jung,D., Jung,Y., Lee,S.G. and Lee,I. (2000) Interaction of human Ku70 with TRF2. FEBS Lett., 481, 81–85.[ISI][Medline]

  30. Smogorzewska,A., van Steensel,B., Bianchi,A., Oelmann,S., Schaefer,M.R., Schnapp,G. and de Lange,T. (2000) Control of human telomere length by TRF1 and TRF2. Mol. Cell. Biol., 20, 1659–1668.[Abstract/Free Full Text]

  31. Chen,C.M., Wang,C.T. and Ho,C.H. (2001) A plant gene encoding a Myb-like protein that binds telomeric GGTTTAG repeats in vitro. J. Biol. Chem., 276, 16511–16519.[Abstract/Free Full Text]

  32. Lundblad,V. and Blackburn,E.H. (1993) An alternative pathway for yeast telomere maintenance rescues est1 senescence. Cell, 73, 347–360.[ISI][Medline]

  33. Kass-Eisler,A. and Greider,C.W. (2000) Recombination in telomere length maintenance. Trends Biochem. Sci., 25, 200–204.[ISI][Medline]

  34. Rhia,K., McKnight,T.D., Griffing,L.R. and Shippen,D.E. (2001) Living with genome instability: plant responses to telomere dysfunction. Science, 291, 1797–1800.[Abstract/Free Full Text]

  35. Peterson,S.E., Stellwagen,A.E., Diede,S.J., Singer,M.S., Haimberger,Z.W., Johnson,C.O., Tzoneva,M. and Gottschling,D.E. (2001) The function of a stem–loop in telomerase RNA is linked to the DNA repair protein Ku. Nature Genet., 27, 64–67.[ISI][Medline]


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
J. Bacteriol.Home page
N. C. Stephanou, F. Gao, P. Bongiorno, S. Ehrt, D. Schnappinger, S. Shuman, and M. S. Glickman
Mycobacterial Nonhomologous End Joining Mediates Mutagenic Repair of Chromosomal Double-Strand DNA Breaks
J. Bacteriol., July 15, 2007; 189(14): 5237 - 5246.
[Abstract] [Full Text] [PDF]


Home page
Plant CellHome page
J.-P. Hong, M. Y. Byun, D.-H. Koo, K. An, J.-W. Bang, I. K. Chung, G. An, and W. T. Kim
Suppression of RICE TELOMERE BINDING PROTEIN1 Results in Severe and Gradual Developmental Defects Accompanied by Genome Instability in Rice
PLANT CELL, June 1, 2007; 19(6): 1770 - 1781.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
R. S. Maser, K.-K. Wong, E. Sahin, H. Xia, M. Naylor, H. M. Hedberg, S. E. Artandi, and R. A. DePinho
DNA-Dependent Protein Kinase Catalytic Subunit Is Not Required for Dysfunctional Telomere Fusion and Checkpoint Response in the Telomerase-Deficient Mouse
Mol. Cell. Biol., March 15, 2007; 27(6): 2253 - 2265.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
J. M. Watson and D. E. Shippen
Telomere Rapid Deletion Regulates Telomere Length in Arabidopsis thaliana
Mol. Cell. Biol., March 1, 2007; 27(5): 1706 - 1715.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
M. G. Hwang and M. H. Cho
Arabidopsis thaliana telomeric DNA-binding protein 1 is required for telomere length homeostasis and its Myb-extension domain stabilizes plant telomeric DNA binding
Nucleic Acids Res., February 28, 2007; 35(4): 1333 - 1342.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
H. Shaked, N. Avivi-Ragolsky, and A. A. Levy
Involvement of the Arabidopsis SWI2/SNF2 Chromatin Remodeling Gene Family in DNA Damage Response and Recombination
Genetics, June 1, 2006; 173(2): 985 - 994.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
L. Melnikova, H. Biessmann, and P. Georgiev
The Ku Protein Complex Is Involved in Length Regulation of Drosophila Telomeres
Genetics, May 1, 2005; 170(1): 221 - 235.
[Abstract] [Full Text] [PDF]


Home page
Plant CellHome page
S. Ren, J. S. Johnston, D. E. Shippen, and T. D. McKnight
TELOMERASE ACTIVATOR1 Induces Telomerase Activity and Potentiates Responses to Auxin in Arabidopsis
PLANT CELL, November 1, 2004; 16(11): 2910 - 2922.
[Abstract] [Full Text] [PDF]


Home page
Genes Dev.Home page
F. d'Adda di Fagagna, S.-H. Teo, and S. P. Jackson
Functional links between telomeres and proteins of the DNA-damage response
Genes & Dev., August 1, 2004; 18(15): 1781 - 1799.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. S. O'Connor, A. Safari, D. Liu, J. Qin, and Z. Songyang
The Human Rap1 Protein Complex and Modulation of Telomere Length
J. Biol. Chem., July 2, 2004; 279(27): 28585 - 28591.
[Abstract] [Full Text] [PDF]


Home page
Plant CellHome page
T. D. McKnight and D. E. Shippen
Plant Telomere Biology
PLANT CELL, April 1, 2004; 16(4): 794 - 803.
[Full Text] [PDF]


Home page
Nucleic Acids ResHome page
H. van Attikum, P. Bundock, R. M. Overmeer, L.-Y. Lee, S. B. Gelvin, and P. J. J. Hooykaas
The Arabidopsis AtLIG4 gene is required for the repair of DNA damage, but not for the integration of Agrobacterium T-DNA
Nucleic Acids Res., July 15, 2003; 31(14): 4247 - 4255.
[Abstract] [Full Text] [PDF]


Home page
Plant CellHome page
M. E. Gallego, N. Jalut, and C. I. White
Telomerase Dependence of Telomere Lengthening in ku80 Mutant Arabidopsis
PLANT CELL, March 1, 2003; 15(3): 782 - 789.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
K. Riha and D. E. Shippen
Ku is required for telomeric C-rich strand maintenance but not for end-to-end chromosome fusions in Arabidopsis
PNAS, January 21, 2003; 100(2): 611 - 615.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Print PDF (380K) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (44)
Right arrow Commercial Re-use Guidelines
for Open Access NAR Content
Google Scholar
Right arrow Articles by Bundock, P.
Right arrow Articles by Hooykaas, P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Bundock, P.
Right arrow Articles by Hooykaas, P.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?