Nucleic Acids Research, 2002, Vol. 30, No. 5 1103-1113
© 2002 Oxford University Press
SGS1 is a multicopy suppressor of srs2: functional overlap between DNA helicases
Department of Physiology, PO Box 147, University of Liverpool, Crown Street, Liverpool L69 3BX, UK
Received November 30, 2001; Revised and Accepted January 4, 2002.
| ABSTRACT |
|---|
|
|
|---|
Sgs1 is a member of the RecQ family of DNA helicases, which have been implicated in genomic stability, cancer and ageing. Srs2 is another DNA helicase that shares several phenotypic features with Sgs1 and double sgs1srs2 mutants have a severe synthetic growth phenotype. This suggests that there may be functional overlap between these two DNA helicases. Consistent with this idea, we found the srs2
mutant to have a similar genotoxin sensitivity profile and replicative lifespan to the sgs1
mutant. In order to directly test if Sgs1 and Srs2 are functionally interchangeable, the ability of high-copy SGS1 and SRS2 plasmids to complement the srs2
and sgs1
mutants was assessed. We report here that SGS1 is a multicopy suppressor of the methyl methanesulphonate (MMS) and hydroxyurea sensitivity of the srs2
mutant, whereas SRS2 overexpression had no complementing ability in the sgs1
mutant. Domains of Sgs1 directly required for processing MMS-induced DNA damage, most notably the helicase domain, are also required for complementation of the srs2
mutant. Although SGS1 overexpression was unable to rescue the shortened mean replicative lifespan of the srs2
mutant, maximum lifespan was significantly increased by multicopy SGS1. We conclude that Sgs1 is able to partially compensate for the loss of Srs2. | INTRODUCTION |
|---|
|
|
|---|
The ability of DNA helicases to unwind DNA enables replication, transcription, recombination and repair of DNA. The fundamental importance of DNA helicases is highlighted by a variety of human genetic disorders resulting from defective helicase function (1). Although the clinical features of these disorders differ, they all exhibit genomic instability and a predisposition to cancer. One class of DNA helicases, the RecQ family (named after its homology with the prototypical bacterial RecQ helicase), has attracted particular interest recently (2). Defects in three of the five known human RecQ family members manifest as Blooms syndrome (BLM) (3), RothmundThomson syndrome (RECQ4) (4) and Werners syndrome (WRN) (5). All three disorders show genomic instability associated with a predisposition to various cancers, while RothmundThomson syndrome and Werners syndrome display features of premature ageing. At the cellular level, cells from Werners syndrome sufferers display genomic translocations and deletions (6), and a decreased replicative lifespan in vitro (7, reviewed in 8). Cells from Blooms syndrome patients similarly exhibit chromosomal rearrangements and deletions, but are characterised by a uniquely high frequency of sister chromatid exchanges (reviewed in 9).
In order to shed light on how mutations in human RecQ helicases result in genomic instability, much recent attention has been directed at RecQ orthologues in lower organisms. The genomes of Escherichia coli, Saccharomyces cerevisiae and Schizosaccharomyces pombe each contain only a single predicted RecQ helicase, thus facilitating analysis of their cellular function(s). Mutations in E.coli recQ, S.cerevisiae SGS1 and S.pombe rqh1+ all result in increased recombination (1015), suggesting a conserved role of RecQ helicases in regulating recombination. Interestingly, the hyper-recombination phenotype of budding yeast sgs1 mutants can be complemented by the human WRN and BLM genes (12). In addition to the hyper-recombination phenotype, sgs1 mutants are sensitive to a range of genotoxins and display a reduced replicative lifespan (defined as the number of buds produced by a mother cell) (12,1624). The human BLM gene has been shown to complement the hydroxyurea sensitivity (12) and short lifespan (22) of the sgs1 mutant, further reinforcing the notion of a conserved function of RecQ helicases. Current thinking suggests that this function may be the prevention of inappropriate recombination at stalled replication forks arising during S phase (25).
The S.cerevisiae SRS2 gene was discovered as a suppressor of the UV sensitivity of rad6 and rad18 mutants (26), and also independently in a genetic screen which isolated and characterised yeast hyper-recombination mutants (27). No obvious human homologue of Srs2 has yet been found, but the sequence of the SRS2 gene does show homology to the bacterial UvrD and Rep helicases (28) and an S.pombe orthologue has been identified recently (29). One function of Srs2 is to channel the repair of DNA lesions into the RAD6 post-replication repair pathway (30). In the absence of Srs2, DNA lesions are instead channelled into the RAD52 homologous recombination repair pathway (31). Srs2 has also been implicated in other DNA repair processes such as non-homologous end joining (32) and single-strand annealing (33).
Srs2 shares a number of interesting features with Sgs1. Both Sgs1 and Srs2 have been demonstrated to be 3'
5' DNA helicases in vitro (34,35). The SGS1 and SRS2 gene products are generally expressed at low abundance but are up-regulated during the S phase of the cell cycle, and both have been implicated in the intra-S checkpoint response (18,36,37). Furthermore, sgs1 and srs2 mutants have a hyper-recombination phenotype (13,27). Most recently, sgs1
and srs2
strains have both been shown to have a shortened replicative lifespan and a greater propensity to undergo terminal cell-cycle arrest as mitotic G2/M intermediates (38). Deletion of both the SGS1 and SRS2 genes causes a severe synthetic growth defect, with low cell viability and a high incidence of G2/M terminal cell-cycle arrest, which can be suppressed by deletion of genes involved in homologous recombination (20,38,39). This suggests that unrestrained recombination causes the poor growth of the sgs1srs2 double mutant and is consistent with the idea that Srs2, like Sgs1, may act to prevent inappropriate recombination at stalled replication forks.
It was initially proposed that the Sgs1 and Srs2 helicases perform redundant functions in DNA replication and RNA pol I transcription (40). However, the DNA replication and RNA pol I defects reported are in fact likely to be secondary consequences of unrestrained recombination (20). Nevertheless, the original suggestion of functional overlap between these two helicases (40) remains possible. Consistent with this idea, we found the srs2
mutant to have a similar genotoxin sensitivity profile and replicative lifespan to the sgs1
mutant. Moreover, increased gene dosage of SGS1 partially restored genotoxin resistance and increased the maximum lifespan in the srs2
mutant. This indicates that Sgs1 can partially compensate for the loss of Srs2.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Yeast strains and plasmids
Yeast strains and plasmids used in this study are described briefly in Table 1. The BY4743 strain was obtained from ATCC (Manassas, TN), and all other strains were obtained from Research Genetics (Groningen, The Netherlands). All deletion mutants were prepared by deletion module PCR using the Kan MX4 cassette (Saccharomyces Genome Deletion Project).
|
The pYES2 vector was obtained from Invitrogen (Groningen, The Netherlands). The pQE30 plasmid was obtained from Qiagen (Dorking, UK). The YCplac33 and YEplac195 vectors were gifts from Dr Alan Boyd (University of Edinburgh, Edinburgh, UK). The pNF3000 plasmid, which carries the RAD3 gene controlled by its endogenous promoter in the YEp24 vector, was generously provided by Drs Paula Fischaber and Errol Friedberg (University of Texas Southwestern Medical Center, Dallas, TX).
Plasmid construction
The YCplac33-SRS2 and YEplac195-SRS2 plasmids were constructed as follows. The 3525 bp SRS2 open reading frame (ORF) plus 610 bp upstream and 132 bp downstream was amplified from yeast genomic DNA (Promega, Southampton, UK) using the following primers: CATGAACCTGGATCCATATATAGAAATCGG (sense, BamHI site underlined) and CATTAAGGGTACCTAACACACCATCCACATTTC (antisense, KpnI site underlined). The PCR product was digested with BamHI and KpnI and ligated into BamHI/KpnI-digested YCplac33 and YEplac195 vectors. The pYES2-SRS2 plasmid was constructed by amplifying the 3.525 kb SRS2 ORF from YEplac195-SRS2 using the primers GGGAGGATCCATGTCGTCGAACAATGATCTTTG (sense, BamHI site underlined) and GAAACTCGAGCTAATCGATGACTATGATTTCAC (antisense, XhoI site underlined). The PCR product was digested with BamHI and XhoI and ligated into BamHI/XhoI-digested pYES2 vector.
The YEplac195-SGS1 and YEplac195-SGS1 K706
A constructs were made by subcloning the 4.8 kb SalI fragment containing the SGS1 gene from YCplac33-SGS1 and YCplac33-SGS1 K706
A (23) into SalI-digested YEplac195. The pYES2-SGS1 plasmid was constructed by amplifying the 4.344 kb SGS1 ORF from yeast genomic DNA using the following primers: GTACACACAAGGGATCCATGGTGACGAAGC (sense, BamHI site underlined) and TTTCCTCGAGTCACTTTCTTCCTCTGTAGT (antisense, XhoI site underlined). The PCR product was digested with BamHI and XhoI and ligated into BamHI/XhoI-digested pYES2 vector.
The pQE30-SGS1(1-400) plasmid was constructed as follows. The 1200 bp fragment of SGS1 was amplified from YCplac33-SGS1 using the following primers: GTACACACAAGGGATCCATGGTGACGAAGC (sense, BamHI site underlined) and TTCTTCTGGTACCACCTACGGATAATCGTC (antisense, KpnI site underlined). The PCR product was digested with BamHI and KpnI and ligated into BamHI/KpnI-digested pQE30 plasmid.
Construction of SGS1 mutant libraries
Initially, the YEplac195-SGS1 plasmid was modified to remove a NotI restriction site carried over from the original cloning vector. Transposon-based mutagenesis was then performed on this modified plasmid using the E::ZTM In-frame linker insertion kit (Cambio, Cambridge, UK). This utilises the Tn5 in vitro transposition system (41). Mutagenesis was performed in vitro by incubating 0.03 pmol of EZ::TN<NotI/KAN-3> transposon and plasmid DNA with 1 µl of Tn5 transposase enzyme at 37°C for 2 h. The reaction was then stopped and the reaction mixture transformed into XL1 Blue E.coli (Stratagene, Amsterdam, The Netherlands). All resultant Kan+ Amp+ colonies were pooled and grown up prior to plasmid DNA isolation. The KanR gene was spliced out by digesting the midiprep with NotI, leaving a 57-bp sequence at the site of transposon insertion. This sequence codes for a 19-amino acid read-through insertion, which maintains the reading frame and so avoids creation of truncation mutants. The NotI-cut plasmid was gel purified, re-ligated in vitro and re-transformed into XL1 Blue E.coli. The resulting Amp+ colonies were used to construct both the random mutational library and the methyl methanesulphonate (MMS) loss-of-function library.
For the random mutational library, 190 Amp+ colonies were selected at random and grown up individually. Of these, PCR analysis identified 80 colonies that contained plasmids harbouring the 57-bp insertion within the SGS1 gene. These colonies were individually grown up prior to isolation of their plasmid DNA. The position of transposon insertion was determined by digesting plasmid minipreps with SalI and NotI.
For the MMS loss-of-function library, all original Amp+ colonies harbouring transposon-mutagenised YEplac195-SGS1 were pooled and grown up. Their DNA was then isolated and transformed into the sgs1
mutant strain. Ura+ transformants (500) were then picked and patched individually onto 10 x 10 grids on SD-URA plates. Each plate also contained positive (sgs1
-YEplac195-SGS1) and negative (sgs1
-YEplac195) controls for comparison. Plates were incubated overnight at 30°C, and then replica plated onto plates containing 0.023% MMS and left for 2 days. Loss-of-function mutations (i.e. plasmids no longer able to rescue MMS sensitivity in the sgs1
strain) were identified on replica plates, and the corresponding colonies picked from the master plate. These were grown up, pooled and their DNA recovered and transformed into XL1 Blue E.coli. Forty-two Amp+ colonies were selected for further analysis of transposon insertion by restriction digest analysis. The remaining colonies were pooled, and their DNA isolated by midiprep.
Drug sensitivity plates
This was performed as described previously for sgs1
, using identical drug concentrations (23). For quantitation of strains grown on solid media supplemented with MMS, yeast strains were grown up in minimal media for 23 days at 30°C, diluted and then spread on solid media plates containing increasing doses of MMS. After 3 days, the percent viability of each strain was expressed as number of colonies obtained relative to that on the control (no MMS) plate. For quantitation of MMS sensitivity of strains in liquid media, yeast strains were grown to an OD600 of 0.50.6 before addition of 0.010.12% MMS for 60 min. Cells were washed in 10% sodium thiosulfate, diluted and spread onto solid media plates. After 3 days, the percent viability of each strain was expressed as number of colonies obtained relative to that obtained for the control samples.
Detection of Sgs1 and Srs2 by western blotting
Yeast extracts were prepared by bead-beating in 8 M-urea-containing 2D-gel extraction buffer (Bio-Rad, Hemel Hempstead, UK) and run on SDSpolyacrylamide gels prior to transfer onto nitrocellulose. Recombinant his-tagged Sgs1(1-400) protein was purified from E.coli transformed with the pQE30-SGS1(1-400) plasmid using Ni2+-NTA-agarose (Qiagen). The purified protein was then used for antibody production in rabbits by following a published method (42). The resulting Sgs1p 857 antiserum was then purified using protein GSepharose to yield the IgG fraction used for western blotting. The Srs2p (yA-19) and Sir2p (yN-19) goat polyclonal antibodies were obtained from Autogen Bioclear (Mile Elm, UK). All primary antibodies were routinely used at dilutions of 1:500. Immunoreactive bands were detected with peroxidase-conjugated secondary antisera and visualised using enhanced chemiluminescence.
Lifespan analysis
This was performed as described previously (23). Briefly, strains were grown at 30°C until they reached an OD600 of 0.61.0. One microlitre of culture was streaked onto plates and left at 30°C for 12 h. After this time, cell doublets were moved to uninhabited regions of the plate. When these budded again, (newly formed) virgin yeast cells were removed by micromanipulation to a new location. All future buds produced by these daughter cells were micromanipulated away, and catalogued. The plates were incubated at 30°C during working hours, and moved to 4°C overnight. Lifespan was defined as number of daughter cells removed from the mother cell. All lifespans were observed a minimum of twice.
Yeast transformation and DNA extraction
This was performed as described previously (23).
| RESULTS |
|---|
|
|
|---|
Deletion of the SGS1 gene in both haploid and diploid strains has been reported to result in a replicative lifespan of
40% that of isogenic wild-type strains (2224). To determine whether deletion of SRS2 has a similar effect, lifespan analysis was performed on srs2
and BY4743 (wild-type) isogenic diploid strains transformed with the empty YCplac33 vector (Fig. 1A). Both strains were transformed with YCplac33 to allow direct comparison with previous findings (23). The mean lifespan of the BY4743-YCplac33 strain was 16.0 ± 1.0 (n = 76), compared with 7.2 ± 0.9 (n = 38) for the srs2
-YCplac33 strain. The maximum lifespans recorded were 44 and 23, respectively. The short lifespan of the srs2
mutant observed is comparable with that of the isogenic diploid sgs1
-YCplac33 strain, which has a mean lifespan of 7.4 ± 0.8 (n = 32) and maximum of 16 (23). A similar magnitude of shortened replicative lifespan has recently been reported for the haploid sgs1
and srs2
strains (38). Therefore, deletion of SGS1 or SRS2 reduces the replicative lifespan to a similar extent in both haploid and diploid backgrounds.
|
We have previously characterised the sensitivity of the sgs1
mutant to MMS (DNA methylating agent), 4-NQO (causes bulky-base adducts and oxidative damage), hydroxyurea (DNA synthesis inhibitor), camptothecin (Type I topoisomerase inhibitor) and mitoxantrone (Type II topoisomerase inhibitor) (23). To assess the sensitivity of the srs2
mutant to these drugs, the diploid srs2
mutant was transformed with YCplac33 (empty vector) and YCplac33-SRS2 and compared with the BY4743 isogenic wild-type strain transformed with YCplac33. Various dilutions of srs2
-YCplac33, BY4743-YCplac33 and srs2
-YCplac33-SRS2 strains were grown on plates containing the above drugs (Fig. 1B). Similar to the sgs1
mutant, the srs2
-YCplac33 strain showed sensitivity to all DNA damaging agents tested. Transformed srs2
cells containing the YCplac33-SRS2 plasmid showed comparable drug sensitivity to the BY4743 wild-type strain under these conditions. The observation that plasmid-borne SRS2 can restore genotoxin resistance to isogenic wild-type levels thus confirms that deletion of the SRS2 gene is the sole defect in the srs2
mutant.
To assess the specificity of the drug sensitive phenotype of the sgs1
and srs2
strains, the MMS sensitivity of other yeast mutants lacking DNA helicases was assessed. The pif1
, rrm3
, yKU70
and yKU80
mutants were tested. Pif1 and Rrm3 are DNA helicases involved in regulating telomeric and mitochondrial DNA (reviewed in 43), and are also involved in the replication fork progression through the rDNA (44). The yKU70 and yKU80 gene products are involved in the repair of DNA double strand breaks (reviewed in 45) and physical and genetic interactions between RecQ helicases and Ku proteins have been demonstrated (46,47). It was found that the pif1
mutant showed a slight sensitivity to MMS, as compared with the isogenic wild-type strain. The rrm3
, yKU70
and yKU80
strains were not sensitive to MMS (results not shown). Therefore, MMS sensitivity appears to be a relatively specific phenotype for loss-of-function of either the Sgs1 or Srs2 helicases.
Based on the fact that either single mutant is viable, but the double mutant has a severe growth defect, it has been proposed that the Sgs1 and Srs2 helicases may be functionally redundant (40). We therefore reasoned that overexpression of either of these DNA helicases might compensate for loss of the other. To initially confirm overexpression, Sgs1 and Srs2 levels in vivo were assessed by western blotting. Protein was extracted from sgs1
-pYES2, sgs1
-pYES2-SGS1, srs2
-pYES2 and srs2
-pYES2-SRS2 cultures induced with galactose. Extracted protein samples were separated by SDSPAGE, western blotted and probed for either Sgs1 or Srs2. An
160 kDa band corresponding to Sgs1 was present in the sgs1
-pYES2-SGS1, but not sgs1
-pYES2, protein extract (Fig. 2A). Similarly, an
150 kDa band corresponding to Srs2 was present in the srs2
-pYES2-SRS2, but not srs2
-pYES2, protein extract (Fig. 2A). For a control, all samples were probed for Sir2p, which was equally present in all protein extracts.
|
Although expression of SGS1 or SRS2 from the galactose-inducible pYES2 vector resulted in detectable levels of Sgs1 or Srs2 protein, it was not possible to detect Sgs1 by western blotting when SGS1 was expressed under its own promoter from the YEplac195 vector. We therefore attempted to genetically verify the overexpression of Sgs1 from this plasmid. Sgs1 helicase activity has been postulated to produce a substrate that is deleterious unless resolved by Top3 (11,48). Sgs1 overexpression should therefore be more harmful in top3
mutants than in TOP3 strains. To test this, top3
mutant and isogenic wild-type control strains were transformed with both low-copy (YCplac33) and high-copy (YEplac195) SGS1 plasmids (Fig. 2B). Both strains gave viable Ura+ transformants when transformed with the YCplac33, YCplac33-SGS1, YEplac195 and YEplac195-SGS1 K706
A plasmids. However, transformation of both strains with YEplac195-SGS1 gave viable Ura+ transformants in the wild-type strain, but very few viable colonies with the top3
mutant. Therefore, expression of Sgs1 from the multicopy YEplac195 vector, but not the low-copy YCplac33 plasmid, was detrimental to the top3
mutant. This indicates that increased gene dosage of Sgs1 does indeed result in increased Sgs1 protein levels. Furthermore, the deleterious effects of higher Sgs1 levels in the top3
mutant required the helicase activity of Sgs1, consistent with the notion that the helicase activity of Sgs1 creates a substrate that Top3 resolves (11,48).
To assess if Sgs1 and Srs2 are functionally interchangeable, the ability of high-copy plasmids carrying SGS1 and SRS2 to rescue MMS sensitivity in the sgs1
and srs2
strains was assessed (Table 2). To control for non-specific effects of helicase overexpression, the high-copy pNF3000 plasmid carrying RAD3 (a 5'
3' DNA helicase involved in excision repair) (49) was also compared. As a further specificity control, the effects of these plasmids on the (slight) MMS sensitivity of the pif1
mutant were also investigated. High-copy plasmids encoding SRS2 (both YEplac195-SRS2 and pYES2-SRS2) were able to complement the MMS sensitivity of the srs2
mutant, but had no obvious beneficial effects in either the sgs1
or pif1
mutants. Rather, Srs2 overexpression was found to have a dominant negative effect on growth of sgs1
, pif1
and wild-type strains. High-copy vectors expressing SGS1 (YEplac195-SGS1 and pYES2-SGS1) were able to complement the MMS sensitivity of both the sgs1
and srs2
mutant, but not the pif1
mutant. Sgs1 helicase activity was essential for complementation as YEplac195-SGS1 K706
A (expressing a helicase-defective allele which has some complementing activity in the sgs1
mutant) (23,50) was not able to suppress the MMS sensitivity of the sgs1
or srs2
mutant. The pNF3000 plasmid was unable to rescue the MMS sensitivity of all three mutants tested, although this plasmid has been demonstrated previously to complement the UV sensitivity of a rad3-1 strain (49).
|
The ability of SGS1 to rescue the sensitivity of the srs2
mutant to MMS and hydroxyurea is shown in Figure 3A. This demonstrates that the ability of SGS1 to act as a multicopy suppressor of srs2
is not uniquely specific for sensitivity to DNA damaging agents, but is also seen for inhibitors of DNA replication. To quantify the SGS1 complementation of srs2
MMS sensitivity, srs2
-YEplac195-SGS1, srs2
-YEplac195 and BY4743-YEplac195 diploid strains were grown up, diluted and then spread onto plates containing increasing doses of MMS. After 3 days, the percent viability of each strain was expressed as number of colonies obtained relative to that on the control (no MMS) plate. It can be seen that at the 0.003% dose, where complete killing of srs2
-YEplac195 cells occurred, the YEplac195-SGS1 construct restored MMS resistance to
60% of that seen in the isogenic wild-type (Fig. 3B). A similar effect was observed when cells were exposed to MMS for 1 h before removal and inactivation of the drug (Fig. 3C). Under these conditions, overexpression of SGS1 restored viability to 3040% of wild-type levels at doses where complete killing of control srs2
-YEplac195 cells occurred.
|
Mutational analysis suggests that Sgs1 is a multifunctional protein, as mutant alleles of sgs1 have selective complementing ability in different phenotypic assays (17,21,23,51). We therefore set out to determine whether the domains of Sgs1 required for rescue of MMS sensitivity in the sgs1
mutant differ from those required for complementation of the srs2
mutant. In order to do this, we used in vitro transposon-scanning mutagenesis on the YEplac195-SGS1 plasmid to create two distinct libraries of sgs1 mutants containing in-frame 19-amino acid insertions (see Materials and Methods). The unselected mutational library was generated by individually growing up randomly chosen bacterial colonies and PCR screening for the presence of plasmids harbouring the 57-bp insertion within the SGS1 gene. Figure 4A shows the frequency and approximate location of in-frame transposon insertions in SGS1 in this library, which comprises 75 alleles. It can be seen that there is coverage of insertion events throughout the entire SGS1 gene with no obvious hotspots, suggesting that transposon insertion is basically random. To construct a library of sgs1 MMS loss-of-function plasmids (i.e. plasmids no longer able to rescue MMS sensitivity in the sgs1
strain), sgs1
cells were transformed with the entire original pool of transposon-mutagenised YEplac195-SGS1. Of the resulting Ura+ transformants, 500 were picked and grown up individually on 10 x 10 grids before replica plating onto MMS plates. One hundred colonies failed to grow on MMS plates; these were recovered from the master plate, and their pooled plasmid DNA isolated to create the MMS loss-of-function library. Restriction analysis of 42 alleles chosen at random from this library revealed a more restricted distribution of insertion events than in the unselected library (compare Fig. 4A and B). Most notably, there was a complete absence of insertions in the C-terminal 250 amino acids of Sgs1, a domain known to be dispensable for MMS resistance (17,51) (Fig. 4B).
|
To determine whether the same functional domains of SGS1 are also required for complementation of srs2
, the srs2
mutant was transformed with the MMS loss-of-function SGS1 library (more than 500 Ura+ transformants obtained). For a control, the srs2
mutant was also transformed with the unselected library of 75 transposon-mutagenised SGS1 plasmids characterised in Figure 4A (more than 200 Ura+ transformants obtained). Colonies were resuspended, diluted and spread on control (no MMS) and 0.0035% MMS plates (a dose at which the srs2
mutant fails to grow). For the unselected SGS1 plasmid library, 156 colonies were obtained in total, compared with 378 colonies obtained on the control (no MMS) plates. This verifies that insertion of the 57-bp linker sequence in the SGS1 gene is not detrimental per se. In contrast, for the MMS loss-of-function SGS1 plasmid library, none of the MMS loss-of-function plasmids (in the sgs1
background) could rescue MMS sensitivity in the srs2
mutant. Therefore, we conclude that the same domains of SGS1 are required to restore MMS resistance to both sgs1
and srs2
strains, suggesting that a common molecular mechanism of action underlies complementation in both mutants.
It has been reported that sensitivity to MMS is enhanced in diploid srs2
strains relative to haploids (28). This ploidy-specific phenotype has been interpreted as additional lethal recombination events occurring between homologous chromosomes as well as sister chromatids. We therefore set out to determine whether the ability of SGS1 to complement MMS sensitivity in the srs2
mutant is due to suppression of recombination between homologous chromosomes. Haploid sgs1
and srs2
strains were used for these studies and compared with the isogenic wild-type BY4741 strain. To directly compare any ploidy-specific phenotypes, both haploid and diploid BY4741, sgs1
and srs2
mutant strains were grown on plates ± MMS (Fig. 5A). As reported previously (28), the diploid srs2
strain was more MMS sensitive than the haploid srs2
strain. The observed MMS sensitivity of strains (in order of most MMS sensitive) was as follows: srs2
diploid > sgs1
haploid = sgs1
diploid > srs2
haploid > BY4741 haploid = BY4741 diploid.
|
To test for any ploidy-specific effects of Sgs1 and Srs2 overexpression, haploid strains transformed with YEplac195, YEplac195-SGS1, YEplac195-SGS1 K706
A or YEplac195-SRS2 were grown on plates ± MMS. Both the haploid sgs1
-YEplac195 and srs2
-YEplac195 strains were sensitive to 0.01% MMS, whereas BY4741-YEplac195 was unaffected at these doses (Fig. 5B). The ability of YEplac195-SGS1 (and not YEplac195-SGS1 K706
A) to suppress MMS sensitivity was reproducible in both the sgs1
and srs2
haploid strains. Similarly, YEplac195-SRS2 could rescue the MMS-sensitive phenotype of the haploid srs2
mutant, but again no beneficial effects in the sgs1
haploid were evident. This demonstrates that the ability of SGS1 to function as a multicopy suppressor of the srs2
mutant is not a ploidy-specific effect.
In addition to the MMS-sensitive phenotype, the ability of the YEplac195-SGS1 plasmid to rescue the shortened replicative lifespan of the srs2
mutant was investigated. Lifespan analysis was performed on the srs2
-YEplac195 and srs2
-YEplac195-SGS1 strains (Fig. 6). Average lifespans of the strains [expressed as mean number of buds removed ± standard error of the mean (SEM)] were 11.1 ± 1.2 (n = 37) for srs2
-YEplac195 and 13.3 ± 1.4 (n = 38) for srs2
-YEplac195-SGS1. The maximum lifespans recorded were 24 and 36, respectively. Although a Students t-test revealed there to be no significant difference between the mean lifespans, a
2 test on the 10% longest-lived subpopulations (52) revealed that Sgs1 overexpression caused a statistically significant increase in srs2
lifespan (P < 0.02).
|
| DISCUSSION |
|---|
|
|
|---|
Phenotypic overlap between sgs1
and srs2
mutantsMutant sgs1 and srs2 strains have been shown to exhibit hyper-recombination, defective intra-S checkpoint responses and shortened replicative lifespans (13,18,27,37,38). The sgs1
mutant is also known to be sensitive to a variety of genotoxic agents (12,16,17,19,23). We report here that the srs2
mutant is similarly sensitive to MMS, hydroxyurea, camptothecin, mitoxantrone and 4-NQO, reinforcing the phenotypic overlap with the sgs1
mutant. In addition to its genotoxin sensitivity, the sgs1
mutant has a shortened replicative lifespan (2224). We found that the srs2
mutant has a mean replicative lifespan
45% of that of the wild-type strain. This is comparable with the average lifespan recorded for the isogenic sgs1
mutant (43%) (23), revealing a similar magnitude of shortened lifespan for the diploid sgs1
and srs2
mutants.
These findings are in agreement with a recent report documenting the phenotypes of the haploid sgs1
and srs2
mutants (38). In that work, it was revealed that the previous characterisation of premature ageing in the sgs1 mutant as a phenocopy of normal ageing (24) was not entirely accurate. Instead, it was concluded that the short lifespan exhibited by both sgs1
and srs2
mutants was due to a combination of ageing-independent mitotic checkpoint arrest and accelerated normal ageing (38). To determine whether the increased G2/M checkpoint arrest phenotype was also apparent in our diploid strains, we followed the approach of McVey et al. (38) and re-analysed our lifespan data for incidence of terminally budded phenotypes. This analysis was performed blind as our lifespan studies were completed before publication of their report. The morphology of sgs1
and srs2
terminal phenotypes revealed a higher percentage of budded mitotic intermediates than that observed for the isogenic wild-type strain (data not shown), thus confirming the findings of McVey et al. (38). As the severe phenotype of sgs1srs2 double mutants can be suppressed by inactivation of Rad51, Rad52 or Rad57, it is likely that it results from unrestrained recombination (38), in keeping with the idea that both Sgs1 and Srs2 act to prevent such events during S phase.
Complementation of the srs2
mutant by SGS1
It has been suggested that the Sgs1 and Srs2 helicases may be functionally redundant, based on the fact that either single mutant is viable, but the double mutant has a severe growth defect (40). Although complete redundancy can be ruled out due to the abundance of phenotypes exhibited by each single mutant (see above), the similarities of these phenotypes are consistent with a degree of functional overlap. Our finding that SGS1 can function as a multicopy suppressor of the MMS and hydroxyurea sensitivity of the srs2
mutant provides direct support for this notion. In contrast, high-copy SRS2 was unable to complement genotoxin sensitivity of the sgs1
strain. One explanation of this finding is that Sgs1 performs some cellular function(s) that cannot be substituted by Srs2, despite the ability of Sgs1 to functionally replace Srs2. However, it is worth noting that, as reported previously (53), we found that higher levels of Srs2 caused detrimental effects in the wild-type strain.
Sgs1 is a large protein that, in addition to the RecQ helicase domain, has distinct domains required for interactions with Top2, Top3 and Rad51 (11,5457). Furthermore, mutant alleles of sgs1 have selective complementing ability in different phenotypic assays (17,23,50,51). Therefore, the domains of Sgs1 required for rescue of MMS sensitivity in the sgs1
background could potentially differ from those required for complementation of the srs2
mutant. To address this issue, we constructed libraries of SGS1 mutant plasmids containing small in-frame insertions. Unsurprisingly, a large proportion of loss-of-function mutants for MMS resistance in the sgs1
background contained transposon insertions in or around the helicase domain of SGS1. This is consistent with reports that the helicase activity of Sgs1 is required for dealing with MMS-induced DNA damage (17,21,23,51,58). Some insertions were also found N-terminal to the helicase domain, mapping close to the interaction sites for Top2 and Top3. This supports the observation that the N-terminus of Sgs1 is essential for MMS resistance (17). Interestingly, no MMS loss-of-function alleles mapped to the C-terminus of Sgs1, where the Rad51 interaction occurs (57). Again, this is consistent with reports that much of the C-terminus of Sgs1 (the final 254 amino acids) is dispensable for MMS resistance (17,51). It was found that none of these SGS1 loss-of-function plasmids tested could complement the srs2
mutant. Similarly, a point mutation causing inactivation of Sgs1 helicase activity (50) was unable to restore MMS resistance to the srs2
strain. This demonstrates that complementation of the srs2
mutant by high-copy SGS1 requires domains of Sgs1 that are directly involved in processing MMS-induced DNA lesions.
When SGS1 was over expressed in the srs2
mutant, no significant increase in the mean replicative lifespan was evident. This contrasts with the ability of SGS1 overexpression to suppress MMS sensitivity of the srs2
mutant. One possible reason for this is that other important roles of Srs2 may still be lacking and contribute to the shortened mean replicative lifespan of the srs2
mutant. Alternatively, the beneficial effects of SGS1 overexpression may be outweighed by detrimental effects associated with high levels of Sgs1. Several observations support the latter theory. First, SGS1 overexpression can increase the maximum lifespan of the srs2
mutant by 50%. Secondly, SGS1 overexpression has been reported to cause detrimental effects (18,24). Thirdly, srs2
cells over expressing SGS1 actually show an increase in terminally budded morphologies as compared with control srs2
mutants containing empty vector (data not shown). It is remarkable that high-copy SGS1 can extend maximum lifespan in the face of such deleterious effects.
Cellular functions of Sgs1 and Srs2
Proteins involved in recombinational repair (e.g. Rad52) and post-replication repair (e.g. Rad6 and Rad18) play important roles in processing DNA lesions induced by MMS, in an analogous manner to that proposed for the processing of UV-induced lesions (59). Srs2 is thought to channel lesions into post-replication repair pathways, whereas Sgs1 is thought to be more intimately involved in recombinational repair (2,57,60) (Fig. 7). The ability of Sgs1 overexpression to process MMS-induced DNA damage in the srs2
mutant implies that endogenous Sgs1 levels are normally limiting in the srs2
mutant. This effect of Sgs1 overexpression may be to increase the efficiency of Sgs1s normal physiological function(s), thereby reducing the requirement for Srs2-dependent repair pathways. Alternatively, it may be that Sgs1 is capable of directly replacing Srs2, by processing substrates that would normally be dealt with by Srs2.
|
A variety of data support the notion that the sgs1
and srs2
phenotypes are a consequence of unrestrained recombination (20). Consistent with this, mutations in the RAD51 or RAD52 genes can suppress the MMS sensitivity of the srs2
mutant (61), whereas overexpression of RAD51 or RAD52 enhances the MMS sensitivity of the srs2
mutant (62). Therefore, in the absence of Srs2, the Rad52-dependent recombination repair pathway is over-active (31), leading to aberrant processing of recombination intermediates and genomic instability (Fig. 7). However, it is worth noting that, in addition to its well-established anti-recombinase function, Srs2 has recently been claimed to promote recombination in some circumstances (63). The absence of Sgs1 would also be predicted to cause aberrant processing of recombination intermediates as not only are the later steps of the homologous recombination repair pathway impaired (57,64), but also aberrant recombination intermediates cannot be salvaged by Sgs1 (14). This model is consistent with observations that the synthetic growth defect in sgs1srs2 double mutants (40) can be rescued by mutation of genes involved in homologous recombination (20,38,39).
Although we favour the idea that Sgs1 overexpression rescues MMS sensitivity in the srs2
mutant by suppressing unrestrained recombination, it remains possible that the ability of Sgs1 overexpression to compensate for lack of Srs2 is unrelated to DNA recombination. This possibility is supported by the fact that inactivation of the homologous recombination pathway does not suppress the severe synthetic growth defects observed in the S.pombe srs2
rqh1
double mutant (29). Nevertheless, the fact that genetic interactions between SGS1/rqh1+ and SRS2 are evident in two such evolutionarily divergent species further supports the notion of functional overlap between these DNA helicases. It will be of interest to assess if overexpression of rqh1+ can rescue any phenotypes of the S.pombe srs2
mutant.
Wider implications of functional overlap between DNA helicases
These findings may have potentially important ramifications for studies of the human RecQ helicases. First, the physiological effects of overexpression of Sgs1 may warrant further characterisation, as higher levels of both the BLM and WRN helicases have been reported to exist in transformed cells and tumour cells, relative to those found in normal cells (65,66). Furthermore, the finding that RecQ helicases can show partial functional redundancy with other DNA repair pathways may be significant for the understanding of the functions of RecQ family members in maintenance of genomic stability. In addition to the functional overlap between Sgs1 and Srs2 demonstrated here, an extra copy of Ku70, a DNA repair helicase, can partially rescue the phenotypes of Drosophila lacking the RecQ helicase Dmblm (47). This functional overlap of DNA repair pathways implies that defects in human RecQ helicases would have more severe effects under conditions where the redundant pathways are limiting. This may be important in understanding the role of the human RecQ helicases in genomic stability, cancer and ageing.
| ACKNOWLEDGEMENTS |
|---|
We gratefully acknowledge Drs Paula Fischaber and Errol Friedberg for the generous gift of the pNF3000 plasmid. This work was supported by the Wellcome Trust in the form of Prize Studentships to H.W.M. and T.J.C.
| FOOTNOTES |
|---|
* To whom correspondence should be addressed. Tel: +44 151 794 5333; Fax: +44 151 794 5337; Email: amorgan{at}liv.ac.uk
| REFERENCES |
|---|
|
|
|---|
- van Brabant,A.J., Stan,R. and Ellis,N.A. (2000) DNA helicases, genomic instability and human genetic disease. Annu. Rev. Genomics Hum. Genet., 1, 409459.
- Chakraverty,R.K. and Hickson,I.D. (1999) Defending genomic integrity during DNA replication: a proposed role for RecQ family helicases. Bioessays, 21, 286294.[Web of Science][Medline]
- Ellis,N.A., Groden,J., Ye,T., Straughen,J., Lennon,D.J., Ciocci,S., Proytcheva,M. and German,J. (1995) The Blooms syndrome gene product is homologous to RecQ helicases. Cell, 83, 655666.[Web of Science][Medline]
- Kitao,S., Shimamoto,A., Goto,M., Miller,R.W., Smithson,W.A., Lindor,N.M. and Furuichi,Y. (1999) Mutations in RECQL4 cause a subset of cases of RothmundThomson syndrome. Nature Genet., 22, 8284.[Web of Science][Medline]
- Yu,C., Oshima,J., Fu,Y., Wijsman,E., Hisama,F., Alisch,R., Matthews,S., Nakura,J., Miki,T., Ouais,S., Martin,G.M., Mulligan,J. and Schellenberg,G.D. (1996) Positional cloning of the Werners syndrome gene. Science, 272, 258262.[Abstract]
-
Fukuchi,K., Martin,G.M. and Monnat,R.J. (1989) Mutator phenotype of Werner syndrome is characterized by extensive deletions. Proc. Natl Acad. Sci. USA, 86, 58935897.
[Abstract/Free Full Text] -
Faragher,R.G.A., Kill,I.R., Hunter,J.A.A., Pope,F.M., Tannock,C. and Shall,S. (1993) The gene responsible for Werner syndrome may be a cell division counting gene. Proc. Natl Acad. Sci. USA, 90, 1203012034.
[Abstract/Free Full Text] - Shen,J.-C. and Loeb,L.A. (2000) The Werner syndrome gene. Trends Genet., 16, 213220.[Web of Science][Medline]
- German,J. (1993) Bloom syndrome: a mendelian prototype of somatic mutational disease. Medicine, 72, 393406.[Medline]
-
Hanada,K., Ukita,T., Kohno,Y., Saito,K., Kato,J.-I. and Ikeda,H. (1997) RecQ DNA helicase is a suppressor of illegitimate recombination in Escherichia coli. Proc. Natl Acad. Sci. USA, 94, 38603865.
[Abstract/Free Full Text] -
Gangloff,S., McDonald,J.P., Bendixen,C., Lane,A. and Rothstein,R. (1994) The yeast type I topoisomerase Top3 interacts with Sgs1, a DNA helicase homolog: a potential eukaryotic reverse gyrase. Mol. Cell. Biol., 14, 83918398.
[Abstract/Free Full Text] -
Yamagata,K., Kato,J., Shimamoto,A., Goto,M., Furuichi,Y. and Ikeda,H. (1998) Blooms and Werners syndrome genes suppress hyperrecombination in yeast sgs1 mutant: implication for genomic instability in human diseases. Proc. Natl Acad. Sci. USA, 95, 87338738.
[Abstract/Free Full Text] - Watt,P.M., Hickson,I.D., Borts,R.H. and Louis,E.J. (1996) SGS1, a homologue of the Blooms and Werners syndrome genes, is required for maintenance of genome stability in Saccharomyces cerevisiae. Genetics, 144, 935945.[Abstract]
- Myung,K., Datta,A., Chen,C. and Kolodner,R.D. (2001) SGS1, the Saccharomyces cerevisiae homologue of BLM and WRN, suppresses genome instability and homeologous recombination. Nature Genet., 27, 113116.[Web of Science][Medline]
- Stewart,E., Riley Chapman,C., Al-Khodairy,F., Carr,A.M. and Enoch,T. (1997) rqh1+, a fission yeast gene related to the Blooms and Werners syndrome genes, is required for reversible S phase arrest. EMBO J., 16, 26822692.[Web of Science][Medline]
-
Kusano,K., Berres,M.E. and Engels,W.R. (1999) Evolution of the RECQ family of helicases: a Drosophila homolog, Dmblm, is similar to the human Bloom syndrome gene. Genetics, 151, 10271039.
[Abstract/Free Full Text] -
Mullen,J.R., Kaliraman,V. and Brill,S.J. (2000) Bipartite structure of the SGS1 DNA helicase in Saccharomyces cerevisiae. Genetics, 154, 11011114.
[Abstract/Free Full Text] -
Frei,C. and Gasser,S.M. (2000) The yeast Sgs1p helicase acts upstream of Rad53p in the DNA replication checkpoint and colocalizes with Rad53p in S-phase-specific foci. Genes Dev., 14, 8196.
[Abstract/Free Full Text] - Saffi,J., Pereira,V.R., Antonio,J. and Henriques,P. (2000) Importance of the Sgs1 helicase activity in DNA repair of Saccharomyces cerevisiae. Curr. Genet., 37, 7578.[Web of Science][Medline]
- Gangloff,S., Soustelle,C. and Fabre,F. (2000) Homologous recombination is responsible for cell death in the absence of the Sgs1 and Srs2 helicases. Nature Genet., 25, 192194.[Web of Science][Medline]
- Miyajima,A., Seki,M., Onoda,F., Shiratori,M., Odagiri,N., Ohta,K., Kikuchi,Y., Ohno,Y. and Enomoto,T. (2000) Sgs1 helicase activity is required for mitotic but apparently not for meiotic functions. Mol. Cell. Biol., 20, 63996409.
- Heo,S.-J., Tatebayashi,K., Ohsugi,I., Shimamoto,A., Furuichi,Y. and Ikeda,H. (1999) Blooms syndrome gene suppresses premature ageing caused by Sgs1 deficiency in yeast. Genes Cells, 4, 619625.[Abstract]
- Mankouri,H.W. and Morgan,A. (2001) The DNA helicase activity of yeast Sgs1p is essential for normal lifespan but not for resistance to topoisomerase inhibitors. Mech. Age. Dev., 122, 11091122.
-
Sinclair,D.A., Mills,K. and Guarente,L. (1997) Accelerated aging and nucleolar fragmentation in yeast sgs1 mutants. Science, 277, 13131316.
[Abstract/Free Full Text] -
Wu,L. and Hickson,I.D. (2001) DNA ends RecQ-uire attention. Science, 292, 229230.
[Free Full Text] -
Lawrence,C.W. and Christensen,R.B. (1979) Metabolic suppressors of trimethoprim and ultraviolet light sensitivities of Saccharomyces cerevisiae rad6 mutants. J. Bacteriol., 139, 866876.
[Abstract/Free Full Text] -
Aguilera,A. and Klein,H.L. (1988) Genetic control of intrachromosomal recombination in Saccharomyces cerevisiae. I. Isolation and genetic characterization of hyper-recombination mutations. Genetics, 119, 779790.
[Abstract/Free Full Text] -
Aboussekhra,A., Chanet,R., Zgaga,Z., Cassier-Chauvat,C., Heude,M. and Fabre,F. (1989) RADH, a gene of Saccharomyces cerevisiae encoding a putative DNA helicase involved in DNA repair. Characteristics of radH mutants and sequence of the gene. Nucleic Acids Res., 17, 72117219.
[Abstract/Free Full Text] -
Wang,S.-W., Goodwin,A., Hickson,I.D. and Norbury,C.J. (2001) Involvement of Schizosaccharomyces pombe Srs2 in cellular responses to DNA damage. Nucleic Acids Res., 29, 29632972.
[Abstract/Free Full Text] - Rong,L., Palladino,F., Aguilera,A. and Klein,H.L. (1991) The hyper-gene conversion hpr5-1 mutation of Saccharomyces cerevisiae is an allele of the SRS2/RADH gene. Genetics, 127, 7585.[Abstract]
- Schiestl,R.H., Prakash,L. and Prakash,S. (1990) The SRS2 suppressor of rad6 mutations of Saccharomyces cerevisiae acts by channeling DNA lesions into the RAD52 DNA repair pathway. Genetics, 124, 817831.[Abstract]
-
Hegde,V. and Klein,H. (2000) Requirement for the SRS2 DNA helicase gene in non-homologous end joining in yeast. Nucleic Acids Res., 28, 27792783.
[Abstract/Free Full Text] -
Sugawara,N., Ira,G. and Haber,J.E. (2000) DNA length dependence of the single-strand annealing pathway and the role of the Saccharomyces cerevisiae RAD59 in double-strand break repair. Mol. Cell. Biol., 20, 53005309.
[Abstract/Free Full Text] -
Rong,L. and Klein,H.L. (1993) Purification and characterisation of the SRS2 DNA helicase of the yeast Saccharomyces cerevisiae. J. Biol. Chem., 268, 12521259.
[Abstract/Free Full Text] -
Bennet,R.J., Sharp,J.A. and Wang,J.C. (1998) Purification and characterisation of the Sgs1 DNA helicase activity of Saccharomyces cerevisiae. J. Biol. Chem., 273, 96449650.
[Abstract/Free Full Text] - Heude,M., Chanet,R. and Fabre,F. (1995) Regulation of the Saccharomyces cerevisiae Srs2 helicase during the mitotic cell cycle, meiosis and after irridation. Mol. Gen. Genet., 248, 5968.[Web of Science][Medline]
- Liberi,G., Chiolo,I., Pellicioli,A., Lopes,M., Plevani,P., Muzi-Falconi,M. and Fioani,M. (2000) Srs2 DNA helicase is involved in checkpoint response and its regulation requires a functional Mec1-dependent pathway and Cdk1 activity. EMBO J., 19, 50275038.[Web of Science][Medline]
-
McVey,M., Kaeberlein,M., Tissenbaum,H.A. and Guarente,L. (2001) The short lifespan of Saccharomyces cerevisiae sgs1 and srs2 mutants is a composite of normal aging processes and mitotic arrest due to defective recombination. Genetics, 157, 15311542.
[Abstract/Free Full Text] -
Klein,H. (2001) Mutations in recombinational repair and in checkpoint control genes suppress the lethal combination of srs2 with other DNA repair genes in Saccharomyces cerevisiae. Genetics, 157, 557565.
[Abstract/Free Full Text] -
Lee,S.-K., Johnson,R.E., Yu,S.-L., Prakash,L. and Prakash,S. (1999) Requirement of yeast SGS1 and SRS2 genes for replication and transcription. Science, 286, 23392342.
[Abstract/Free Full Text] -
Goryshin,I.Y. and Reznikoff,W.S. (1998) Tn5 in vitro transposition. J. Biol. Chem., 273, 73677374.
[Abstract/Free Full Text] - Morgan,A. and Burgoyne,R.D. (1995) A role for soluble NSF attachment proteins (SNAPs) in regulated exocytosis in adrenal chromaffin cells. EMBO J., 14, 232239.[Web of Science][Medline]
- Bessler,J.B., Torres,J.Z. and Zakian,V.A. (2001) The Pif1p subfamily of helicases: region-specific DNA helicases? Trends Cell Biol., 11, 6065.[Web of Science][Medline]
- Ivessa,A.S., Zhou,J.-Q. and Zakian,V.A. (2000) The Saccharomyces cerevisiae Pif1p DNA helicase and highly related Rrm3p have opposite effects on replication fork progression in ribosomal DNA. Cell, 100, 479489.[Web of Science][Medline]
- Khanna,K.K. and Jackson,S.P. (2001) DNA double strand breaks: signaling, repair and the cancer connection. Nature Genet., 27, 247254.[Web of Science][Medline]
-
Cooper,M.P., Machwe,A., Orren,D.K., Brosh,R.M., Ramsden,D. and Bohr,V.A. (2000) Ku complex interacts with and stimulates the Werner protein. Genes Dev., 14, 907912.
[Abstract/Free Full Text] -
Kusano,K., Johnson-Schlitz,D.M. and Engels,W.R. (2001) Sterility of Drosophila with mutations in the Bloom syndrome gene-complementation by Ku70. Science, 291, 26002602.
[Abstract/Free Full Text] -
Chakraverty,R.J., Kearsey,J.M., Oakley,T.J., Grenon,M., De la Torre Ruiz,M.-A., Lowndes,N.F. and Hickson,I.D. (2001) Topoisomerase III acts upstream of Rad53p in the S-phase DNA damage checkpoint. Mol. Cell. Biol., 21, 71507162.
[Abstract/Free Full Text] -
Naumovski,L. and Friedberg,E.C. (1982) Molecular cloning of eucaryotic genes required for excision repair of UV-irridated DNA: isolation and partial characterisation of the RAD3 gene of Saccharomyces cerevisiae. J. Bacteriol., 152, 323331.
[Abstract/Free Full Text] - Lu,J., Mullen,J.R., Brill,S.J., Kleff,S., Romeo,A.M. and Sternglanz,R. (1996) Human homologues of yeast helicase. Nature, 383, 678679.[Web of Science][Medline]
- Miyajima,A., Seki,M., Onoda,F., Ui,A., Satoh,Y., Ohno,Y. and Enomoto,T. (2000) Different domains of Sgs1 are required for mitotic and meiotic functions. Genes Genet. Syst., 75, 319326.[Web of Science][Medline]
-
Egilmez,N.K. and Jazwinski,S.M. (1989) Evidence for the involvement of a cytoplasmic factor in the aging of the yeast Saccharomyces cerevisiae. J. Bacteriol., 171, 3742.
[Abstract/Free Full Text] - Kaytor,M.D., Nguyen,M. and Livingston,D.M. (1995) The complexity of the interaction between RAD52 and SRS2. Genetics, 140, 14411442.[Web of Science][Medline]
- Watt,P.M., Louis,E.J., Borts,R.H. and Hickson,I.D. (1995) Sgs1: a eukaryotic homolog of E.coli RecQ that interacts with topoisomerase II in vivo and is required for faithful chromosome segregation. Cell, 81, 253260.[Web of Science][Medline]
-
Bennett,R.J., Noirot-Gros,M.-F. and Wang,J.C. (2000) Interaction between yeast Sgs1 helicase and DNA topoisomerase III. J. Biol. Chem., 275, 2689826905.
[Abstract/Free Full Text] -
Fricke,W.M., Kaliraman,V. and Brill,S.J. (2001) Mapping the DNA topoisomerase III binding domain of the Sgs1 DNA helicase. J. Biol. Chem., 276, 88488855.
[Abstract/Free Full Text] -
Wu,L., Davies,S.L., Levitt,N.C. and Hickson,I.D. (2001) Potential role for the BLM helicase in recombinational repair via a conserved interaction with RAD51. J. Biol. Chem., 276, 1937519381.
[Abstract/Free Full Text] - Onoda,F., Seki,M., Miyajima,A. and Enomoto,T. (2000) Elevation of sister chromatid exchange in Saccharomyces cerevisiae sgs1 disruptants and the relevance of the disruptants as a system to evaluate mutations in the Blooms syndrome gene. Mutagen. Res., 459, 203209.
- Xiao,W., Chow,B.L. and Rathgeber,L. (1996) The repair of DNA methylation damage in Saccharomyces cerevisiae. Curr. Genet., 30, 461468.[Web of Science][Medline]
- Broomfield,S., Hryciw,T. and Xiao,W. (2001) DNA postreplication repair and mutagenesis in Saccharomyces cerevisiae. Mutagen. Res., 486, 167184.
- Chanet,R., Heude,M., Adjiri,A., Maloisel,L. and Fabre,F. (1996) Semidominant mutations in the yeast Rad51 protein and their relationship with the Srs2 helicase. Mol. Cell. Biol., 16, 47284789.
- Milne,G.T., Ho,T. and Weaver,D.T. (1995) Modulation of Saccharomyces cerevisiae DNA double-strand break repair by SRS2 and RAD51. Genetics, 139, 11891199.[Abstract]
- Friedl,A.A., Liefshitz,B., Steinlauf,R. and Kupiec,M. (2001) Deletion of the SRS2 gene suppresses elevated recombination and DNA damage sensitivity in rad5 and rad18 mutants of Saccharomyces cerevisiae. Mutagen. Res., 486, 137146.
- Onoda,F., Seki,M., Miyajima,A. and Enomoto,T. (2001) Involvement of SGS1 in DNA damage-induced heteroallelic recombination that requires RAD52 in Saccharomyces cerevisiae. Mol. Gen. Genet., 264, 702708.[Web of Science][Medline]
-
Shiratori,M., Sakamoto,S., Suzuki,N., Tokutake,Y., Kawabe,Y., Enomoto,T., Sugimoto,M., Goto,M., Matsumoto,T. and Furuichi,Y. (1999) Detection by epitope-defined monoclonal antibodies of Werner DNA helicases in the nucleoplasm and their upregulation by cell transformation and immortalization. J. Cell Biol., 144, 19.
[Abstract/Free Full Text] -
Turley,H., Wu,L., Canamero,M., Gatter,K.C. and Hickson,I.D. (2001) The distribution and expression of the Blooms syndrome gene product in normal and neoplastic human cells. Br. J. Cancer, 85, 261265.[Web of Science][Medline]
This article has been cited by other articles:
![]() |
G. A. Cromie, R. W. Hyppa, and G. R. Smith The Fission Yeast BLM Homolog Rqh1 Promotes Meiotic Recombination Genetics, July 1, 2008; 179(3): 1157 - 1167. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Branzei and M. Foiani RecQ helicases queuing with Srs2 to disrupt Rad51 filaments and suppress recombination Genes & Dev., December 1, 2007; 21(23): 3019 - 3026. [Full Text] [PDF] |
||||
![]() |
D. V. Bugreev, X. Yu, E. H. Egelman, and A. V. Mazin Novel pro- and anti-recombination activities of the Bloom's syndrome helicase Genes & Dev., December 1, 2007; 21(23): 3085 - 3094. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. S. Symington and W.-D. Heyer Some disassembly required: role of DNA translocases in the disruption of recombination intermediates and dead-end complexes Genes & Dev., September 15, 2006; 20(18): 2479 - 2486. [Full Text] [PDF] |
||||
![]() |
A. Kato and H. Inoue Growth Defect and Mutator Phenotypes of RecQ-Deficient Neurospora crassa Mutants Separately Result From Homologous Recombination and Nonhomologous End Joining During Repair of DNA Double-Strand Breaks Genetics, January 1, 2006; 172(1): 113 - 125. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Lundin, M. North, K. Erixon, K. Walters, D. Jenssen, A. S. H. Goldman, and T. Helleday Methyl methanesulfonate (MMS) produces heat-labile DNA damage but no detectable in vivo DNA double-strand breaks Nucleic Acids Res., July 11, 2005; 33(12): 3799 - 3811. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Suzuki, A. Kato, Y. Sakuraba, and H. Inoue Srs2 and RecQ homologs cooperate in mei-3-mediated homologous recombination repair of Neurospora crassa Nucleic Acids Res., March 30, 2005; 33(6): 1848 - 1858. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Liberi, G. Maffioletti, C. Lucca, I. Chiolo, A. Baryshnikova, C. Cotta-Ramusino, M. Lopes, A. Pellicioli, J. E. Haber, and M. Foiani Rad51-dependent DNA structures accumulate at damaged replication forks in sgs1 mutants defective in the yeast ortholog of BLM RecQ helicase Genes & Dev., February 1, 2005; 19(3): 339 - 350. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Bhattacharyya and R. S. Lahue Saccharomyces cerevisiae Srs2 DNA Helicase Selectively Blocks Expansions of Trinucleotide Repeats Mol. Cell. Biol., September 1, 2004; 24(17): 7324 - 7330. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Sugawara, T. Goldfarb, B. Studamire, E. Alani, and J. E. Haber Heteroduplex rejection during single-strand annealing requires Sgs1 helicase and mismatch repair proteins Msh2 and Msh6 but not Pms1 PNAS, June 22, 2004; 101(25): 9315 - 9320. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. L. Doe and M. C. Whitby The involvement of Srs2 in post-replication repair and homologous recombination in fission yeast Nucleic Acids Res., March 1, 2004; 32(4): 1480 - 1491. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Fabre, A. Chan, W.-D. Heyer, and S. Gangloff Alternate pathways involving Sgs1/Top3, Mus81/ Mms4, and Srs2 prevent formation of toxic recombination intermediates from single-stranded gaps created by DNA replication PNAS, December 24, 2002; 99(26): 16887 - 16892. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||











