Nucleic Acids Research, 2002, Vol. 30, No. 21 e115
© 2002 Oxford University Press
Stable and efficient cassette exchange under non-selectable conditions by combined use of two site-specific recombinases
1 Division of Molecular Genetics and 2 Division of Pathology, Institute of Ophthalmology, University College London, 1143 Bath Street, London EC1V 9EL, UK and 3 Max-Planck-Institute of Neurobiology, Am Klopferspitz 18a, 82152 Martinsried, Germany
*To whom correspondence should be addressed at Division of Molecular Genetics, Institute of Ophthalmology, University College London, 1143 Bath Street, London EC1V 9EL, UK. Tel: +44 20 7608 6891; Fax: +44 20 7608 6863; Email: m.lauth{at}ucl.ac.uk
Received July 24, 2002; Revised and Accepted September 7, 2002
| ABSTRACT |
|---|
|
|
|---|
Work of the last decade has proven the one gene one productone function hypothesis an oversimplification. To further unravel the emerging one genemultiple productseven more functions concept, new methods (such as subtle knock-in and tightly regulated conditional mutations) for the analysis of gene function in health and disease are required. Another class of improvements (such as tetraploid fusion and cassette exchange) addresses the efficiency with which targeted mutant strains can be generated. Recombinase-mediated cassette exchange (RMCE), which in theory is well suited for the rapid generation of multiple alleles of a given locus, is hampered by its low efficiency in the absence of selection and, especially in vivo, by the promiscuity of the participating recombinase recognition sites. Here we present a novel approach which circumvents this problem by the use of two independent recombinase systems. The strategy, which uses loxP on one and FRT on the other side of the cassette together with a Cre/Flpe expression vector, prevents excisive events and results in higher rates of cassette integration without selection than previously described. This method has a huge potential for the generation of allelic series in embryonic stem cells and, importantly, in pre-implantation embryos in vivo.
| INTRODUCTION |
|---|
|
|
|---|
Recombinase-mediated cassette exchange (RMCE) has been devised to facilitate the generation of multiple mutant alleles of a defined genomic locus (reviewed in 1,2). Recent developments show that a comprehensive understanding of gene function greatly benefits from the analysis of different mutant alleles. Rather than producing each mutation independently of all the others as in conventional homologous recombination-mediated gene targeting, RMCE aims at providing one conventionally targeted mutation which then serves as a platform for recombinase-mediated targeting of all other modifications. RMCE is of interest for embryonic stem (ES) cell work, but even more so for in vivo use (3). Here we report on designing and testing of a novel and unusual RMCE strategy which introduces modifications essential for both applications.
RMCE is a two-step procedure. First, recognition sites for a site-specific recombinase (SSR) are targeted to the locus of interest by homologous recombination. Second, site-specific recombination inserts a replacement sequence into this pre-tagged site. RMCE has proven to be very efficient in several cell lines, including ES cells, under conditions in which the recombinant product could be selected for (47). Yet, in situations where selective pressure could not be applied, current methods have only achieved moderate rates of recombination (e.g. 2% in ES cells) (7). Our own previous attempts to achieve RMCE without selection in fertilised mouse oocytes in vivo failed due to recombination of heterospecific loxP and lox511 sites (lox511 is a single mutant lox site), in spite of high initial integration rates (3). Thus, promiscuity of the recognition sites seems to be a general obstacle when using heterospecific sites. Recently, it could be shown that even very different lox sites can readily be recombined (8,9). Although the exclusiveness of sites can be increased by the introduction of additional mutations (10,11), these are likely to result in decreased overall integration rates (12). We were therefore aiming at a radically different approach that could overcome the limitations posed by the putative promiscuity of the participating recognition sites. We have combined the Cre and Flp recombination pathways to achieve stable and efficient RMCE in ES cells. Instead of heterospecific lox sites, this method is based on the Cre/loxP system on the 5' and the Flp/FRT system on the 3' side of the genomic sequence of interest. As the loxP and the FRT sites have absolutely no sequence similarity, we predicted that recombination between the flanking sites is precluded and the incoming sequence gets securely locked at the locus of interest.
Using this method, which we termed Froxing, because it makes use of Frt and loxP sites, we could obtain a high percentage of correct clones under conditions with and without antibiotic selection. This is the first report of a combination of two independent site-specific recombination systems to unidirectionally deliver transgenes to a defined genomic locus.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Plasmid construction
pPGK-FroxNeo was constructed by ET cloning (13), with the plasmid pPGK-FRT (A.F. Stewart, unpublished results) as the PCR template and pPGKpaX1 (14) as the targeted plasmid. pPGK-FRT has the structure FRTPGKNeoFRT (PGK designates the mouse phosphoglycerate kinase promoter). As a result of the ET reaction, the floxed Pac gene of pPGKpaX1 was replaced by a froxed Neo gene. All the other plasmids were constructed using conventional cloning techniques (15).
The plasmid pFrox-Hygro was built by inserting a loxP HygroPGKpA PCR fragment [PGKpA designates the poly(A) of the PGK gene] into the ClaI site of pFRT. The PCR template was the plasmid pPWL512 (16) and the loxP site was delivered as an overhang primer. Plasmid pFRT was the product after Flp recombination of pPGK-FRT. Plasmid pFrox-EGFP was constructed by insertion of a PCR-amplified EGFPSV40pA sequence of pEGFP-N3 (Clontech) between the loxP and FRT sites of pFroxCV1. Plasmid pFroxCV1 is a pBluescript KS vector (Stratagene) carrying loxP and FRT in the HindIII and SpeI sites, respectively. The plasmid harbouring the coding sequences of the two recombinases, pCre/Flp, was made by cloning the XhoI fragment of pMC-Cre (17), which comprises the Cre expression unit, into the BamHI site of pCAGGS-Flpe (18).
Cell culture and platform cell line production
Standard procedures were used for the culture of E14.1 ES cells (19). The platform cell line was produced by electroporating 1 x 106 ES cells with 5 µg of NotI-linearised pPGK-FroxNeo plasmid in a Bio-Rad Gene Pulser set at 230 V and 500 µF. Selection with 380 µg/ml G418 was started 48 h after electroporation and lasted for 10 days. Single colonies were picked and genomic DNA was prepared as described in Ramirez-Solis et al. (20). The structure of the integrated transgene was characterized by Southern blotting and PCR. ES cell clones with a single genomic integration site were used for further experiments.
Transfections and site-specific targeting
Aliquots of 34 x 105 PGK-FroxNeo cells were transfected on gelatinised 3.5 cm plates with 1 µg of pCre/Flp and 1 µg of replacement vector using Fugene 6 (Roche) as transfection reagent according to the manufacturers instructions. In some cases (see Results), cells were subjected to 24 h of puromycin selection (1 µg/ml) starting 1 day after the beginning of transfection. This step was omitted in all other experiments.
Forty-eight hours after the start of transfection, cells were transferred onto 10 cm dishes and left without selection (in the case of EGFP replacement) or subjected to hygromycin B selection (200 µg/ml) for 10 days.
Southern blot and PCR analysis
Southern analyses were performed as previously described (3). For the detection of targeted clones the following probes were used. The Neo probe was a PCR-amplified fragment encompassing codons 142259 of the Neo coding sequence (accession no. AF335419), the Hygro probe was the BamHI SalI fragment of pPWL512 and the EGFP probe was cut out of pEGFP-N3 as an EcoRINotI fragment, both probes comprising the entire respective coding sequences. For the detection of integrated Neo and Hygro sequences, genomic DNA was digested with BamHI, while for the detection of integrated EGFP a BglII digest was performed.
PCR analysis of recombination site junctions used the following primers (5'
3') and parameters. LoxNeo junction: primers 1 (GCTTCAAAAGCGCACGTCTG) and 2 (GCTTCCCAACCTTACCAGAG), annealing temperature (TA) 60°C. NeoFRT junction: primers 3 (ACGCCGGCTGGATGATCC) and 4 (TGAGGGGACGACGACAGTATC), TA 60°C. LoxHygro junction: primers 1 and 5 (TATCCACGCCCTCCTACATCG), TA 62°C. HygroFRT junction: primers 6 (GAATGGAAGGATTGGAGCTAC) and 4, TA 62°C. LoxEGFP junction: primers 1 and 7 (ACTTGTGGCCGTTTACGTC), TA 62°C. EGFPFRT junction: primers 8 (TCGGCATGGACGAGCTGTAC) and 4, TA 62°C. PCRs were done with 3540 cycles of 94°C for 30 s, TA for 30 s, 72°C for 30 s. All recombination junction PCR products were sequenced. The absence of the Neo coding sequence was proven by Southern blotting or PCR analysis using the primers Neo+ (ACATCGCATCGAGCGAGCAC) and Neo (AAGGCGATGCGCTGCGAATC) (TA 72°C).
Flow cytometric analysis
Cells were trypsinised and resuspended in PBS with 0.5 mM EDTA at a density of 2 x 106 cells/ml. Cell counts were performed on a Becton Dickinson FACScan with argon laser (488 nm) excitation and 530 nm bandpass emission filters to detect GFP expression. Data processing was with Cellquest software.
Determination of co-transfection efficiency
PGK-FroxNeo ES cells were co-transfected with 1 µg pEGFP-N3 and 1 µg pDsRed-N1 (Clontech) as described above. Two and a half days after transfection cells were counted by flow cytometry using 488 nm argon laser excitation and 530 and 585 nm bandpass emission filters to detect GFP and DsRed fluorescence, respectively.
Representation of experimental data
Pictures of DNA gels were taken using a digital camera. Southern blots were scanned using a phosphorimager. Data files were processed in Corel Photo Paint with the only editing being on the contrast level of the picture. Pictures of ES cells were taken using conventional, non-digital photography.
| RESULTS |
|---|
|
|
|---|
Principles of Froxing
The general outline of the approach is depicted in Figure 1A. ES cells carrying a gene flanked by loxP and FRT (from now on called a froxed gene) are transfected with a replacement plasmid harbouring the same sites and a plasmid expressing Cre and Flp. The Flp variant used was Flpe (21), a thermostable mutant of the enzyme. In order to keep additional nucleotides to a minimum, the FRT site used in this study as a Flp recognition site was the 34 bp and not the wild-type 48 bp variant (22,23). This has implications for the proposed mechanism of Froxing (Fig. 1A). As the minimal FRT is refractive to integration (22), Cre inserts the entire replacement plasmid via loxP first, leading to an intermediate co-integrate. In this state, two reactions are possible. First, Cre reverses the reaction and recreates the original structure. Second, excisional recombination by Flp takes place which results in a net exchange of the froxed sequences and yields the desired product. The recombinational by-product, a plasmid carrying the formerly genomic sequence, is lost because it cannot replicate. The constructs made to test the approach are shown in Figure 1B. A PGK promoter-driven froxed neomycin resistance gene (PGK-FroxNeo) was used as a platform for successive recombination rounds. The loxP site was placed between the promoter and the Neo coding sequence, whereas the FRT site flanked the 3' side. This has the advantage that promoterless replacement constructs could be used, because these can only be expressed after correct insertion next to a promoter. In order to test the general applicability of our method, we decided not to target a specific locus, but rather insert the PGK-FroxNeo by random integration in ES cells (referred to as PGK-FroxNeo in Fig. 1B). This enabled us to use different genomic loci and test the efficiency of the approach in different genomic environments.
|
Efficiency of site-specific integration of a selectable marker
In order to characterise the system, we first chose a set-up in which antibiotic selection for the recombination product was feasible. ES cells containing a single genomic copy of PGK-FroxNeo were transfected with pFrox-Hygro (see Figs 1B and 2A and B) and submitted to hygromycin selection. Resistant cell clones were analysed by PCR and/or Southern blotting for the presence of the integrated Hygro coding sequence and the absence of Neo. Three different unspecified genomic loci (A, B and C) were investigated (see Table 1). Average recombination rates ranged from 61 to 78%, depending on the locus analysed. Yet, although the frequency of correct recombinants was locus-independent, our estimation was that the overall number of clones obtained differed by a factor of about three between locus A and C (with locus B in between).
|
|
Altogether, the correct lox junction was found in 93% of all analysed clones and 83% of these clones also carried the correct FRT junction. The clones that were positive for the loxHygro junction and did not show the HygroFRT junction were co-integrates (mosaic clones in Table 1) and retained the NeoFRT junction (9% of the clones investigated). This is in agreement with Schaft et al. (18), who found Flp/FRT recombination to be mosaic in ES cell clones.
In order to demonstrate the dependency of the method on site-specific recombination, cells were transfected with pFrox-Hygro only, omitting pCre/Flp. Not a single clone grew after transfection of PGK-FroxNeo cells and subsequent selection. This result was obtained with either of the three genomic loci A, B or C (n = 2 for each locus). For further experiments, only locus A was investigated.
Efficiency of site-specific integration of a non-selectable marker
Integrating a non-selectable gene via RMCE has previously proven to be very inefficient (3,7). At least in vivo, this inefficiency is partly due to the fact that the 5' and 3' recognition sites were not entirely exclusive and subject to intramolecular recombination, thus leading to the removal of the intervening sequence (3). Different recombination systems on each side should overcome this limitation and result in higher exchange rates due to stabilisation of the reaction product. To test this hypothesis, PGK-FroxNeo ES cells were transfected with pCre/Flp and pFrox-EGFP (Figs 1B and 2A and C). Green fluorescent clones resulting from replacement of Neo by EGFP are the products expected from correct RMCE. For quantification purposes, GFP-positive cells were counted by flow cytometry 68 days after transfection. As shown in Figure 3, non-transfected PGK-FroxNeo ES cells did not show GFP fluorescence, whereas cells transfected with the EGFP replacement plasmid and the recombinases expression plasmid clearly contained a fraction of GFP-positive cells. The percentage of GFP-positive cells ranged from 0.13 to 0.24% of the gated cells. The mean of three independent RMCE experiments was 0.17 ± 0.04% green fluorescent cells. Cells which were transfected only with pFrox-EGFP, omitting pCre/Flp, never showed green fluorescence (n = 2, not shown). As the majority of the cells was not transfected, the recombination efficiency was actually much higher when referred to the number of transfected cells. In order to calculate the real recombination efficiency, the transfection rate was determined. This was measured by flow cytometry under double transfection conditions with EGFP and DsRed expression plasmids, as this resembled the fact that two different plasmids must be present in one cell for Froxing to function. The co-transfection efficiency determined was 1.2% (range ±0.2, n = 2, not shown). Thus, 14.2% of the cells that received the two required plasmids underwent site-specific recombination. Attempts to enrich for transfected cells by puromycin selection were not entirely successful as we could detect only an
8-fold increase (1.4 ± 0.5%; Fig. 3).
|
In order to investigate the genotype of the GFP-positive cells, colonies were picked and analysed for recombination events (Fig. 2C). Out of 34 clones analysed, 33 displayed full Frox recombination via loxP and FRT (97%), while one clone showed integration of EGFP only via loxP (3%).
It should be noted that the particular transgene structure used here is not critical for the efficiency of the method. The use of promoterless replacement constructs does not influence the site-specific recombination process and thus any type of replacement cassette could be used in principle.
| DISCUSSION |
|---|
|
|
|---|
We have devised a novel method for the unidirectional introduction of transgenes into a pre-tagged locus in mouse ES cells. This methodology is based on the combined use of two independent site-specific recombination systems (Cre/loxP and Flp/FRT) on the 5' and 3' side of the transgene. This renders the introduced sequence more stable, compared to systems that utilise only a single SSR. This is of great importance in situations where selection for the correct recombination product is not possible and where a prolonged activity of the SSR might excise the recombination product.
The general applicability of this method was investigated at three different genomic loci. With selective pressure applied, correct recombination was found at all three loci in 6178% of all clones. This demonstrates the feasibility of Froxing and shows its relative independence of the chosen locus. The fact that the overall number of clones differed between the analysed loci most likely displays the variation in accessibility of the respective locus to the SSRs. All plasmids were provided transiently, thus minimising random integration of the transgene and negative effects associated with prolonged Cre expression (24).
Not all clones that displayed Cre/lox recombination showed Flp-mediated recombination, which might reflect the lower activity of Flp in mammalian cells (25). We tried to circumvent this disadvantage by expressing Flp from a stronger promoter (pCAGGS) than Cre (pHSV-Tk) (26), but were not able to prevent mosaicism occurring at the FRT site. Nevertheless, 91% of the clones were non-mosaic and mosaic cells can easily be singled out by passaging the cells. We never found mosaicism at the lox site, either in experiments with or without selection, supporting the proposed reaction mechanism of Froxing with Cre recombination as the initial step, followed by Flp recombination.
The only publication on RMCE in ES cells without selection reports 2% (2 out of 96, all of which were transfected) correct colonies (7). In this case, inverted heterospecific lox sites were applied. With our approach of combining independent recombination systems, we could increase the efficiency of exchange under non-selective conditions
7-fold (1415%). A closer examination of these cells revealed that 97% were fully recombined (33/34). Application of a short puromycin pulse resulted in modest enrichment of GFP-positive cells. This is in disagreement with Schaft et al. (18), who found no significant effect of short-term puromycin treatment. One could speculate whether IRES-mediated Puro translation is altered in our expression construct.
The approach presented here is very promising for in vivo applications for two reasons. First, the recombination rate of 1415% is high enough to allow sufficient recovery of mutants. Second, the problems encountered with heterospecific lox sites (3) are unlikely to occur when two independent recombination systems are applied. Another advantage over heterospecific sites may be the use of wild-type sequences, as the efficiency of recombination decreases with the introduction of mutations into recognition sites (3,12).
For routine use in ES cells, approaches which include a more thorough removal of non-transfected cells may be suitable. For example, a froxed thymidine kinase gene-containing transgene could be introduced into the genome of the platform line followed by Ganciclovir counterselection. Another approach might use a froxed GFP in the platform line and, after transfection, cells would be sorted for loss of GFP expression. FACS has been shown not to affect the ability of ES cells to contribute to the germline (27).
In summary, the approach presented here should prove especially useful in the post-genomic era where rapid methodologies for the functional evaluation of genes become increasingly important.
| ACKNOWLEDGEMENTS |
|---|
We are indebted to A. F. Stewart for the kind gift of pCAGGS-Flpe, pPGKpaX1, pPGK-FRT and reagents necessary for ET cloning. We also thank K. L. Tucker for providing pPWL512, K. Rajewsky, H. Gu and R. Kühn for pMC-Cre and the E14.1 ES cell line, and we are grateful to H. Tyrlas for DNA sequencing and G. Galatowicz for flow cytometry. This work was supported by DFG grant Me 1121/2-1.
| REFERENCES |
|---|
|
|
|---|
- Bode,J., Schlake,T., Iber,M., Schubeler,D., Seibler,J., Snezhkov,E. and Nikolaev,L. (2000) The transgeneticists toolbox: novel methods for the targeted modification of eukaryotic genomes. Biol. Chem., 381, 801813.[Web of Science][Medline]
- Baer,A. and Bode,J. (2001) Coping with kinetic and thermodynamic barriers: RMCE, an efficient strategy for the targeted integration of transgenes. Curr. Opin. Biotechnol., 12, 473480.[Web of Science][Medline]
- Lauth,M., Moerl,K., Barski,J.J. and Meyer,M. (2000) Characterization of Cre-mediated cassette exchange after plasmid microinjection in fertilized mouse oocytes. Genesis, 27, 153158.[Web of Science][Medline]
- Bethke,B. and Sauer,B. (1997) Segmental genomic replacement by Cre-mediated recombination: genotoxic stress activation of the p53 promoter in single-copy transformants. Nucleic Acids Res., 25, 28282834.
[Abstract/Free Full Text] - Seibler,J., Schubeler,D., Fiering,S., Groudine,M. and Bode,J. (1998) DNA cassette exchange in ES cells mediated by Flp recombinase: an efficient strategy for repeated modification of tagged loci by marker-free constructs. Biochemistry, 37, 62296234.[Medline]
- Feng,Y.Q., Seibler,J., Alami,R., Eisen,A., Westerman,K.A., Leboulch,P., Fiering,S. and Bouhassira,E.E. (1999) Site-specific chromosomal integration in mammalian cells: highly efficient CRE recombinase-mediated cassette exchange. J. Mol. Biol., 292, 779785.[Web of Science][Medline]
- Soukharev,S., Miller,J.L. and Sauer,B. (1999) Segmental genomic replacement in embryonic stem cells by double lox targeting. Nucleic Acids Res., 27, e21.
[Abstract/Free Full Text] - Siegel,R.W., Jain,R. and Bradbury,A. (2001) Using an in vivo phagemid system to identify non-compatible loxP sequences. FEBS Lett., 505, 467473.[Medline]
- Aranda,M., Kanellopoulou,C., Christ,N., Peitz,M., Rajewsky,K. and Dröge,P. (2001) Altered directionality in the Cre-loxP site-specific recombination pathway. J. Mol. Biol., 311, 453459.[Web of Science][Medline]
- Kolb,A.F. (2001) Selection-marker-free modification of the murine ß-casein gene using a lox2272 [correction of lox2722] site. Anal. Biochem., 290, 260271.[Web of Science][Medline]
- Langer,S.J., Ghafoori,A.P., Byrd,M. and Leinwand,L. (2002) A genetic screen identifies novel non-compatible loxP sites. Nucleic Acids Res., 30, 30673077.
[Abstract/Free Full Text] - Lee,G. and Saito,I. (1998) Role of nucleotide sequences of loxP spacer region in Cre-mediated recombination. Gene, 216, 5565.[Web of Science][Medline]
- Zhang,Y., Buchholz,F., Muyrers,J.P. and Stewart,A.F. (1998) A new logic for DNA engineering using recombination in Escherichia coli. Nature Genet., 20, 123128.[Web of Science][Medline]
- Kellendonk,C., Tronche,F., Monaghan,A.P., Angrand,P.O., Stewart,F. and Schutz,G. (1996) Regulation of Cre recombinase activity by the synthetic steroid RU 486. Nucleic Acids Res., 24, 14041411.
[Abstract/Free Full Text] - Sambrook,J., Fritsch,E.F. and Maniatis,T. (1989) Molecular Cloning: A Laboratory Manual, 2nd Edn. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.
- Johnson,K.A., Lerner,C.P., Di Lacio,L.C., Laird,P.W., Sharpe,A.H. and Simpson,E.M. (1995) Transgenic mice for the preparation of hygromycin-resistant primary embryonic fibroblast feeder layers for embryonic stem cell selections. Nucleic Acids Res., 23, 12731275.
[Free Full Text] - Gu,H., Zou,Y.R. and Rajewsky,K. (1993) Independent control of immunoglobulin switch recombination at individual switch regions evidenced through Cre-loxP-mediated gene targeting. Cell, 73, 11551164.[Web of Science][Medline]
- Schaft,J., Ashery-Padan,R., van der Hoeven,F., Gruss,P. and Stewart,A.F. (2001) Efficient FLP recombination in mouse ES cells and oocytes. Genesis, 31, 610.[Web of Science][Medline]
- Kuhn,R., Rajewsky,K. and Muller,W. (1991) Generation and analysis of interleukin-4 deficient mice. Science, 254, 707710.
[Abstract/Free Full Text] - Ramirez-Solis,R., Rivera-Perez,J., Wallace,J.D., Wims,M., Zheng,H. and Bradley,A. (1992) Genomic DNA microextraction: a method to screen numerous samples. Anal. Biochem., 201, 331335.[Web of Science][Medline]
- Buchholz,F., Angrand,P.O. and Stewart,A.F. (1998) Improved properties of FLP recombinase evolved by cycling mutagenesis. Nat. Biotechnol., 16, 657662.[Web of Science][Medline]
- Jayaram,M. (1985) Two-micrometer circle site-specific recombination: the minimal substrate and the possible role of flanking sequences. Proc. Natl Acad. Sci. USA, 82, 58755879.
[Abstract/Free Full Text] - Lyznik,L.A., Mitchell,J.C., Hirayama,L. and Hodges,T.K. (1993) Activity of yeast FLP recombinase in maize and rice protoplasts. Nucleic Acids Res., 21, 969975.
[Abstract/Free Full Text] - Loonstra,A., Vooijs,M., Beverloo,H.B., Allak,B.A., van Drunen,E., Kanaar,R., Berns,A. and Jonkers,J. (2001) Growth inhibition and DNA damage induced by Cre recombinase in mammalian cells. Proc. Natl Acad. Sci. USA, 98, 92099214.
[Abstract/Free Full Text] - Andreas,S., Schwenk,F., Kuter-Luks,B., Faust,N. and Kuhn,R. (2002) Enhanced efficiency through nuclear localization signal fusion on phage
C31-integrase: activity comparison with Cre and FLPe recombinase in mammalian cells. Nucleic Acids Res., 30, 22992306.[Abstract/Free Full Text] - Araki,K., Imaizumi,T., Okuyama,K., Oike,Y. and Yamamura,K. (1997) Efficiency of recombination by Cre transient expression in embryonic stem cells: comparison of various promoters. J. Biochem. (Tokyo), 122, 977982.
[Abstract/Free Full Text] - Reddy,S., Rayburn,H., von Melchner,H. and Ruley,H.E. (1992) Fluorescence-activated sorting of totipotent embryonic stem cells expressing developmentally regulated lacZ fusion genes. Proc. Natl Acad. Sci. USA, 89, 67216725.
[Abstract/Free Full Text]
This article has been cited by other articles:
![]() |
Z. Li, A. Xing, B. P. Moon, R. P. McCardell, K. Mills, and S. C. Falco Site-Specific Integration of Transgenes in Soybean via Recombinase-Mediated DNA Cassette Exchange Plant Physiology, November 1, 2009; 151(3): 1087 - 1095. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. D. Louwerse, M. C.M. van Lier, D. M. van der Steen, C. M.T. de Vlaam, P. J.J. Hooykaas, and A. C. Vergunst Stable Recombinase-Mediated Cassette Exchange in Arabidopsis Using Agrobacterium tumefaciens Plant Physiology, December 1, 2007; 145(4): 1282 - 1293. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Pscherer, J. Schliwka, K. Wildenberger, A. Mincheva, C. Schwaenen, H. Dohner, S. Stilgenbauer, and P. Lichter Antagonizing inactivated tumor suppressor genes and activated oncogenes by a versatile transgenesis system: application in mantle cell lymphoma FASEB J, June 1, 2006; 20(8): 1188 - 1190. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Dafhnis-Calas, Z. Xu, S. Haines, S. K. Malla, M. C. M. Smith, and W. R. A. Brown Iterative in vivo assembly of large and complex transgenes by combining the activities of {varphi}C31 integrase and Cre recombinase Nucleic Acids Res., December 15, 2005; 33(22): e189 - e189. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Seibler, B. Kuter-Luks, H. Kern, S. Streu, L. Plum, J. Mauer, R. Kuhn, J. C. Bruning, and F. Schwenk Single copy shRNA configuration for ubiquitous gene knockdown in mice Nucleic Acids Res., April 14, 2005; 33(7): e67 - e67. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. B. Osipovich, A. Singh, and H. E. Ruley Post-entrapment genome engineering: First exon size does not affect the expression of fusion transcripts generated by gene entrapment Genome Res., March 1, 2005; 15(3): 428 - 435. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||






