Nucleic Acids Research, 2002, Vol. 30, No. 4 975-982
© 2002 Oxford University Press
c-Maf, the
D-crystallin Maf-responsive element and growth factor regulation
Department of Biochemistry, University of Nijmegen, Nijmegen, The Netherlands
Received October 19, 2001; Revised and Accepted December 6, 2001.
| ABSTRACT |
|---|
|
|
|---|
The transcription factor c-Maf has been suggested to regulate the activity of
-crystallin promoters in lens fibre cells. We here show that the transactivation potential of c-Maf and MafB for the rat
D-crystallin Maf-responsive element (
D MARE) is dependent upon the cellular context and, using chimeric and single domain mutants, that c-Maf is most likely to be the cognate factor for the
D MARE in the lens. Transactivation of the
D MARE by c-Maf in lens cells was not enhanced by c-Fos or c-Jun and was not blocked by dominant negative c-Fos or c-Jun constructs. c-Maf can activate the
D MARE as a homodimer since activation of the
D-crystallin promoter in P19 embryonic carcinoma cells required only c-Maf, but none of a number of c-Fos and c-Jun family members tested. Transactivation by c-Maf was inhibited by activation of protein kinase A (PKA) (by signal transduction agonist forskolin) or of protein kinase C (PKC) (by signal transduction agonist tetradecanoyl phorbol acetate). Site-directed mutagenesis showed that this effect is not mediated by phosphorylation of the consensus PKA/PKC site in the extended DNA-binding domain, but likely involves activation of MAP kinase kinase, as inhibition by PD98059 increased transactivation by c-Maf. | INTRODUCTION |
|---|
|
|
|---|
The Maf transcription factors are a subclass of the family of bZIP factors. Maf proteins can be either small or large, the small ones lacking the activation domain present in the large proteins. Maf proteins act as homo- or heterodimers with a variety of factors, including members of the AP1 family (for reviews see 1,2), and bind to an extended tetradecanoyl phorbol acetate (TPA) response element (T-MARE) or extended cAMP response element (CRE) (C-MARE) (3,4). Maf proteins have been implicated in the control of development and differentiation, most recently in that of the lens. In the chicken and quail, a special large Maf (L-Maf or MafA) is found in lens and neural retina (5,6). Ectopic expression of L-Maf induces lentoid body formation (6). No mammalian homologue of L-Maf has as yet been isolated. Of the three Maf proteins detected in mammalian lenses, Nrl, c-Maf and MafB (7), the role of c-Maf has been most firmly established (810). The recent showing that c-Maf is up-regulated by Pax-6 ties c-Maf to the regulatory network specifying ocular development and differentiation (11). c-Maf knockout mice fail to develop fully formed lenses (810) and do not express most of the crystallin genes, i.e. the genes encoding the abundant water-soluble lens proteins. In agreement with this finding, putative MAREs have been detected in the crystallin promoters. For example, the promoters of the six rodent
-crystallin genes, the
A
F-crystallin genes, all contain a MARE
20 bp upstream from the TATA box (6,8,12). Hence, it has been suggested that c-Maf directly transactivates the
-crystallin promoters. However, as the
-crystallin genes are only active during terminal fibre cell differentiation (13,14), it cannot be excluded that the lack of
-crystallin gene expression in c-Maf knockout mice is due to incomplete fibre cell differentiation rather than to a direct effect on the activity of the
-crystallin gene promoter. We show here that the ability of MafB or c-Maf to transactivate the rat
D-crystallin promoter is dependent upon the cellular context and that in the lens fibre cell c-Maf indeed regulates the rat
D-crystallin promoter.
As the rat
D-crystallin promoter is only fully active in lens fibre cells cultured with FGF-2 or insulin (15), we also investigated whether c-Maf was involved in transmission of the growth factor signal to the
D-crystallin promoter. We here show that, unexpectedly, c-Maf activity is negatively regulated by common components of the signal transduction pathways: transactivation of the rat
D promoter decreased upon activation of the cAMP or protein kinase C (PKC) pathway. The mechanism of the latter inhibition does not involve phosphorylation of the consensus protein kinase A (PKA)/PKC site in the DNA-binding domain of c-Maf but appears to be transmitted through MAP kinase.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Cell culture and transfection
Lens epithelial cell explants were prepared from newborn rat lenses as previously described (12). Explants were cultured in M199 (Life Technologies) with 0.1% BSA and 25 ng/ml FGF-2 (a kind gift from Scios, Mountain View, CA) for 10 days to allow fibre cell differentiation to occur. Explants were transfected using the PDS-1000/He Biolistic Particle Delivery System (Bio-Rad) as described (12) using 1 µg DNA (0.8 µg reporter and expression constructs or empty vector, as indicated, and 0.2 µg CMVß-gal). Explants were harvested 3 days after transfection, lysed and assayed as described (12). Chloramphenicol acetyltransferase (CAT) activity was assayed using the Quan-T-CAT system (Amersham). Luciferase activity was determined using the Luciferase Assay System from Promega according to the manufacturers instructions. P19 cells were cultured in a 1:1 mixture of DMEM and F12 medium with 10% foetal calf serum. One hour before transfection, the medium was refreshed. Cells, in a 35 mm plate, were transfected with 1 µg DNA (0.4 µg reporter construct, 0.4 µg appropriate expression construct or empty vector and 0.2 µg CMVß-gal) using 3 µl of Fugene 6 under the conditions recommended by the manufacturer (Roche Boehringer). Cells were harvested 48 h after transfection and assayed for ß-galactosidase activity and CAT.
CHO-IR800 cells (CHO cells stably expressing the insulin receptor) were cultured in DMEM (Life Technologies) with 10% foetal calf serum. Cells were transfected as described above for P19 cells. The medium was changed to DMEM with 0.5% foetal calf serum 24 h after transfection and 8 h later the signal transduction (ant)agonists were added. After 32 h the cell density was determined by measuring cleavage of the tetrazolium salt WST-1 using the reagent supplied by Roche Boehringer. Cells were then harvested and ß-galactosidase and luciferase activities were assayed. All transfections were done in duplicate or triplicate; all data reported are the averages of at least three independent experiments in the case of explants and of at least two independent experiments in the case of P19 or CHO cells. Reporter gene activity was corrected for differences in transfection activity on the basis of the activity of the co-transfected CMVß-gal. In the case of CHO cells treated with (ant)agonists, transfection efficiencies were assumed to be equal and data were corrected for differences in cell density.
Reporter gene constructs
Most of the
D promoterCAT fusion genes used in this study have been previously described (12,16,17). The 73/+10
D promoterluciferase fusion gene was made by excising the promoter fragment from the corresponding CAT clone and inserting it in the polylinker of pGL3 (Promega). The Sox-binding site was mutated from TTTTGT to TGGATC using the oligo GCGGGCCCCTGGATCCCTGTTCCTGCCAAC and its complement and a QuikChange kit (Stratagene) according to the manufacturers instructions.
Trans-acting factor expression clones and mutants thereof
The expression clones for rat Maf-1 (MafB) and Maf-2 (c-Maf) were obtained from Dr M. Sakai. In these clones MafB or c-Maf expression is driven by the ß-actin promoter (7). For the c-Maf binding and dimerisation domain expression clone, the ß-actinc-Maf clone was digested with StuI (which cuts the sequence 7 nt upstream of the beginning of the extended DNA-binding domain) and BamHI (which cuts 3' of the insert). The StuIBamHI fragment was inserted into SmaI + BamHI-digested vector pAS2-1 (Clontech) to obtain an in-frame 5' NcoI site, and the NcoIBamHI fragment was then inserted in the NcoI + BamHI-digested ß-actin vector. The MafB single domain expression clones were made in a similar manner except that a SmaI site instead of the StuI site was used. The chimeric c-MafMafB clones were made by replacing the NcoIStuI fragment of c-Maf with the NcoISmaI fragment of MafB for the MafBc-Maf clone or, for the c-MafMafB clone, by replacing the StuIBamHI fragment of c-Maf with the SmaIBamHI fragment of MafB. In the construction of site-directed mutants, we encountered considerable problems with amplification of the c-Maf coding sequence, presumably because of the CG-rich repeated region encoding the stretch of glycines. Hence, for site-directed mutation of the putative phosphorylation sites, the 3'-part of c-Maf was first subcloned as a NotIXbaI fragment into pBluescript. The putative phosphorylation sites were then mutated using the QuikChange kit (Stratagene) with the following primers (only the sense sequence given): c-MafT291A, GAAGAGGCGGGCCCTGAAAAACC; c-MafT291D, GAAGAGGCGGGACCTGAAAAACC; c-MafY340F, GAAAGGGACGCCTCCAAGGAGAAATACG. The constructs were sequenced to confirm the presence of the desired mutations. The StuIXbaI mutated region was reinserted into the StuI + XbaI-digested ß-actinc-Maf expression vector.
EGFPc-Maf constructs
For the EGFPcMaf construct, the NcoIXbaI(blunt) c-Maf fragment was first inserted into NcoI + XhoI-digested vector pJGBR. c-Maf was excised from the recombinant as a BglIISalI fragment, which was inserted into BglII + XhoI-digested pEGFP-C1 (Clontech). For the EGFPc-Maf mutant constructs, the NotIBamHI fragment of the wild-type clone was replaced with corresponding fragments containing the desired mutations. Expression of properly sized fusion products was verified by western blotting of extracts of CHO cells transfected with the various EGFPc-Maf expression clones, using an anti-GFP antibody (Clontech).
The chicken L-Maf expression construct
The L-Maf coding sequence was amplified from chicken lens RNA using the forward primers ACAGCCCGACCTCACCCCATTGC and CCTCCATGGACTGAGATGGCCTCGGAG, with the reverse primers GAGGGAGGGGGTGGAAGGGGCATTG and GGGCTCACATGAAGAAGTCAGCGGCAG. The PCR product was cloned in pBluescript and sequenced. The cDNA clone obtained contained a D174G mutation, which was corrected by site-directed mutagenesis according to the QuikChange (Stratagene) procedure using the primer GGAGAGGTTTTCCGACGACCAGTTGGTG and its complement. The coding sequence was then cloned as a NcoIBamHI fragment in the ß-actin expression vector.
| RESULTS |
|---|
|
|
|---|
Transactivation of the rat
D promoter by MafB, c-Maf and L-MafThe mouse
F-crystallin promoter has been shown to be activated by c-Maf and L-Maf in non-lens cells (6,8). Similarly, the 73/+10 rat
D promoter is activated equally well in CHO cells by either MafB or c-Maf (Fig. 1A). When in vitro differentiating lens cells, which express the endogenous
-crystallin genes and in all respects resemble in vivo lens fibre cells, were used as transfection hosts, L-Maf did not activate the 73/+10
D promoter, while MafB did stimulate activity of the
D promoter, although not as well as c-Maf (Fig. 1B).
|
To determine whether the higher activity of c-Maf is due to its DNA-binding and dimerisation domain, to its activation domain or to both, chimeric MafBc-Maf constructs were made. The construct containing the MafB activation domain coupled to the c-Maf DNA-binding and dimerisation domain had the same low activity as MafB itself; the reverse chimera, with the c-Maf activation domain linked to the MafB DNA-binding and dimerisation domain, was completely inactive (Fig. 2). Hence, for optimal activation both the c-Maf activation domain and the DNA-binding and dimerisation domain are required.
|
These data show that c-Maf is an efficient activator of the
D promoter in the context of the lens fibre cell, however, they do not prove that c-Maf is the endogenous
D-activating factor. We therefore used a c-Maf mutant that inhibits activation by c-Maf (18). This mutant (c-Maf BD) contains only the DNA-binding and dimerisation domain and should compete with endogenous c-Maf for the MARE but cannot activate the
D promoter. Hence, if c-Maf is the endogenous cognate factor, the c-Maf BD mutant should inhibit activity. As shown in Figure 3, it does. As a control the comparable mutant of MafB (MafB BD) was also tested. This mutant does not inhibit activity of the 73/+10
DCAT construct, in agreement with the finding that MafB is a poor activator of the
D promoter (see Fig. 1B). We tested the effect of a c-Maf mutant containing only an activation domain (c-Maf AD) as well. This mutant also inhibited the activity of the 73/+10
DCAT construct (Fig. 3). The N-terminal domain could capture co-activating factors, thus quenching activity. As expected, co-transfection of the MafB activation domain had no effect on
D promoter activity (Fig. 3).
|
The role of AP1 factors in activation of the
D promoterc-Maf can act as a homodimer and can also heterodimerise with other Maf factors or with Fos family proteins, but not with Jun family proteins (19). We therefore tested the effect of co-transfection of both c-Maf and c-Fos on the activity of the
D promoter. As a control, similar experiments were performed using a c-Jun expression clone. No significant effect of co-expression of either c-Fos or c-Jun was found, showing that neither c-Fos nor c-Jun participates in activation of the
D promoter (Fig. 4A). To confirm these data, we co-transfected dominant negative c-Fos or c-Jun constructs (20). Neither of these constructs inhibited activity of the
DCAT construct (Fig. 4B). That these dominant negative constructs do inhibit the activity of a promoter with an AP1 site in the context of lens fibre cells was shown by testing the effect of the dominant negative expression constructs on the activity of the 73/+10
D(AP1) mutant promoter. In this mutant an AP1 site was created directly downstream of the MARE (such an apposition of a MARE and an AP1 site is found in the
B-crystallin gene promoter; 12). The
D(AP1) promoter was inhibited by
25% by the dominant negative c-Fos construct and by
50% by the dominant negative c-Jun construct.
|
The data presented in Figure 4 argue against an involvement of AP1 factors in MARE-directed activation of the
D promoter. However, recognition of the MARE by MafAP1 heterodimers is sequence dependent (4,19) and the possibility that the
D MARE requires an AP1-like factor other than c-Fos cannot be excluded. We therefore turned to P19 embryocarcinoma cells, which lack AP1 factors. The 73/+10
DCAT construct is inactive in P19 cells. Activity in these cells can be restored by co-transfection with the c-Maf expression vector (Fig. 5A). Co-transfection with c-Fos did not increase activity of the
D promoter further. The activity of a known target of c-Fos, a TRE, was stimulated under these conditions, as shown by increased activity of a TRECAT reporter. Hence, in the context of P19 cells, c-Maf does not cooperate with c-Fos in activation of the
D promoter. A number of other AP1 family members were tested (Fig. 5B): none stimulated activity and, indeed, the Jun family factors tended to inhibit activity of the 73/+10
DCAT construct when co-transfected with c-Maf. Why the Jun factors tend to inhibit c-Maf activity is not clear, since full-length c-Maf has been shown not to interact with Jun proteins (19), although the C-terminal domain of c-Maf and full-length v-Maf do interact with Jun (4,19).
|
The MARE suffices for growth factor response of the
D promoterProgression through fibre cell differentiation and sequential activation of the crystallin promoters requires continuous growth factor signalling, which can be provided by FGF-2 or insulin (21,22). The 73/+10
D promoter is also activated in the presence of FGF-2 (Fig. 6; note that promoter activity in the absence of FGF-2 is close to background and was not corrected for background). Previous mapping experiments have delineated three elements in the 73/+10 region: a Sox target site at 70/67 (23), the MARE at 57/46 and a positive acting element around 10 (12,17,24). Mutation of the Sox target site decreased promoter activity by 50% but did not affect the growth factor response (Fig. 6). To test the effect of the 10 element, we used a
D/F chimeric promoter, in which the region downstream of the
D TATA box is replaced with the corresponding region of the
F promoter, which lacks the 10 element (12). This
D/F chimeric promoter is less active than the
D promoter, as expected, but is still activated by FGF-2 (Fig. 6). Hence, the MARE must suffice for FGF-2 stimulation. As this element is absolutely required for promoter activity (12,17,25), the effect of mutating this element on FGF-2 stimulation cannot be tested.
|
In the absence of FGF-2, added c-Maf still stimulated the 73/+10
D promoter. The promoter activity reached in the absence of FGF-2 was the same as that reached in the presence of FGF-2 (Fig. 7), showing that excess c-Maf can compensate for the lack of growth factor signalling.
|
c-Maf and signal transduction
The data reported above strongly support the hypothesis that c-Maf activates the
D promoter as a homodimer, not a c-MafAP1 heterodimer. As the data in Figure 6 show that the c-Maf target sequence, the MARE, suffices for FGF-2 stimulation, this would imply that c-Maf is a target of FGF-2 signalling. We tested this hypothesis by determining whether the activity of c-Maf is affected by (ant)agonists of signal transduction pathways. For ease of manipulation, CHO cells were used in these experiments. CHO cells co-transfected with the
DCAT reporter construct and the c-Maf expression construct were treated either with the signal transduction agonists forskolin and TPA, which activate PKA and PKC, respectively, or the antagonists PD98059, an inhibitor of MAPK/ERK, and SB203580, an inhibitor of p38 MAPK and, at the concentration used here, of protein kinase B kinase (26). Treatment with forskolin strongly inhibited activation of the
D promoter by c-Maf, while treatment with TPA was also inhibitory, but to a lesser extent (Fig. 8). In contrast, inhibition of MAPK/ERK by PD98059 markedly increased the extent of activation by c-Maf; inhibition of p38 MAPK by SB203580 had no effect. In the absence of c-Maf, activity of the
D promoter was not affected by the (ant)agonists, but remained at background level.
|
The data presented in Figure 8 suggest that c-Maf activity is regulated negatively by the PKA, PKC and MAPK/ERK signalling cascades. A prosite scan of the c-Maf amino acid sequence identified several possible phosphorylation sites: six putative casein kinase II sites, three possible PKC sites, one of which overlapped with the single PKA site, and one tyrosine phosphorylation site. We decided to focus on two sites phosphorylation of which is likely to be inhibitory: the joint PKA/PKC site, which is located in the extended DNA-binding domain, and the tyrosine phosphorylation site, which is at the end of the dimerisation domain. The sequence of the putative PKA/PKC target site is KRRTLK (amino acids 288293). We mutated T291 either to alanine (c-MafT291A), thus preventing phosphorylation, or to aspartate (c-MafT291D), thereby mimicking phosphorylation. The putative tyrosine phosphorylation site of c-Maf is RLAKERDDLY (amino acids 332340). In the mutant c-MafY340F the tyrosine was mutated to phenylalanine. This mutant was consistently less active than the wild-type protein. The c-MafT291A mutant was almost as active as the wild-type protein, while the c-MafT291D mutant was essentially inactive (Fig. 8). To ensure that the mutations did not affect nuclear localisation of c-Maf, the mutant c-Maf coding sequences, as well as the wild-type c-Maf coding sequence, were fused to EGFP. The activities of the EGFPc-Maf fusion proteins were the same as that of the parental c-Maf (mutant) coding sequences (data not shown). Cellular localisation of the EGFPc-Maf fusion proteins was determined by confocal microscopy. All EGFPc-Maf fusion proteins accumulated in the nucleus. The EGFPc-MafY340F protein gave a more particulate pattern and frequently showed large aggregates, suggesting that the lower activity caused by this mutation may be due to aberrant proteinprotein interaction (data not shown). Possibly the leucine zipper is disturbed, even though the mutation is C-terminal to the region shown to be required in v-Maf for dimer formation (3,27).
The almost wild-type activity of the c-MafT291A mutant and the lack of activity of the c-MafT291D mutant is consistent with an inhibitory effect of PKA and/or PKC phosphorylation of T291. If so, the c-MafT291A mutant should be refractory to inhibition. To test this, CHO cells were co-transfected with a 73/+10
Dluciferase construct and the c-MafT291A expression construct and treated with forskolin, TPA, PD98059 or SB203580. The effect of these agents on activation of the
D promoter by c-MafT291A was essentially the same as that found for wild -type c-Maf: forskolin still caused a strong inhibition and TPA was also still inhibitory, while PD98059 still activated and SB203580 had no effect (Fig. 9). Hence, T291 is not a target of PKC or PKA. Similar experiments were performed with the c-MafY340F mutant: this mutant also responded as the wild-type protein to the (ant)agonists used (data not shown). These data suggest that the inhibitory phosphorylation sites could be located in the N-terminal domain. Attempts to mutate the N-terminal domain failed because we were unable to carry out PCR across the glycine repeat region of c-Maf, a problem also encountered by others (9).
|
| DISCUSSION |
|---|
|
|
|---|
The three large Maf proteins, MafB, c-Maf and L-Maf (or MafA), are closely related and all are capable of binding to and activating a rodent
-crystallin MARE in non-lens cells (Fig. 1; 6,8). However, as we show here, the transactivation potential of these proteins is severely constrained by the cellular context. In in vitro differentiating lens fibre cells, in which the endogenous
-crystallin genes are highly active and which contain all transcription factors involved in regulating activity of the
-crystallin promoters, c-Maf is a better transactivator than MafB, whereas L-Maf is virtually inactive. Hence, not only the sequence context but also other transcription factors binding in the vicinity, such as Sox in the case of the
D promoter, determine the specificity of a MARE. The constraints imposed by neighbouring transcription factors must also affect the binding affinity, as only the C-terminal domain of c-Maf and not that of MafB inhibited the endogenous transcription factor. Our data also show that the endogenous cognate transcription factor of the
D MARE is most likely c-Maf, in agreement with previous studies showing that c-Maf can activate the mouse
F promoter and that in transgenic mice lacking c-Maf the
-crystallins are absent (6,8,9).
The ability of c-Maf to transactivate the
D promoter independent of the cellular context and in the absence of AP1 factors suggests that c-Maf can transactivate the
D promoter as a homodimer, at least in non-lens cells. This suggestion is in agreement with the recognition site specificity of the c-Maf homodimer, of the c-Mafc-Fos heterodimer and of the c-Fosc-Jun heterodimer: the C found at the fourth position of the
D MARE (instead of the optimal T) abolishes recognition by c-Mafc-Fos and c-Fosc-Jun heterodimers, but not by a c-Maf homodimer (3,19).
Recently it was shown that MafA, the quail orthologue of chicken L-Maf, is only active in the phosphorylated form. One of the kinases responsible was found to be ERK2 (28). In contrast, we find that, under our experimental conditions, c-Maf is negatively regulated by stimulation of growth factor signalling pathways. In particular, blocking MEK1/2, and thus indirectly also ERK1/2, activates rather than silences c-Maf transactivation of the
D MARE. The strongly negative effect of forskolin, as well as the more modest effect of TPA, could also be mediated by MEK1/2, as MEK1/2 is downstream from PKA as well as PKC. Thus, our data suggest that c-Maf transmits a negative rather than a positive signal from a growth factor stimulus to the transcriptional apparatus. Our results do not rigorously exclude the possibility that the inhibitory effect of the activation of growth factor signalling pathways on the activity of c-Maf is due to competition for the MARE by other growth factors activated by the growth factor stimulus. However, we think this unlikely, as co-transfection of obvious candidates, the AP1 factors, does not inhibit activation by c-Maf, with the exception of JunD. One would then have to assume that the
D MARE is bound non-productively by a JunD complex, yet the slight deviation of the
D MARE sequence from the TRE consensus abolishes FosJun and JunJun recognition (3).
Our conclusion that the
D MARE is required for positive regulation of the
D promoter by FGF-2 seems completely at odds with our finding that c-Maf is negatively regulated by stimulation of growth factor signalling pathways. However, the effects of growth factor signalling on c-Maf were determined in non-lens cells, under conditions in which we suggest that c-Maf acts as a homodimer and activates the
D promoter in the absence of other factors. There is indirect evidence that c-Maf as part of a heterodimer can transmit a positive PKC or ras signal. c-Maf is known to be a partner of the transcription factor NF-ATc. Activation of NF-ATc-dependent transcription requires both a Ca2+ and a PKC or ras signal, with the latter signal being transmitted by the NF-ATc partner (29). A similar situation could exist in the lens, where other transcription factors cooperate or constrain c-Maf. Our previous mapping studies of the
-crystallin promoters have shown that in lens fibre cells the MARE is required but not sufficient for promoter activity (12,17; see also for example Fig. 6) and a consensus MARE does not activate the minimal ß-globin promoter in lens fibre cells (unpublished data). Hence, we think it likely that c-Maf acts as a heterodimer in the lens in vivo, with the heterodimeric partner modulating the growth factor response of c-Maf. Our data show that the putative c-Maf lens partner is not one of the common AP1 factors. However, other partners of the Maf transcription factors are known, such as members of the CREB family (1,2). CREB-2 is required for proper lens development (30,31), but the phenotype of CREB-2 knockout mice argues against a role for CREB-2 in
-crystallin gene expression. We favour the hypothesis that c-Maf has a lens-specific partner. A lens-specific partner for c-Maf could also explain why a pentamer of the mouse
F MARE directs expression of a hsp68lacZ reporter gene only in lens fibre cells and a subregion of the hindbrain in transgenic mice (25), even though c-Maf is widely expressed and is found, for example, in liver, spleen and kidney (7). Unfortunately, direct purification of a c-Maf complex from rat lenses is precluded by the excessive number of lenses required. The larger calf lenses are no alternative, as we have never been able to extract a factor binding to the
D MARE from calf lenses, possibly because of the age of the calves. Finally, a first attempt to select lens-specific partners of c-Maf by a two-hybrid screen failed due to the high intrinsic transcription activation by c-Maf in yeast. Further experimentation is required to overcome this problem.
| ACKNOWLEDGEMENTS |
|---|
The dominant negative c-Fos and c-Jun clones were given to us by Dr R. de Groot. The expression clones for the other Jun family members were originally made by Dr P. Angel and were obtained together with the clones for the other Fos family members from Dr A. Zantema. The CHO-IR800 cells were obtained from Dr J. A. Maassen. The financial support of the Netherlands Diabetes Foundation is gratefully acknowledged.
| FOOTNOTES |
|---|
* To whom correspondence should be addressed at: Biochemistry 161, NCMLS, PO Box 9101, 6500 HB Nijmegen, The Netherlands. Tel: +31 24 3616850; Fax: +31 24 3540525; Email: nhl{at}sci.kun.nl
| REFERENCES |
|---|
|
|
|---|
- Blank,V. and Andrews,N.C. (1997) The Maf transcription factors: regulators of differentiation. Trends Biochem. Sci., 22, 437441.[Web of Science][Medline]
-
Motohashi,H., Shavit,J.A., Igarashi,K., Yamamoto,M. and Engel,J.D. (1997) The world according to Maf. Nucleic Acids Res., 25, 29532959.
[Abstract/Free Full Text] -
Kataoka,K., Noda,M. and Nishizawa,M. (1994) Maf nuclear oncoprotein recognizes sequences related to an AP-1 site and forms heterodimers with both Fos and Jun. Mol. Cell. Biol., 14, 700712.
[Abstract/Free Full Text] - Kerppola,T.K. and Curran,T. (1994) Maf and Nrl can bind to AP-1 sites and form heterodimers with Fos and Jun. Oncogene, 9, 675684.[Web of Science][Medline]
- Benkhelifa,S., Provot,S., Lecoq,O., Pouponnot,C., Calothy,G. and Felder-Schmittbuhl,M.-P. (1998) MafA, a novel member of the maf proto-oncogene family, displays developmental regulation and mitogenic capacity in avian neuroretina cells. Oncogene, 17, 247254.[Web of Science][Medline]
-
Ogino,H. and Yasuda,K. (1998) Induction of lens differentiation by activation of a bZIP transcription factor, L-Maf. Science, 280, 115118.
[Abstract/Free Full Text] - Sakai,M., Imaki,J., Yoshida,K., Ogata,A., Matsushima-Hibaya,Y., Kuboki,Y., Nishizawa,M. and Nishi,S. (1997) Rat maf related genes: specific expression in chondrocytes, lens and spinal cord. Oncogene, 14, 745750.[Web of Science][Medline]
-
Kim,J.I., Li,T., Ho,I.C., Grusby,M.J. and Glimcher,L.H. (1999) Requirement for the c-Maf transcription factor in crystallin gene regulation and lens development. Proc. Natl Acad. Sci. USA, 96, 37813785.
[Abstract/Free Full Text] -
Kawauchi,S., Takahashi,S., Nakajima,O., Ogino,H., Morita,M., Nishizawa,M., Yasuda,K. and Yamamoto,M. (1999) Regulation of lens fiber cell differentiation by transcription factor c-Maf. J. Biol. Chem., 274, 1925419260.
[Abstract/Free Full Text] - Ring,B.Z., Cordes,S.P., Overbeek,P.A. and Barsh,G.S. (2000) Regulation of mouse lens fiber cell development and differentiation by the Maf gene. Development, 127, 307317.[Abstract]
-
Sakai,M., Serria,M.S., Ikeda,H., Yoshida,K., Imaki,J. and Nishi,S. (2001) Regulation of c-maf gene expression by Pax6 in cultured cells. Nucleic Acids Res., 29, 12281237.
[Abstract/Free Full Text] -
Klok,E.J., van Genesen,S.T., Civil,A., Schoenmakers,J.G.G. and Lubsen,N.H. (1998) Regulation of expression within a gene family. The case of the rat
B- and
D-crystallin promoters. J. Biol. Chem., 273, 1720617215.[Abstract/Free Full Text] -
McAvoy,J.W. (1978) Cell division, cell elongation and distribution of
-, ß- and
-crystallins in the rat lens. J. Embryol. Exp. Morphol., 44, 149165.[Web of Science][Medline]
- Van Leen,R.W., Breuer,M.L., Lubsen,N.H. and Schoenmakers,J.G.G. (1987) Developmental expression of crystallin genes: in situ hybridization reveals a differential localization of specific mRNAs. Dev. Biol., 123, 338345.[Web of Science][Medline]
- Peek,R., McAvoy,J.W., Lubsen,N.H. and Schoenmakers,J.G.G. (1992) Rise and fall of crystallin gene messenger levels during fibroblast growth factor induced terminal differentiation of lens cells. Dev. Biol., 152, 152160.[Web of Science][Medline]
-
Peek,R., van der Logt,P., Lubsen,N.H. and Schoenmakers,J.G.G. (1990) Tissue- and species-specific promoter elements of rat
-crystallin genes. Nucleic Acids Res., 18, 11891197.[Abstract/Free Full Text] -
Dirks,R.P.H., Klok,E.J., van Genesen,S.T., Schoenmakers,J.G.G. and Lubsen,N.H. (1996) The sequence of regulatory events controlling the expression of the
D-crystallin gene during fibroblast growth factor mediated rat lens fibre cell differentiation. Dev. Biol., 172, 1425.
- Doerwald,L., Nijveen,H., Civil,A., van Genesen,S.T. and Lubsen,N.H. (2001) Regulatory elements in the rat ßB2-crystallin promoter. Exp. Eye Res., 73, 703710.[Web of Science][Medline]
- Matsushima-Hibiya,Y., Nishi,S. and Sakai,M. (1998) Rat maf-related factors: the specificities of DNA binding and heterodimer formation. Biochem. Biophys. Res. Commun., 245, 412418.[Web of Science][Medline]
-
Ransone,L.J., Visvader,J., Wamsley,P. and Verma,I.M. (1990) Trans-dominant negative mutants of Fos and Jun. Proc. Natl Acad. Sci. USA, 87, 38063810.
[Abstract/Free Full Text] - Chamberlain,C.G., McAvoy,J.W. and Richardson,N.A. (1991) The effects of insulin and basic fibroblast growth factor on fibre differentiation in rat lens epithelial explants. Growth Factors, 4, 183188.[Medline]
- Leenders,W.P., van Genesen,S.T., Schoenmakers,J.G.G., van Zoelen,E.J.J. and Lubsen,N.H. (1997) Synergism between temporally distinct growth factors: bFGF, insulin and lens cell differentiation. Mech. Dev., 67, 193201.[Web of Science][Medline]
- Kamachi,Y., Sockanathan,S., Liu,Q., Breitman,M., Lovell-Badge,R. and Kondoh,H. (1995) Involvement of SOX proteins in lens-specific activation of crystallin genes. EMBO J., 14, 35103519.[Web of Science][Medline]
-
Peek,R., Kraft,H.J., Klok,E.J., Lubsen,N.H. and Schoenmakers,J.G.G. (1992) Activation and repression sequences determine the lens-specific expression of the rat
D-crystallin gene. Nucleic Acids Res., 20, 48654871.[Abstract/Free Full Text] -
Goring,D.R., Bryce,D.M., Tsui,L.-C., Breitman,M.L. and Liu,Q. (1993) Developmental regulation and cell type-specific expression of the murine
F-crystallin gene is mediated through a lens-specific element containing the
F-1 binding site. Dev. Dyn., 196, 143152.[Web of Science][Medline]
-
Lali,F.V., Hunt,A.E., Turner,S.J. and Foxwell,B.M. (2000) The pyridinyl imidazole inhibitor SB203580 blocks phosphoinositide-dependent protein kinase activity, protein kinase B phosphorylation and retinoblastoma hyperphosphorylation in interleukin-2-stimulated T cells independently of p38 mitogen-activated protein kinase. J. Biol. Chem., 275, 73957402.
[Abstract/Free Full Text] -
Kataoka,K., Nishizawa,M. and Kawai,S. (1993) Structurefunction analysis of the maf oncogene product, a member of the b-Zip protein family. J. Virol., 67, 21332141.
[Abstract/Free Full Text] -
Benkhelifa,S., Provot,S., Nabais,E., Eychene,A., Calothy,G. and Felder-Schmittbuhl,M.-P. (2001) Phosphorylation of MafA is essential for its transcriptional and biological properties. Mol. Cell. Biol., 21, 44414452.
[Abstract/Free Full Text] - Crabtree,G.R. (1999) Generic signals and specific outcomes: signaling through Ca2+, Calcineurin and NF-AT. Cell, 96, 611614.[Web of Science][Medline]
- Hettmann,T., Barton,K. and Leiden,J.M. (2000) Microphthalmia due to p53-mediated apoptosis of anterior lens epithelial cells in mice lacking the CREB-2 transcription factor. Dev. Biol., 222, 110123.[Web of Science][Medline]
-
Tanaka,T., Tsujimura,T., Takeda,K., Sugihara,A., Maekawa,A., Terada,N., Yoshida,N. and Akira,S. (1998) Targeted disruption of ATF4 discloses its essential role in the formation of eye lens fibres. Genes Cells, 3, 801810.[Abstract]
This article has been cited by other articles:
![]() |
S. Guo, R. Burnette, L. Zhao, N. L. Vanderford, V. Poitout, D. K. Hagman, E. Henderson, S. Ozcan, B. E. Wadzinski, and R. Stein The Stability and Transactivation Potential of the Mammalian MafA Transcription Factor Are Regulated by Serine 65 Phosphorylation J. Biol. Chem., January 9, 2009; 284(2): 759 - 765. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Perveen, J. Favor, R.V. Jamieson, D.W. Ray, and G.C.M. Black A heterozygous c-Maf transactivation domain mutation causes congenital cataract and enhances target gene activation Hum. Mol. Genet., May 1, 2007; 16(9): 1030 - 1038. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Cao, J. Liu, L. Song, and X. Ma The Protooncogene c-Maf Is an Essential Transcription Factor for IL-10 Gene Expression in Macrophages J. Immunol., March 15, 2005; 174(6): 3484 - 3492. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. Cui, S. I. Tomarev, J. Piatigorsky, A. B. Chepelinsky, and M. K. Duncan Mafs, Prox1, and Pax6 Can Regulate Chicken {beta}B1-Crystallin Gene Expression J. Biol. Chem., March 19, 2004; 279(12): 11088 - 11095. [Abstract] [Full Text] [PDF] |
||||
![]() |
T.-a. Matsuoka, L. Zhao, I. Artner, H. W. Jarrett, D. Friedman, A. Means, and R. Stein Members of the Large Maf Transcription Family Regulate Insulin Gene Transcription in Islet {beta} Cells Mol. Cell. Biol., September 1, 2003; 23(17): 6049 - 6062. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. E. Samaras, L. Zhao, A. Means, E. Henderson, T.-a. Matsuoka, and R. Stein The Islet beta Cell-enriched RIPE3b1/Maf Transcription Factor Regulates pdx-1 Expression J. Biol. Chem., March 28, 2003; 278(14): 12263 - 12270. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||












