Nucleic Acids Research

This Article Abstract Print PDF (160K) Alert me when this article is cited Alert me if a correction is posted Services Email this article to a friend Similar articles in this journal Similar articles in ISI Web of Science Similar articles in PubMed Alert me to new issues of the journal Add to My Personal Archive Download to citation manager Search for citing articles in: ISI Web of Science (36) Request Permissions Commercial Re-use Guidelines for Open Access NAR Content Google Scholar Articles by Wu, L. Articles by Hickson, I. D. Search for Related Content PubMed PubMed Citation Articles by Wu, L. Articles by Hickson, I. D. Social Bookmarking          What's this?

Nucleic Acids Research, 2002, Vol. 30, No. 22 4823-4829
© 2002 Oxford University Press

The Bloom’s syndrome helicase stimulates the activity of human topoisomerase III

Leonard Wu and Ian D. Hickson^*

Cancer Research UK Laboratories, Weatherall Institute of Molecular Medicine, University of Oxford, John Radcliffe Hospital, Oxford OX3 9DS, UK

*To whom correspondence should be addressed. Tel: +44 1865 222 417; Fax: +44 1865 222 431; Email: ian.hickson{at}cancer.org.uk

Received August 15, 2002; Revised and Accepted September 17, 2002

	ABSTRACT

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
Bloom’s syndrome (BS) is a disorder associated with chromosomal instability and a predisposition to the development of cancer. The BS gene product, BLM, is a DNA helicase of the RecQ family that forms a complex in vitro and in vivo with topoisomerase III. Here, we show that BLM stimulates the ability of topoisomerase III to relax negatively supercoiled DNA. Moreover, DNA binding analyses indicate that BLM recruits topoisomerase III to its DNA substrate. Consistent with this, a mutant form of BLM that retains helicase activity, but is unable to bind topoisomerase III, fails to stimulate topoisomerase activity. These results indicate that a physical association between BLM and topoisomerase III is a prerequisite for their functional biochemical interaction.

	INTRODUCTION

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
Bloom’s syndrome (BS) is a rare genetic disorder characterized by proportional dwarfism, immunodeficiency, male infertility and a greatly elevated incidence of cancers of most types (reviewed in 1). This predisposition to cancer is thought to arise from the inherent genomic instability that is a feature of BS cells. In particular, BS cells display an elevated level of genetic recombination that is manifested as an increase in the frequency of both sister chromatid exchanges and interchromosomal homologous recombination events (2).

The gene mutated in BS, BLM, encodes a protein of molecular mass 159 kDa that belongs to the RecQ family of DNA helicases (3). BLM protein has been purified and shown to act as a 3'5' DNA helicase on a variety of different DNA substrates (4–8). Mutations in two other genes encoding RecQ helicases are also associated with human cancer-prone disorders. WRN is defective in Werner’s syndrome and RECQ4 is defective in Rothmund–Thomson syndrome (9,10). Members of the RecQ helicase family contain a highly conserved catalytic helicase domain that is flanked by domains that vary both in size and sequence between different family members. However, despite this apparent sequence divergence in those regions outside the helicase domain, all known mutants lacking a RecQ helicase display genomic instability (reviewed in 11–13). Moreover, many of these mutants display a hyper-recombinogenic phenotype reminiscent of BS cells, suggesting that RecQ helicases perform a conserved function in controlling the level of homologous recombination in cells (14–19). Although the precise cellular role of any RecQ helicase has yet to be elucidated, several lines of evidence suggest that RecQ helicases act in concert with type IA topoisomerases (reviewed in 20).

The type IA subclass of topoisomerases includes Escherichia coli topoisomerases I and III and the eukaryotic topoisomerase III enzymes (reviewed in 21). In vertebrates, there are at least two isoforms of topoisomerase III, termed and ß, which display only a weak topoisomerase activity towards negatively supercoiled DNA (22–25). Yeast cells express a single topoisomerase III enzyme encoded by the TOP3 gene (26). In Saccharomyces cerevisiae, top3 mutants are viable, but grow very slowly and have defects in S phase responses to DNA damage and in both mitotic and meiotic recombination (16,26–28). In contrast, the top3⁺ gene in Schizosaccharomyces pombe is essential for viability, with top3 mutants displaying an inability to accurately segregate daughter chromosomes during mitosis (29,30). Interestingly, mutation of SGS1 or rqh1⁺, the sole RecQ homologues found in budding and fission yeast, respectively, can suppress the deleterious effects caused by the absence of Top3 protein (16,28–30). One interpretation of this conserved genetic interaction is that RecQ helicases act upstream of topoisomerase III in the same biochemical pathway and that RecQ helicases generate a DNA structure that requires resolution by topoisomerase III (reviewed in 20). Consistent with this proposal, E.coli RecQ can convert negatively supercoiled plasmid DNA to a structure [as yet not defined, but presumed to be single-stranded (ss)DNA] that can be acted upon by E.coli or S.cerevisiae Top3p to generate catenated DNA molecules (31).

The S.cerevisiae Sgs1 and Top3 proteins also interact physically, raising the possibility that Sgs1p may recruit Top3p to its site of action (16,32,33). We and others have demonstrated that BLM and human topoisomerase III (hTOPO III) are tightly associated in human cells (34–36) and that the two purified proteins interact in vitro (35), indicating that this association is a direct one.

In this study, we demonstrate that BLM can stimulate the topoisomerase activity of hTOPO III. In contrast, a mutant BLM protein that is catalytically active, but no longer able to interact with hTOPO III, has lost the ability to stimulate hTOPO III protein. Moreover, we provide evidence that hTOPO III associates with a BLM–DNA complex. These data are consistent with the notion that hTOPO III is recruited to its site of action through a direct interaction with the BLM helicase.

	MATERIALS AND METHODS

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
DNA substrates
The X174 helicase substrate was generated by annealing a 21mer oligonucleotide (GTGCATATACCTGGTCTTTCG) to circular X174 ssDNA before being extended by 4 nt in the presence of Klenow polymerase, dATP, dTTP and [-³²P]dCTP. G-quadruplex (G4) DNA representing the murine immunoglobulin S2B switch region and the 12 nt bubble-containing duplex were prepared using the oligonucleotides and experimental conditions described previously (6,7). Topoisomerase assays (see below) were performed on negatively supercoiled (form I) X174 DNA.

Expression and purification of recombinant proteins
Plasmids driving the expression of either hexahistidine-tagged BLM or BLM-NC have been described previously (4,35). Purification of these proteins from yeast was as described by Karow et al. (4). Relative specific helicase activities of both proteins were determined using the partially double-stranded X174 DNA substrate described above. Recombinant hTOPO III was a kind gift of Drs Jean-François Riou and Hélène Goulaouic (Aventis Pharma, France). Human RPA was a kind gift of Dr Rick Wood (University of Pittsburgh). Escherichia coli SSB was purchased from Promega.

Far-western analysis
Protein–protein interactions between hTOPO III and the BLM or BLM-NC proteins were tested as described previously (35).

Helicase assays
Unwinding of various DNA substrates by BLM and BLM-NC were performed using the reaction conditions described by Karow et al. (4)

Topoisomerase assays
Typically, BLM (120 nM) and hTOPO III (300 nM) were incubated with 200 ng of negatively supercoiled X174 in the presence of either human RPA (350 ng) or E.coli SSB (1.5 µg) in 30 µl of reaction buffer (50 mM Tris–HCl pH 7.5, 5 mM MgCl₂, 100 µg/ml BSA, 40 mM NaCl, 0.2 U creatine kinase, 6 mM phosphocreatine and 1 mM DTT). In experiments comparing BLM and BLM-NC, protein preparations were diluted to give equivalent specific activities. Reactions were initiated by the addition of 5 mM ATP, followed by incubation at 37°C. Aliquots of 5 µl were taken at the indicated times and 1 µl of 5x STOP buffer (250 mM EDTA, 5% SDS, 5 mg/ml proteinase K) was added. Samples were then incubated at 37°C for a further 10 min to deproteinise the DNA. The DNA was separated on 0.6% agarose gels in the absence of ethidium bromide, before being transferred to nylon filters by conventional Southern blotting and then hybridised to a random-primed labeled X174 DNA probe using Rediprime (Amersham). Visualisation and quantification of reaction products were performed using a PhosphorImager 840 (Molecular Dynamics) and ImageQuant software.

Gel mobility shift assays
Typically, BLM (300 nM) and hTOPO III (100–900 nM) were incubated together with the labeled bubble-containing duplex substrate in 30 µl of reaction buffer (20 mM triethanolamine–HCl pH 7.5, 5 mM MgCl₂, 100 µg/ml BSA, 40 mM NaCl, 1 mM DTT and 5 mM ATPS). Reactions were incubated at room temperature for 25 min. Protein–DNA complexes were fixed by the addition of 0.25% glutaraldehyde and incubation at 37°C for 10 min, before electrophoresis through a native 5% polyacrylamide gel in TBE buffer.

	RESULTS

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
BLM can stimulate the activity of hTOPO III
To examine a possible functional role for the interaction of the BLM and hTOPO III proteins, we investigated whether BLM had any effect on the ability of hTOPO III to act upon negatively supercoiled X174 DNA. When hTOPO III was incubated with supercoiled X174 DNA in the absence of BLM, form I DNA disappeared with the concomitant appearance of topoisomers. At longer incubation periods, fully relaxed DNA (form II) was also evident. It is possible that a proportion of form II DNA molecules also represented nicked DNA since Top3ß from Drosophila melanogaster has been shown to introduce single-stranded nicks into negatively supercoiled DNA (see Discussion). Given the potential heterogeneity of the reaction products generated by hTOPO III, we quantified the loss of form I DNA as an indication of hTOPO III activity and found that co-incubation with BLM led to an approximate doubling in the rate of hTOPO III activity (Fig. 1A and B). Incubation of BLM alone with the X174 substrate had no effect on the level of form I DNA, indicating that the BLM preparation did not contain any contaminating topoisomerase activity (Fig. 1A).

View larger version (37K): [in this window] [in a new window]   Figure 1. BLM stimulates the activity of hTOPO III. (A) Time course showing the relaxation of supercoiled X174 DNA in the presence of 120 nM BLM alone (top), 300 nM hTOPO III alone (middle) or BLM and hTOPO III together (bottom). All reactions contained 150 nM RPA. The positions of supercoiled DNA (form I), relaxed DNA (form II) and intermediate topoisomers are indicated on the right. (B) Quantification of the data from (A), showing loss of form I DNA in the presence of hTOPO III alone (closed cicles) or BLM and hTOPO III together (open circles). (C) Stimulation of hTOPO III by BLM is dependent on RPA. Relaxation of supercoiled X174 DNA incubated with various combinations of BLM, hTOPO III and RPA, as indicated above the panel. Positions of supercoiled DNA (form I), relaxed DNA (form II) and topoisomers are indicated on the right.

 
The stimulatory effect of BLM on the activity of hTOPO III was found to be dependent on the presence of RPA in the reactions (Fig. 1C). It was therefore possible that RPA inhibits hTOPO III by binding to ssDNA regions in the negatively supercoiled substrate, thereby preventing access of hTOPO III to the DNA. BLM might then act to stimulate hTOPO III by displacing RPA from the DNA. To eliminate this possibility, we examined the effect of RPA on hTOPO III activity in the absence of BLM. RPA did not inhibit the plasmid relaxation activity of hTOPO III, but rather had a mild stimulatory effect (Fig. 2). This effect appeared to be solely a function of RPA binding to ssDNA, as opposed to a protein–protein interaction occurring between RPA and hTOPO III, since a similar stimulatory effect was also seen when RPA was substituted by E.coli SSB (Fig. 2). We therefore analysed whether SSB could substitute for RPA in supporting the stimulatory effects of BLM on the activity of hTOPO III. Figure 2 shows that in the presence of SSB, BLM still caused a stimulation of hTOPO III plasmid relaxation activity. Due to the apparent functional equivalence of RPA and SSB in these reactions, coupled with the commercial availability of SSB, the bacterial protein was used in all subsequent experiments.

View larger version (36K): [in this window] [in a new window]   Figure 2. Effects of RPA and SSB on plasmid relaxation catalysed by hTOPO III. (A) Time course showing the relaxation of supercoiled X174 DNA in the presence of combinations of BLM, hTOPO IIII, SSB or RPA, as indicated above the panels. Positions of supercoiled DNA (form I), relaxed DNA (form II) and topoisomers are indicated on the left. (B) Quantification of the loss of form I DNA in the presence of hTOPO III alone (open circles) or of hTOPO III in the presence of RPA (open triangles) or SSB (open squares) or of hTOPO III in the presence of BLM and SSB (closed squares).

 
BLM can recruit hTOPO III to single-stranded DNA bubbles
BLM and hTOPO III have been shown to interact directly with each other and form a complex in vivo (34,35). Moreover, it has been shown that the ability of ectopically expressed BLM to reduce the elevated frequency of SCEs in BS cells correlates with its ability to interact with hTOPO III (36). The stimulatory effect of BLM on the activity of hTOPO III that we observed might therefore be mediated by the recruitment of hTOPO III to its site of action by BLM. In such a scenario, BLM should be able to simultaneously interact with both DNA and hTOPO III. We have shown previously that BLM can unwind a duplex DNA molecule that contains a single-stranded bubble of the sort that is a characteristic of negatively supercoiled DNA (6). We tested, therefore, the ability of BLM to bind simultaneously to a synthetic bubble-containing duplex DNA substrate and to hTOPO III. As expected, BLM was found to bind the bubble-containing substrate and generated two retarded complexes designated B1 and B2 (Fig. 3). A proportion of the substrate was also incorporated into a complex that was retained in the wells. Since this material did not resolve under the gel running conditions employed, it was not possible to anaylse further the nature of these apparent aggregates of DNA and protein. Quantification of the amount of DNA in these complexes revealed that B1 and B2 represented 9 and 6%, respectively, of the total substrate in the reaction. In contrast, at the concentrations used in Figure 3, hTOPO III displayed a negligible binding affinity for the DNA substrate. However, the addition of hTOPO III to BLM-containing reactions resulted in the conversion of 93% of B1 and 54% of B2 into a new, slower migrating complex, termed BT (Fig. 3). Since concentrations of hTOPO III were used at which hTOPO III alone maximally bound <5% of the substrate, the conversion of the majority of B1 and B2 into BT indicates that hTOPO III preferentially binds B1 and B2 over the DNA substrate alone. These data also imply that DNA-bound BLM can still form a complex with hTOPO III and are consistent with the notion that BLM recruits hTOPO III to its site of action on DNA.

View larger version (40K): [in this window] [in a new window]   Figure 3. BLM can recruit hTOPO III to ssDNA structures. Electrophoretic mobility shift assay using a bubble DNA substrate, 300 nM BLM (where indicated by + above the lanes) and varying concentrations of hTOPO III, as indicated above the lanes. The positions of the unbound DNA bubble substrate (end-labeled on one strand as indicated by the asterisk) and protein–DNA complexes (B1, B2 and BT) are indicated on the left.

 
Purification of a hTOPO III binding-defective form of BLM that retains helicase activity
To confirm that the stimulatory effect of BLM on hTOPO III activity requires BLM to recruit hTOPO III to its site of action, a mutant BLM protein was generated that was no longer able to interact with hTOPO III. Mapping studies have revealed that two hTOPO III interaction domains exist in BLM that are located between residues 1–212 and 1267–1417 (35). A hexahistidine-tagged truncated protein, BLM-NC, that consists of residues 213–1266 of BLM and does not, therefore, contain either of the hTOPO III interaction domains, was expressed in yeast and purified to near homogeneity by nickel-chelate affinity chromatography. BLM-NC had an apparent molecular mass of 150 kDa on SDS–PAGE (Fig. 4A) and was recognised on western blots by both polyclonal and monoclonal anti-BLM antibodies (35), as well as by an anti-hexahistidine tag antibody (data not shown), thereby confirming its identity.

View larger version (27K): [in this window] [in a new window]   Figure 4. A truncated form of BLM that does not bind to hTOPO III fails to stimulate topoisomerase activity. (A) A Coomassie blue stained polyacrylamide gel of purified BLM and BLM-NC (left) and a far-western blot (right) of the same BLM and BLM-NC proteins using hTOPO III as probe (see text for details). (B) Comparison of the helicase activity of the BLM and BLM-NC proteins on substrates comprising an oligonucleotide annealed to single-stranded X174 DNA (left) and G4 DNA (right). The positions of the substrate and the unwound ssDNA products are indicated on the left of each panel. Lanes marked – contained no BLM protein. (C) Time course comparing the ability of BLM and BLM-NC to stimulate the topoisomerase activity of hTOPO III on supercoiled X174 DNA. Reactions contained hTOPO III together with no additional protein (left), BLM-NC protein (middle) or full-length BLM protein (right). All reactions contained SSB.

 
To establish that BLM-NC no longer bound hTOPO III, and hence to eliminate the possibility that additional hTOPO III interaction domains might be present in the BLM protein not detected in our previous studies, far-western analysis using hTOPO III as a probe was performed with BLM and BLM-NC. After separation of the BLM and BLM-NC proteins by SDS–PAGE and transfer to nitrocellulose filters, the membranes were incubated with hTOPO III before being washed to remove any unbound material. hTOPO III was then detected by western analysis using a previously characterized polyclonal antibody (D6) (35). We have shown using this technique that hTOPO III associates with full-length BLM (35), and this result was confirmed in the current experiments (Fig. 4A). In contrast, hTOPO III did not bind to BLM-NC (Fig. 4A), confirming that all hTOPO III interaction domains have been removed by truncation of BLM to create BLM-NC.

Despite the fact that relatively large regions of BLM were deleted to generate BLM-NC, the truncated protein was still catalytically active and was able to unwind a variety of DNA substrates that have been shown to be substrates for the full-length protein (4,6,7). These included oligonucleotides annealed to a circular ssDNA and highly stable G4 DNA structures (Fig. 4B).

A hTOPO III binding-defective mutant form of BLM cannot stimulate hTOPO III
We next compared the ability of BLM and BLM-NC to stimulate the activity of hTOPO III. Significantly, the stimulatory effect on hTOPO III activity observed with full-length BLM was not seen when BLM was substituted by BLM-NC (Fig. 4C). This failure of BLM-NC to stimulate hTOPO III was seen over a wide concentration range (81-fold), with higher concentrations even having a mild inhibitory effect on hTOPO III (Fig. 4C). We conclude, therefore, that the stimulatory effect of BLM on hTOPO III requires that the two proteins be capable of forming a complex.

	DISCUSSION

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
In this paper, we report the first demonstration of a functional biochemical interaction between a eukaryotic RecQ family DNA helicase and topoisomerase III. BLM was found to significantly stimulate the ability of hTOPO III to act upon negatively supercoiled DNA. When hTOPO III alone was incubated with supercoiled X174 DNA, two classes of reaction products were observed. These were in the form of topoisomers that appeared after 15 min incubation, and form II DNA that only accumulated after longer periods of incubation, up to 60 min. The latter class of reaction products most likely consisted of fully relaxed DNA, since their appearance occurred only after the formation of topoisomers. However, it is also possible that a proportion of form II molecules contained single strand nicks. Indeed, Wilson-Sali and Hsieh (37) have reported recently that Top3ß from D.melanogaster is able to catalyse the nicking of negatively supercoiled DNA. It is presently unknown if hTOPO III possesses an equivalent endonucleolytic activity. However, we are currently addressing this issue and determining what differential effects BLM might have on the topoisomerase versus putative endonuclease activities of hTOPO III.

BLM was found able to bind simultaneously to both hTOPO III and DNA. Moreover, the stimulation of hTOPO III by BLM was lost when BLM was modified to eliminate all of the hTOPO III interaction domains. We therefore propose that one role of BLM is to recruit hTOPO III to its site of action. This proposal is supported by a number of observations. In normal cells, BLM and hTOPO III can be detected together in subnuclear structures termed PML bodies (38–41). However, in BS cells, hTOPO III is expressed normally but is aberrantly localised in the nucleus (34,35). Furthermore, recent studies on Sgs1p, the budding yeast homologue of BLM, which also interacts with Top3p, have shown that expression of mutant forms of Sgs1p that cannot associate withTop3p are unable to complement several aspects of the sgs1 phenotype, including sensitivity to methylmethane sulphonate and hydroxyurea, which damage DNA and inhibit DNA replication, respectively (32). However, this requirement for Sgs1p to interact with Top3p can be circumvented by the expression of a fusion protein consisting of Top3p fused to the N-terminus of a Top3p binding-defective form of Sgs1p (32). Together, these data indicate that the evolutionarily conserved interaction between RecQ helicases and topoisomerase III serves to recruit topoisomerase III to its site of action.

The requirement for the presence of either RPA or SSB in the reactions to observe the stimulatory effect of BLM on the activity of hTOPO III suggests that the DNA structure BLM recruits hTOPO III to has single-stranded character. Consistent with this is the ability of BLM to recruit hTOPO III to single-stranded ‘bubbles’. In human cells, the nature of the DNA structure that BLM loads hTOPO III onto remains to be determined. TOPO III is required for embryonic development in mice (42), indicating that TOPO III performs an essential role that cannot be provided by other topoisomerases. Similarly, in both budding and fission yeast, neither Top1p nor Top2p can functionally substitute for Top3p (26,27,29,30). Taken together, these findings indicate that eukaryotic topoisomerase III enzymes do not function as typical topoisomerases and, consistent with this, it has been reported previously that Top3p is unlikely to play a significant role in regulating the overall supercoiling status of the budding yeast genome (reviewed in 43). Mutants lacking topoisomerase III, as well as those defective in RecQ family helicases, including BLM, generally display hyper-recombination throughout the genome (14–19,26). This would suggest that the BLM–hTOPO III complex acts to suppress inadvertant recombination or to disrupt inappropriately paired DNA molecules. One possible target for the complex is the Holliday junction recombination intermediate. It is known that RecQ, Sgs1p, WRN and BLM can disrupt Holliday junctions (5,6,44–46). Moreover, we have shown recently that BLM promotes the ATP-dependent branch migration of these junctions (5). Through catalysing this reaction, BLM may act to promote and/or eliminate recombinants, depending upon the circumstances. Although the role of topoisomerase III in this process is unclear, it may be significant that yeast Top3p has been shown to be required for the resolution of meiotic recombination intermediates (27). The possibility exists, therefore, that BLM recruits hTOPO III to Holliday junctions to affect their resolution. Ongoing studies of the effects of hTOPO III on BLM-catalysed Holliday junction branch migration reactions aim to address this possibility. A second potential role for the BLM–hTOPO III complex is in the elimination of G-quadruplex DNA in order to permit progression of the replication and/or transcription machinery. This ability of BLM to unwind such non-canonical Watson–Crick DNA structures is a conserved function of the RecQ family helicases (13). G4 DNA has been suggested to be highly recombinogenic due primarily to its potential to lead to replication fork stalling and hence the formation of DNA double-strand breaks.

In summary, we have shown that BLM stimulates the activity of hTOPO III and that this stimulation requires that the two proteins be able to form a stable complex. We propose that BLM functions to regulate the levels of genetic recombination through the recruitment of hTOPO III to recombinogenic DNA structures and/or recombination intermediates. The biochemical functions of BLM and hTOPO III appear to be intimately connected, consistent with the observation that lack of BLM in BS cell lines causes hTOPO III to be mislocalised in the nucleus (34,35). It is therefore quite possible that the diverse phenotypes observed in BS cells are not due solely to a loss of BLM. Instead, ‘uncoupling’ of the BLM–hTOPO III heteromeric helicase/topoisomerase complex might be at least partially responsible for this phenotypic diversity.

	ACKNOWLEDGEMENTS

 
We thank Drs J.-F. Riou and H. Goulaouic for hTOPO III, Dr R. Wood for RPA, Dr C. Norbury for critical reading of the manuscript and members of the Cancer Research UK Genome Integrity Group for useful discussions. This work was supported by Cancer Research UK.

	REFERENCES

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 

1. German,J. (1993) Bloom syndrome: a Mendelian prototype of somatic mutational disease. Medicine, 72, 393–406.[Medline]

2. Chaganti,R.S., Schonberg,S. and German,J. (1974) A manyfold increase in sister chromatid exchanges in Bloom’s syndrome lymphocytes. Proc. Natl Acad. Sci. USA, 71, 4508–4512.[Abstract/Free Full Text]

3. Ellis,N.A., Groden,J., Ye,T.Z., Straughen,J., Lennon,D.J., Ciocci,S., Proytcheva,M. and German,J. (1995) The Bloom’s syndrome gene product is homologous to RecQ helicases. Cell, 83, 655–666.[Web of Science][Medline]

4. Karow,J.K., Chakraverty,R.K. and Hickson,I.D. (1997) The Bloom’s syndrome gene product is a 3'-5' DNA helicase. J. Biol. Chem., 272, 30611–30614.[Abstract/Free Full Text]

5. Karow,J.K., Constantinou,A., Li,J.L., West,S.C. and Hickson,I.D. (2000) The Bloom’s syndrome gene product promotes branch migration of holliday junctions. Proc. Natl Acad. Sci. USA, 97, 6504–6508.[Abstract/Free Full Text]

6. Mohaghegh,P., Karow,J.K., Brosh,R.M.,Jr, Bohr,V.A. and Hickson,I.D. (2001) The Bloom’s and Werner’s syndrome proteins are DNA structure-specific helicases. Nucleic Acids Res., 29, 2843–2849.[Abstract/Free Full Text]

7. Sun,H., Karow,J.K., Hickson,I.D. and Maizels,N. (1998) The Bloom’s syndrome helicase unwinds G4 DNA. J. Biol. Chem., 273, 27587–27592.[Abstract/Free Full Text]

8. van Brabant,A.J., Ye,T., Sanz,M., German,I.J., Ellis,N.A. and Holloman,W.K. (2000) Binding and melting of D-loops by the Bloom syndrome helicase. Biochemistry, 39, 14617–14625.[Medline]

9. Yu,C., Oshima,J., Fu,Y., Wijsman,E.M., Hisama,F., Alisch,R., Matthews,S., Nakura,J., Miki,T., Ouais,S. et al. (1996) Positional cloning of the Werner’s syndrome gene. Science, 272, 258–262.[Abstract]

10. Kitao,S., Shimamoto,A., Goto,M., Miller,R.W., Smithson,W.A., Lindor,N.M. and Furuichi,Y. (1999) Mutations in RECQL4 cause a subset of cases of Rothmund-Thomson syndrome. Nature Genet., 22, 82–84.[Web of Science][Medline]

11. Mohaghegh,P. and Hickson,I.D. (2001) DNA helicase deficiencies associated with cancer predisposition and premature ageing disorders. Hum. Mol. Genet., 10, 741–746.[Abstract/Free Full Text]

12. Wu,L., Davies,S.L. and Hickson,I.D. (2000) Roles of RecQ family helicases in the maintenance of genome stability. Cold Spring Harbor Symp. Quant. Biol., 65, 573–581.[Web of Science][Medline]

13. Karow,J.K., Wu,L. and Hickson,I.D. (2000) RecQ family helicases: roles in cancer and aging. Curr. Opin. Genet. Dev., 10, 32–38.[Web of Science][Medline]

14. Hanada,K., Ukita,T., Kohno,Y., Saito,K., Kato,J.-I. and Ikeda,H. (1997) RecQ DNA helicase is a suppressor of illegitimate recombination in Escherichia coli. Genetics, 94, 3860–3865.

15. Fukuchi,K., Martin,G.M. and Monnat,R.J.,Jr (1989) Mutator phenotype of Werner syndrome is characterized by extensive deletions. Proc. Natl Acad. Sci. USA, 86, 5893–5897.[Abstract/Free Full Text]

16. Gangloff,S., McDonald,J.P., Bendixen,C., Arthur,L. and Rothstein,R. (1994) The yeast type I topoisomerase Top3 interacts with Sgs1, a DNA helicase homolog: a potential eukaryotic reverse gyrase. Mol. Cell. Biol., 14, 8391–8398.[Abstract/Free Full Text]

17. Stewart,E., Chapman,C.R., Al-Khodairy,F., Carr,A.M. and Enoch,T. (1997) rqh1⁺, a fission yeast gene related to the Bloom’s and Werner’s syndrome genes, is required for reversible S phase arrest. EMBO J., 16, 2682–2692.[Web of Science][Medline]

18. Watt,P.M., Hickson,I.D., Borts,R.H. and Louis,E.J. (1996) SGS1, a homologue of the Bloom’s and Werner’s syndrome genes, is required for maintenance of genome stability in Saccharomyces cerevisiae. Genetics, 144, 935–945.[Abstract]

19. Nakayama,H., Nakayama,K., Nakayama,R., Irino,N., Nakayama,Y. and Hanawalt,P.C. (1984) Isolation and genetic characterization of a thymineless death-resistant mutant of Escherichia coli K12: identification of a new mutation (recQ1) that blocks the RecF recombination pathway. Mol. Gen. Genet., 195, 474–480.[Web of Science][Medline]

20. Wu,L. and Hickson,I.D. (2001) RecQ helicases and topoisomerases: components of a conserved complex for the regulation of genetic recombination. Cell. Mol. Life Sci., 58, 894–901.[Web of Science][Medline]

21. Champoux,J.J. (2001) DNA topoisomerases: structure, function and mechanism. Annu. Rev. Biochem., 70, 369–413.[Web of Science][Medline]

22. Hanai,R., Caron,P.R. and Wang,J.C. (1996) Human TOP3: a single-copy gene encoding DNA topoisomerase III. Proc. Natl Acad. Sci. USA, 93, 3653–3657.[Abstract/Free Full Text]

23. Seki,T., Seki,M., Onodera,R., Katada,T. and Enomoto,T. (1998) Cloning of cDNA encoding a novel mouse DNA topoisomerase III (Topo IIIbeta) possessing negatively supercoiled DNA relaxing activity, whose message is highly expressed in the testis. J. Biol. Chem., 273, 28553–28556.[Abstract/Free Full Text]

24. Goulaouic,H., Roulon,T., Flamand,O., Grondard,L., Lavelle,F. and Riou,J.F. (1999) Purification and characterization of human DNA topoisomerase III. Nucleic Acids Res., 27, 2443–2450.[Abstract/Free Full Text]

25. Wilson,T.M., Chen,A.D. and Hsieh,T. (2000) Cloning and characterization of Drosophila topoisomerase IIIbeta. Relaxation of hypernegatively supercoiled DNA. J. Biol. Chem., 275, 1533–1540.[Abstract/Free Full Text]

26. Wallis,J.W., Chrebet,G., Brodsky,G., Rolfe,M. and Rothstein,R. (1989) A hyper-recombination mutation in S. cerevisiae identifies a novel eukaryotic topoisomerase. Cell, 58, 409–419.[Web of Science][Medline]

27. Gangloff,S., de Massy,B., Arthur,L., Rothstein,R. and Fabre,F. (1999) The essential role of yeast topoisomerase III in meiosis depends on recombination. EMBO J., 18, 1701–1711.[Web of Science][Medline]

28. Chakraverty,R.K., Kearsey,J.M., Oakley,T.J., Grenon,M., de La Torre Ruiz,M.A., Lowndes,N.F. and Hickson,I.D. (2001) Topoisomerase III acts upstream of Rad53p in the S-phase DNA damage checkpoint. Mol. Cell. Biol., 21, 7150–7162.[Abstract/Free Full Text]

29. Maftahi,M., Han,C.S., Langston,L.D., Hope,J.C., Zigouras,N. and Freyer,G.A. (1999) The top3(+) gene is essential in Schizosaccharomyces pombe and the lethality associated with its loss is caused by Rad12 helicase activity. Nucleic Acids Res., 27, 4715–4724.[Abstract/Free Full Text]

30. Goodwin,A., Wang,S.W., Toda,T., Norbury,C. and Hickson,I.D. (1999) Topoisomerase III is essential for accurate nuclear division in Schizosaccharomyces pombe. Nucleic Acids Res., 27, 4050–4058.[Abstract/Free Full Text]

31. Harmon,F.G., DiGate,R.J. and Kowalczykowski,S.C. (1999) RecQ helicase and topoisomerase III comprise a novel DNA strand passage function: a conserved mechanism for control of DNA recombination. Mol. Cell, 3, 611–620.[Web of Science][Medline]

32. Bennett,R.J. and Wang,J.C. (2001) Association of yeast DNA topoisomerase III and Sgs1 DNA helicase: studies of fusion proteins. Proc. Natl Acad. Sci. USA, 98, 11108–11113.[Abstract/Free Full Text]

33. Fricke,W.M., Kaliraman,V. and Brill,S.J. (2001) Mapping the DNA topoisomerase III binding domain of the Sgs1 DNA helicase. J. Biol. Chem., 276, 8848–8855.[Abstract/Free Full Text]

34. Johnson,F.B., Lombard,D.B., Neff,N.F., Mastrangelo,M.A., Dewolf,W., Ellis,N.A., Marciniak,R.A., Yin,Y., Jaenisch,R. and Guarente,L. (2000) Association of the Bloom syndrome protein with topoisomerase IIIalpha in somatic and meiotic cells. Cancer Res., 60, 1162–1167.[Abstract/Free Full Text]

35. Wu,L., Davies,S.L., North,P.S., Goulaouic,H., Riou,J.F., Turley,H., Gatter,K.C. and Hickson,I.D. (2000) The Bloom’s syndrome gene product interacts with topoisomerase III. J. Biol. Chem., 275, 9636–9644.[Abstract/Free Full Text]

36. Hu,P., Beresten,S.F., van Brabant,A.J., Ye,T.Z., Pandolfi,P.P., Johnson,F.B., Guarente,L. and Ellis,N.A. (2001) Evidence for BLM and Topoisomerase IIIalpha interaction in genomic stability. Hum. Mol. Genet., 10, 1287–1298.[Abstract/Free Full Text]

37. Wilson-Sali,T. and Hsieh,T.S. (2002) Generation of double-stranded breaks in hypernegatively supercoiled DNA by Drosophila topoisomerase III beta, a type IA enzyme. J. Biol. Chem., 277, 26865–26871.[Abstract/Free Full Text]

38. Zhong,S., Hu,P., Ye,T.Z., Stan,R., Ellis,N.A. and Pandolfi,P.P. (1999) A role for PML and the nuclear body in genomic stability. Oncogene, 18, 7941–7947.[Web of Science][Medline]

39. Sanz,M.M., Proytcheva,M., Ellis,N.A., Holloman,W.K. and German,J. (2000) BLM, the Bloom’s syndrome protein, varies during the cell cycle in its amount, distribution and co-localization with other nuclear proteins. Cytogenet. Cell Genet., 91, 217–223.[Web of Science][Medline]

40. Bischof,O., Kim,S.H., Irving,J., Beresten,S., Ellis,N.A. and Campisi,J. (2001) Regulation and localization of the Bloom syndrome protein in response to DNA damage. J. Cell Biol., 153, 367–380.[Abstract/Free Full Text]

41. Ishov,A.M., Sotnikov,A.G., Negorev,D., Vladimirova,O.V., Neff,N., Kamitani,T., Yeh,E.T., Strauss,J.F.,III and Maul,G.G. (1999) PML is critical for ND10 formation and recruits the PML-interacting protein daxx to this nuclear structure when modified by SUMO-1. J. Cell Biol., 147, 221–234.[Abstract/Free Full Text]

42. Li,W. and Wang,J.C. (1998) Mammalian DNA topoisomerase IIIalpha is essential in early embryogenesis. Proc. Natl Acad. Sci. USA, 95, 1010–1013.[Abstract/Free Full Text]

43. Wang,J.C. (1996) DNA topoisomerases. Annu. Rev. Biochem., 65, 635–692.[Web of Science][Medline]

44. Bennett,R.J., Keck,J.L. and Wang,J.C. (1999) Binding specificity determines polarity of DNA unwinding by the Sgs1 protein of S. cerevisiae. J. Mol. Biol., 289, 235–248.[Web of Science][Medline]

45. Constantinou,A., Tarsounas,M., Karow,J.K., Brosh,R.M., Bohr,V.A., Hickson,I.D. and West,S.C. (2000) Werner’s syndrome protein (WRN) migrates Holliday junctions and co-localises with RPA upon replication arrest. EMBO Rep., 1, 80–84.[Web of Science][Medline]

46. Harmon,F.G. and Kowalczykowski,S.C. (1998) RecQ helicase, in concert with RecA and SSB proteins, initiates and disrupts DNA recombination. Genes Dev., 12, 1134–1144.[Abstract/Free Full Text]

CiteULike    Connotea    Del.icio.us    What's this?

This article has been cited by other articles:

				A. V. Nimonkar, A. Z. Ozsoy, J. Genschel, P. Modrich, and S. C. Kowalczykowski Human exonuclease 1 and BLM helicase interact to resect DNA and initiate DNA repair PNAS, November 4, 2008; 105(44): 16906 - 16911. [Abstract] [Full Text] [PDF]

				S. Mohanty, T. Town, T. Yagi, C. Scheidig, K. Y. Kwan, H. G. Allore, R. A. Flavell, and A. C. Shaw Defective p53 engagement after the induction of DNA damage in cells deficient in topoisomerase 3{beta} PNAS, April 1, 2008; 105(13): 5063 - 5068. [Abstract] [Full Text] [PDF]

				J. D. Bartos, W. Wang, J. E. Pike, and R. A. Bambara Mechanisms by Which Bloom Protein Can Disrupt Recombination Intermediates of Okazaki Fragment Maturation J. Biol. Chem., October 27, 2006; 281(43): 32227 - 32239. [Abstract] [Full Text] [PDF]

				M. Wagner, G. Price, and R. Rothstein The Absence of Top3 Reveals an Interaction Between the Sgs1 and Pif1 DNA Helicases in Saccharomyces cerevisiae Genetics, October 1, 2006; 174(2): 555 - 573. [Abstract] [Full Text] [PDF]

				H. W. Mankouri and I. D. Hickson Top3 Processes Recombination Intermediates and Modulates Checkpoint Activity after DNA Damage Mol. Biol. Cell, October 1, 2006; 17(10): 4473 - 4483. [Abstract] [Full Text] [PDF]

				R. D. Kennedy and A. D. D'Andrea The Fanconi Anemia/BRCA pathway: new faces in the crowd Genes & Dev., December 15, 2005; 19(24): 2925 - 2940. [Abstract] [Full Text] [PDF]

				V. A. Rao, A. M. Fan, L. Meng, C. F. Doe, P. S. North, I. D. Hickson, and Y. Pommier Phosphorylation of BLM, Dissociation from Topoisomerase III{alpha}, and Colocalization with {gamma}-H2AX after Topoisomerase I-Induced Replication Damage Mol. Cell. Biol., October 15, 2005; 25(20): 8925 - 8937. [Abstract] [Full Text] [PDF]

				J. L. Plank, S. H. Chu, J. R. Pohlhaus, T. Wilson-Sali, and T.-s. Hsieh Drosophila melanogaster Topoisomerase III{alpha} Preferentially Relaxes a Positively or Negatively Supercoiled Bubble Substrate and Is Essential during Development J. Biol. Chem., February 4, 2005; 280(5): 3564 - 3573. [Abstract] [Full Text] [PDF]

				W. Li, S.-M. Kim, J. Lee, and W. G. Dunphy Absence of BLM leads to accumulation of chromosomal DNA breaks during both unperturbed and disrupted S phases J. Cell Biol., June 21, 2004; 165(6): 801 - 812. [Abstract] [Full Text] [PDF]

				P. L. Opresko, W.-H. Cheng, and V. A. Bohr Junction of RecQ Helicase Biochemistry and Human Disease J. Biol. Chem., April 30, 2004; 279(18): 18099 - 18102. [Full Text] [PDF]

				S. Sharma, J. A. Sommers, L. Wu, V. A. Bohr, I. D. Hickson, and R. M. Brosh Jr. Stimulation of Flap Endonuclease-1 by the Bloom's Syndrome Protein J. Biol. Chem., March 12, 2004; 279(11): 9847 - 9856. [Abstract] [Full Text] [PDF]

				S.-X. Dou, P.-Y. Wang, H. Q. Xu, and X. G. Xi The DNA Binding Properties of the Escherichia coli RecQ Helicase J. Biol. Chem., February 20, 2004; 279(8): 6354 - 6363. [Abstract] [Full Text] [PDF]

				J. P. Braybrooke, J.-L. Li, L. Wu, F. Caple, F. E. Benson, and I. D. Hickson Functional Interaction between the Bloom's Syndrome Helicase and the RAD51 Paralog, RAD51L3 (RAD51D) J. Biol. Chem., November 28, 2003; 278(48): 48357 - 48366. [Abstract] [Full Text] [PDF]

				R. Onclercq-Delic, P. Calsou, C. Delteil, B. Salles, D. Papadopoulo, and M. Amor-Gueret Possible anti-recombinogenic role of Bloom's syndrome helicase in double-strand break processing Nucleic Acids Res., November 1, 2003; 31(21): 6272 - 6282. [Abstract] [Full Text] [PDF]

				J.-P. Laine, P. L. Opresko, F. E. Indig, J. A. Harrigan, C. von Kobbe, and V. A. Bohr Werner Protein Stimulates Topoisomerase I DNA Relaxation Activity Cancer Res., November 1, 2003; 63(21): 7136 - 7146. [Abstract] [Full Text] [PDF]

				F. G. Harmon, J. P. Brockman, and S. C. Kowalczykowski RecQ Helicase Stimulates Both DNA Catenation and Changes in DNA Topology by Topoisomerase III J. Biol. Chem., October 24, 2003; 278(43): 42668 - 42678. [Abstract] [Full Text] [PDF]

This Article Abstract Print PDF (160K) Alert me when this article is cited Alert me if a correction is posted Services Email this article to a friend Similar articles in this journal Similar articles in ISI Web of Science Similar articles in PubMed Alert me to new issues of the journal Add to My Personal Archive Download to citation manager Search for citing articles in: ISI Web of Science (36) Request Permissions Commercial Re-use Guidelines for Open Access NAR Content Google Scholar Articles by Wu, L. Articles by Hickson, I. D. Search for Related Content PubMed PubMed Citation Articles by Wu, L. Articles by Hickson, I. D. Social Bookmarking          What's this?

Online ISSN 1362-4962 - Print ISSN 0305-1048

Copyright © 2009 Oxford University Press

Oxford Journals Oxford University Press

• Site Map
• Privacy Policy
• Frequently Asked Questions

Other Oxford University Press sites: Oxford University Press Oxford Journals China Oxford Journals Japan American National Biography Booksellers' Information Service Children's Fiction and Poetry Children's Reference Corporate & Special Sales Dictionaries Dictionary of National Biography Digital Reference English Language Teaching Higher Education Textbooks Humanities International Education Unit Law Medicine Music Online Products Oxford English Dictionary Reference Rights and Permissions Science School Books Social Sciences Very Short Introductions World's Classics