Nucleic Acids Research, 2002, Vol. 30, No. 9 2068-2075
© 2002 Oxford University Press
Functional characterization of the interferon regulatory element in the enhancer 1 region of the hepatitis B virus genome
1Department of Cell Biology, The Scripps Research Institute, 10550 North Torrey Pines Road, La Jolla, CA 92037, USA and 2Viral Hepatitis Research Unit, West China Hospital, West China Medical School, Sichuan University, Guo Xue Xiang, No. 37, Chengdu, Sichuan 610041, Peoples Republic of China
Received December 13, 2001; Revised and Accepted March 7, 2002.
| ABSTRACT |
|---|
|
|
|---|
An interferon-stimulated response element (ISRE)/interferon regulatory element (IRE) spanning nucleotide coordinates 10911100 is present in the enhancer 1/X gene promoter region of the hepatitis B virus (HBV) genome. In the context of a minimal promoter element, the enhancer 1/X gene promoter ISRE/IRE was shown to be a functional regulatory site capable of mediating interferon
- (IFN
) and interferon-stimulated gene factor 3 (ISGF3)-specific transcriptional activation in transient transfection analysis. The enhancer 1/X gene promoter ISRE/IRE was also shown to mediate interferon regulatory factor (IRF) 1 and IRF7 activation of transcription from a minimal promoter construct. In contrast, IFN
and the IRFs had minimal effect on HBV transcription and replication in the context of the viral genome in cell culture. | INTRODUCTION |
|---|
|
|
|---|
Hepatitis B virus (HBV) is an enveloped virus associated with significant morbidity and mortality (1,2). HBV causes both acute and chronic liver disease. Chronic HBV infection is associated with liver cirrhosis and hepatocellular carcinoma (3,4). It is estimated that there are
300 000 000 chronic HBV carriers in the world. Current therapeutic interventions often fail to resolve the viral infection although they can improve the prognosis of the patients (58). A widely used therapeutic intervention is treatment with interferon
(IFN
) (611). IFN
therapy can reduce viral replication and liver damage associated with viral infection. The mechanisms of action of IFN
responsible for the improvement in the patients condition are poorly defined.
The genome of HBV is a partially double-stranded circular 3.2 kb DNA molecule. The DNA genome of the virus is transcribed in the nucleus of the hepatocyte to produce the 3.5, 2.4, 2.1 and 0.7 kb viral transcripts (2,12). The level of these transcripts are regulated by the enhancer 2/core promoter, the large surface antigen promoter, the major surface antigen promoter and the enhancer 1/X gene promoter, respectively (1315). The 3.5 kb pregenomic HBV transcript encodes the viral polymerase and the nucleocapsid or core polypeptide (16). The HBV polymerase binds to the packaging sequence (
) in the pregenomic RNA and this complex is encapsidated by core polypeptides to form an immature viral capsid (1719). The reverse transcriptase/DNA polymerase activity of the viral polymerase converts the pregenomic RNA into the partially double-stranded DNA genome present in the mature capsid (20). The mature capsid interacts with the surface antigen polypeptides and subsequently buds into the lumen of the endoplasmic reticulum as a virus particle (2123). Virions pass through the endoplasmic reticulum and Golgi apparatus prior to release from hepatocytes (12).
As the pregenomic RNA is the substrate for the generation of viral DNA replication intermediates, it is apparent that regulation of HBV transcription can directly influence synthesis of the virus (24). The presence of a sequence element in the enhancer 1/X gene promoter region with homology to an interferon-stimulated response element (ISRE) and an interferon regulatory element (IRE) suggested that IFN
might directly regulate HBV transcription and, consequently, HBV replication (2529). The relationship between IFN
and the activation of transcription mediated through ISRE/IRE sequences is complex. IFN
binds to the type 1 interferon receptor and activates the latent signal transducer and activator of transcription 1 (STAT1), STAT2 and interferon regulatory factor (IRF)9/p48/ISGF3
, which form a trimeric complex, the interferon-stimulated gene factor 3 (ISGF3). ISGF3 translocates into the nucleus where it binds to ISRE sequences and directly activates transcription of interferon-stimulated genes (ISG) (30). One of the target genes for ISGF3 is IRF7 (31). In addition, IFNß has been shown to stimulate IRF1 and IRF2 expression (32). Therefore, IFN
/ß can indirectly activate transcription of genes possessing IRE sequences in their enhancers and promoters. However, the similarity in the consensus sequences for ISGF3 and IRF binding can make it difficult to establish the relative importance of these transcription factors for transcriptional activation from promoters containing ISRE/IRE sequences (26,28,29).
Initial analysis suggested that IRF9/p48/ISGF3
was involved in the IFN
-induced suppression of HBV enhancer 1 activity (25). However, further studies suggested that IFN
suppressed viral replication by an indirect mechanism that did not involve the ISRE/IRE sequence in the HBV enhancer 1 region (27). In this study the functional properties of the HBV ISRE/IRE sequence in the enhancer 1 region were further characterized in cell culture. In the context of a minimal promoter, the HBV IRSE/IRE sequence was shown to mediate ISGF3- and IRF-mediated activation of transcription. In contrast, in the context of the viral genome, the HBV ISRE/IRE sequence was unable to mediate IFN
- or IRF-dependent modulation of transcription. This suggests that if HBV transcription and replication are directly regulated by IFN
and IRFs modulating enhancer 1 activity during a viral infection, this situation has not yet been reproduced in cell culture.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Plasmid constructs
The steps in cloning of the plasmid constructs used in the transfection experiments were performed by standard techniques (33). HBV DNA sequences in these constructs were derived from plasmid pCP10, which contains two copies of the HBV genome (subtype ayw) cloned into the EcoRI site of pBR322 (34). The firefly luciferase (LUC) reporter gene in these constructs was derived from plasmid p19DLUC (35). pHBVTATALUC was constructed by inserting a double-stranded oligonucleotide containing the large surface antigen promoter TATA-box element, produced by annealing the oligonucleotides CTATATTATATAAGAGAGAAGCT and TCTCTCTTATATAATATAGGTAC (spanning HBV coordinates 27732791), into the SacI and KpnI sites of p19DLUC in the same orientation as the TATA-box element occurs in the HBV genome (36). XpIRE(1)TATALUC, XpIRE(4)TATALUC, XpIREmut(4)TATALUC and ISG15-ISRE(3)TATALUC were made by inserting one to four copies (as indicated in the construct designation) of the XpIRE, XpIREmut and ISG15-ISRE double-stranded oligonucleotides into the unique SalI site of pHBVTATALUC. The oligonucleotide pairs used to generate the XpIRE, XpIREmut and ISG15-ISRE double-stranded oligonucleotides were TCGAGCAGGCTTTCACTTTCTCGC and TCGAGCGAGAAAGTGAAAGCCTGC (oligo XpIRE, HBV nucleotide coordinates 10841104), TCGAGCAGGCcTTtACcTTCTCGC and TCGAGCGAGAAgGTaAAgGCCTGC (oligo XpIREmut, mutated nucleotides in the HBV ISRE/IRE are indicated in lower case) and TCGAGCCTCGGGAAAGGGAAACCGAAACTGAA and TCGATTCAGTTTCGGTTTCCCTTTCCCGAGGC (oligo ISG15-ISRE, nucleotide sequence located between position 119 and 92 of the ISG15 promoter). The XpIRE double-stranded oligonucleotide spans the HBV enhancer 1/X gene promoter IRF-binding site (Fig. 1A; 25,27). The ISG15-ISRE double-stranded oligonucleotide spans the ISRE of interferon-stimulated gene 15 (ISG15) (37,38). The luciferase reporter gene constructs, ISG54LUC and p[(AAGTGA)4]5tk
(39)lucter, have been described previously (39,40). The ISG54LUC construct contains the hamster interferon-stimulated gene 54 (ISG54) promoter spanning 429 and +31 and controlling the level of expression of the luciferase reporter gene (39). The p[(AAGTGA)4]5tk
(39)lucter construct contains five copies of a synthetic IRE upstream of the herpes simplex virus minimal thymidine kinase promoter regulating the level of expression of the luciferase reporter gene (40).
|
The HBV DNA (4.1 kb) construct, containing 1.3 copies of the HBV genome, includes the viral sequence from nucleotide coordinates 10723182 plus 11990 (Fig. 1B). This plasmid was constructed by cloning the NsiIBglII HBV DNA fragment (nucleotide coordinates 10721990) into pUC13, generating pHBV(10721990). Subsequently, a complete copy of the 3.2 kb viral genome linearized at the NcoI site (nucleotide coordinates 13753182 plus 11374) was cloned into the unique NcoI site (HBV nucleotide coordinate 1374) of pHBV(10721990), generating the HBV DNA (4.1 kb) construct. The plasmid 4.1IREmut was derived by introducing clustered point mutations into the ISRE/IRE of the enhancer 1/X gene promoter in the HBV DNA (4.1 kb) construct using the Chameleon double-stranded, site-directed mutagenesis kit (Stratagene Cloning Systems, La Jolla, CA) according to the manufacturers instructions. The IREmut mutation converted the 10 nt ISRE/IRE sequence located between nucleotide coordinates 1091 and 1100 from GAAAGTGAAA to GAAgGTaAAg (Fig. 1A) but did not alter the HBV polymerase polypeptide sequence. The nucleotide substitutions introduced into the enhancer 1/X gene promoter construct were verified by dideoxynucleotide sequencing (41). Both enhancer 1/X gene promoter regions in the terminally redundant HBV DNA (4.1 kb) construct were mutated for this analysis.
The pCMVSTAT1
, pCMVSTAT2, pCMVISGF3
p48, pCMVIRF1, pCMVIRF2, pBPSRT1IRF3 and pCMVIRF7 vectors express STAT1, STAT2, IRF9/p48/ISGF3
, IRF1, IRF2, IRF3 and pIRF7 polypeptides from the human STAT1, human STAT2, human IRF9/p48/ISGF3
, human IRF1, human IRF2, mouse IRF3 and mouse IRF7 cDNAs, respectively, using the cytomegalovirus immediate early promoter (pCMV) (31,39,42).
Cells and transfections
The human hepatoma cell line HepG2 was grown in RPMI-1640 medium and 10% fetal bovine serum at 37°C in 5% CO2/air. Transfections using luciferase reporter gene constructs were performed as previously described (43,44), except that 6-well plates, containing
3 x 105 cells, were used. The transfected DNA mixture comprised 5 µg LUC plasmid and 0.25 µg pCMVß, which served as an internal control for transfection efficiency. pCMVß directs expression of the Escherichia coli ß-galactosidase (ß-gal) gene using the cytomegalovirus (CMV) immediate early promoter (Clontech Laboratories, Palo Alto, CA). When appropriate, the DNA mixture also included 0.5 µg STAT1, STAT2, IRF9/p48/ISGF3
, IRF1, IRF2, IRF3 and pIRF7 expression vectors, pCMVSTAT1
, pCMVSTAT2, pCMVISGF3
p48, pCMVIRF1, pCMVIRF2, pBPSRT1IRF3 and pCMVIRF7, respectively, or the control expression vector, pCMV (45). The DNA was removed 46 h after transfection and washed with 2 ml of medium. Fresh RPMI medium containing recombinant human IFN
(PBL Biomedical Laboratories, New Brunswick, NJ) at a final concentration of 1000 U/ml replaced the standard medium as required 10 h prior to harvesting cells. Serum-free DMEM containing poly(I)·poly(C) (Fluka Chemical Corp., NY) and DEAEdextran at final concentrations of 10 and 500 µg/ml, respectively, replaced the standard medium as required 10 h prior to harvesting cells. After 1 h the serum-free medium containing poly(I)·poly(C) was replaced with RPMI-1640 medium containing 10% fetal bovine serum. Cell extracts were prepared 4048 h after transfection. Cells were lysed in 150 µl of lysis buffer (0.1 M potassium phosphate, pH 7.8, 0.2% v/v Triton X-100) and the cell debris was pelleted by centrifugation for 2 min at 13 000 r.p.m. in an Eppendorf 5417C microcentrifuge with an F45-30-11 rotor. The supernatant was assayed for luciferase activity essentially as previously described (46) and for ß-galactosidase activity using a Galacto-Light kit (Tropix Inc.) as instructed by the manufacturer. The level of ß-galactosidase activity observed was not specifically affected by any of the exogenously expressed transciption factors. The luciferase activities were normalized to the level of ß-galactosidase activity in each transfection experiment.
Transfections for viral RNA and DNA analysis were performed as previously described (47) using 10 cm plates, containing
1 x 106 cells. DNA and RNA isolation was performed 3 days post-transfection. The transfected DNA mixture was composed of 10 µg HBV DNA (4.1 kb) plus 1.5 µg transcription factor expression vectors, pCMVIRF1, pCMVIRF2, pBPSRT1IRF3 and pCMVIRF7 (39,42). Controls were derived from cells transfected with HBV DNA (4.1 kb) and the pCMV expression vector lacking a transcription factor cDNA insert (45). Fresh RPMI medium containing recombinant human IFN
(PBL Biomedical Laboratories) at a final concentration of 1000 U/ml replaced the standard medium as required 10 h prior to harvesting cells.
Characterization of HBV transcripts and viral replication intermediates
Transfected cells from a single plate were divided equally and used for the preparation of total cellular RNA and viral DNA replication intermediates as described previously (48), with minor modifications. For RNA isolation (49) the cells were lysed in 1.8 ml of 25 mM sodium citrate, pH 7.0, 4 M guanidinium isothiocyanate, 0.5% (v/v) sarcosyl, 0.1 M 2-mercaptoethanol. After addition of 0.18 ml of 2 M sodium acetate, pH 4.0, the lysate was extracted with 1.8 ml of water-saturated phenol plus 0.36 ml of chloroform/isoamyl alcohol (49:1). After centrifugation for 30 min at 3000 r.p.m. in a Sorval RT6000 rotor, the aqueous layer was precipitated with 1.8 ml of isopropanol. The precipitate was resuspended in 0.3 ml of 25 mM sodium citrate, pH 7.0, 4 M guanidinium isothiocyanate, 0.5% (v/v) sarcosyl, 0.1 M 2-mercaptoethanol and precipitated with 0.6 ml of ethanol. After centrifugation for 20 min at 14 000 r.p.m. in an Eppendorf 5417C microcentrifuge with an F45-30-11 rotor, the precipitate was resuspended in 0.3 ml of 10 mM TrisHCl, pH 8.0, 5 mM EDTA, 0.1% (w/v) sodium lauryl sulfate and precipitated with 45 µl of 2 M sodium acetate plus 0.7 ml of ethanol.
For the isolation of viral DNA replication intermediates the cells were lysed in 0.4 ml of 100 mM TrisHCl, pH 8.0, 0.2% (v/v) NP40. The lysate was centrifuged for 1 min at 14 000 r.p.m. in an Eppendorf 5417C microcentrifuge with an F45-30-11 rotor to pellet the nuclei. The supernatant was adjusted to 6.75 mM magnesium acetate plus 200 µg/ml DNase I and incubated for 1 h at 37°C to remove the transfected plasmid DNA. The supernatant was readjusted to 100 mM NaCl, 10 mM EDTA, 0.8% (w/v) sodium lauryl sulfate, 1.6 mg/ml pronase and incubated for an additional 1 h at 37°C. The supernatant was extracted twice with phenol, precipitated with 2 vol of ethanol and resuspended in 100 µl of 10 mM TrisHCl, pH 8.0, 1 mM EDTA. RNA (northern) and DNA (Southern) filter hybridization analyses were performed using 10 µg total cellular RNA and 30 µl viral DNA replication intermediates, respectively, as described (33).
| RESULTS |
|---|
|
|
|---|
ISGF3 and IFN
activate transcription through the HBV enhancer 1 ISRE/IRE sequence in the context of a minimal promoterThe enhancer 1/X gene promoter ISRE/IRE sequence (Fig. 1A) was examined in the context of a minimal TATA-box element located upstream of the luciferase open reading frame (Fig. 2). These synthetic promoter constructs were tested for their transcriptional activity in the HepG2 cell line in the absence or presence of ectopic expression of STAT1, STAT2 and IRF9/p48/ISGF3
, which constitute the ISGF3 transcription factor. The level of transcription from the minimal promoter construct XpIRE(4)TATALUC, containing four copies of the enhancer 1/X gene promoter ISRE/IRE sequence, increased 4.7-fold in the presence of ectopic expression of ISGF3 (ratio of relative activities from Fig. 2, 1.21/0.26). Similarly, IFN
treatment, which activates endogenous ISGF3, increased the level of transcription from the XpIRE(4)TATALUC construct
9-fold (ratio of relative activities from Fig. 2, 2.27/0.26). The combined effect of ectopic expression of ISGF3 and IFN
treatment was approximately additive and resulted in a 13-fold increase in transcription (ratio of relative activities from Fig. 2, 3.42/0.26). Mutation of the enhancer 1/X gene promoter ISRE/IRE sequence in the construct XpIREmut(4)TATALUC completely inhibited activation of transcription from the minimal promoter by ectopic expression of ISGF3 or IFN
treatment (Fig. 2). Poly(I)·poly(C) failed to greatly modulate transcription from the XpIRE(4)TATALUC construct, suggesting that this treatment poorly activated transcription factors, including ISGF3 and IRFs, which mediate their effects on transcription through the ISRE/IRE sequence in these cells. The single copy of the enhancer 1/X gene promoter ISRE/IRE sequence present in the XpIRE(1)TATALUC construct failed to mediate ISGF3- or IFN
-dependent transcription, indicating that in the context of a minimal promoter multiple ISRE/IRE sequences are required for activation of transcription (Fig. 2). However, activation of transcription by ISGF3 or IFN
treatment demonstrates that the enhancer 1/X gene promoter ISRE/IRE sequence can act as an interferon-stimulated response element in the context of a minimal promoter element.
|
The ISG54LUC, ISG15-ISRE(3)TATALUC and p[(AAGTGA)4]5tk
(39)lucter constructs demonstrated similar, but somewhat greater, responsiveness to ectopic expression of ISGF3 and IFN
treatment, confirming that the enhancer 1/X gene promoter ISRE/IRE sequence can act as an interferon-stimulated response element in a manner similar to previously characterized ISRE/IRE-containing promoters (3740). These constructs also showed a 3-fold increase in transcription in response to poly(I)·poly(C) treatment, suggesting that this stimulus weakly activates transcription factors that can mediate their effects through ISRE/IRE sequences in HepG2 cells (Fig. 2). Similar results using these constructs were also obtained using Huh7 cells (data not shown).
IRF1 and IRF7 activate transcription through the HBV enhancer 1 ISRE/IRE sequence in the context of a minimal promoter
The enhancer 1/X gene promoter ISRE/IRE sequence (Fig. 1A) was examined in the context of a minimal TATA-box element located upstream of the luciferase open reading frame. These synthetic promoter constructs were tested for their transcriptional activities in the HepG2 cell line in the absence or presence of the ectopic expression of IRF1, IRF2, IRF3, IRF7 and IRF9/p48/ISGF3
(Fig. 3). The level of transcription from the minimal promoter construct XpIRE(4)TATALUC, containing four copies of the enhancer 1/X gene promoter ISRE/IRE sequence, was increased
25- and 220-fold in the presence of ectopic expression of IRF1 and IRF7, respectively (ratio of relative activities from Fig. 3, 6.06/0.23 and 52.05/0.23, respectively). IRF2, IRF3 and IRF9/p48/ISGF3g failed to alter the level of transcription from the XpIRE(4)TATALUC construct. Mutation of the enhancer 1/X gene promoter ISRE/IRE sequence in the construct XpIREmut(4)TATALUC completely inhibited activation of transcription from the minimal promoter by ectopic expression of IRF1 and IRF7 (Fig. 3). IRF1 and IRF7 activated transcription from the XpIRE(1)TATALUC construct 2- and 6-fold, respectively, demonstrating that modest transcriptional activation by these transcription factors was possible from a minimal promoter containing a single copy of the enhancer 1/X gene promoter ISRE/IRE sequence (ratio of relative activities from Fig. 3, 0.08/0.04 and 0.24/0.04, respectively). These results demonstrate that the enhancer 1/X gene promoter ISRE/IRE sequence is capable of mediating IRF-dependent transcriptional activation from a minimal promoter construct. The ISG54LUC, ISG15-ISRE(3)TATALUC and p[(AAGTGA)4]5tk
(39)lucter constructs demonstrated qualitatively similar responsiveness to ectopic expression of IRF1 and IRF7, confirming that the enhancer 1/X gene promoter ISRE/IRE sequence can act as an interferon regulatory element in a manner similar to previously characterized ISRE/IRE-containing promoters (3740). Similar results using these constructs were also obtained using Huh7 cells (data not shown).
|
The HBV enhancer 1 ISRE/IRE sequence does not influence HBV transcription and replication in the context of the viral genome
Using minimal promoter constructs, it was possible to demonstrate that the enhancer 1/X gene promoter ISRE/IRE sequence can mediate activation of transcription by IFN
and the transcription factors ISGF3, IRF1 and IRF7 (Figs 2 and 3). In contrast, reporter gene constructs containing the complete viral genome and utilizing the large surface antigen promoter (PS1pLUC), the major surface antigen promoter (SpLUC), the enhancer 1/X gene promoter (XpLUC) and the enhancer 2/core promoter (CpLUC) (35), respectively, failed to demonstrate any alteration in the level of transcription in response to treatment with IFN
or ectopic expression of IRF1 and IRF7 (data not shown). Similarly, viral transcription and replication derived from the HBV DNA (4.1 kb) construct (Fig. 1B) was not altered by treatment with IFN
or ectopic expression of IRF1 and IRF7 (Fig. 4). Mutation of the enhancer 1/X gene promoter ISRE/IRE sequence in the HBV DNA (4.1 kb) construct, generating the 4.1IREmut construct, reduced the level of the HBV 3.5 kb transcripts and viral replication intermediates 2 4-fold (Fig. 4). This indicated that this regulatory element contributes to the level of pregenomic RNA expression. As this region of the enhancer 1/X gene promoter has been reported to bind p53 and NF1 in addition to the IRF transcription factors (25,27,5052), it is reasonable that this element might contribute to the constitutive level of viral replication in HepG2 cells. However, it does not appear to be able to mediate ISGF3- or IRF-dependent alterations in viral transcription in the context of the viral genome (Fig. 4).
|
| DISCUSSION |
|---|
|
|
|---|
Chronic HBV infection is a serious health problem which is commonly treated with interferon therapy (7,8). IFN therapy suppresses viral replication and can relieve the clinical symptoms associated with HBV infection (7,8). However, IFN therapy does not efficiently resolve chronic HBV infections and the molecular mechanisms of IFN action contributing to the reduction in HBV replication are not well understood (7,8). In cell culture systems IFN generally reduces HBV transcription and replication to only a limited extent (27,5355). This suggests that the mechanism of inhibition of HBV replication observed in vivo may be more complex than those demonstrated in cell culture. This is supported by studies using HBV transgenic mice, where treatment with poly(I)·poly(C), which stimulates IFN synthesis, or direct administration of IFN results in significant inhibition of viral replication (56). In HBV transgenic mice inhibition of HBV DNA synthesis occurs in the absence of any major effect on viral transcription, suggesting that post-transcriptional mechanisms may be responsible for the reduction in viral replication (56). The mechanism of the putative post-transcriptional inhibition of viral replication is unknown.
In contrast to the proposed post-transcriptional inhibition of viral replication by IFN in HBV transgenic mice, it has been suggested that IFN might modulate HBV transcription directly by activating ISGF3 or members of the IRF family of transcription factors (25,27). The presence of an ISRE/IRE sequence in the enhancer 1/X gene promoter region of the HBV genome supports this contention (25,27). However, the effect of IFN treatment on the level of transcription from the HBV promoters using reporter gene constructs and greater-than-genome length HBV DNA constructs capable of supporting viral replication indicated that IFN has a relatively modest effect on viral transcription and replication (25,27). Our analysis supports this suggestion (Fig. 4). These observations do not appear to support the suggestion that the enhancer 1/X gene promoter ISRE/IRE sequence is a functionally important element capable of responding to IFN signaling in cell culture.
In this study the enhancer 1/X gene promoter ISRE/IRE sequence was also analyzed in the context of a minimal promoterreporter gene construct (Figs 2 and 3). This analysis demostrated that the enhancer 1/X gene promoter ISRE/IRE sequence was capable of responding to IFN treatment in HepG2 cells (Fig. 2). In addition, ectopic expression of ISGF3 also supported transcription from a minimal promoter construct containing the enhancer 1/X gene promoter ISRE/IRE sequence, indicating that IFN treatment probably mediated its effects by directly activating the ISGF3 transcription factor. The IRF1 and IRF7 transcription factors also increase transcription from the enhancer 1/X gene promoter ISRE/IRE sequence in the context of a minimal promoter element (Fig. 3). These findings support the previous observations that members of the IRF family of transcription factors can directly bind to the enhancer 1/X gene promoter ISRE/IRE sequence (25,27). However, it is noteworthy that IFN gene expression is activated by IRFs and interferon can activate IRF gene expression (31,32,57). The complex interplay between IFN expression, ISGF3 activation and IRF gene expression suggests that several of these transcription factors may modulate HBV gene expression in response to IFN treatment by interacting with the enhancer 1/X gene promoter ISRE/IRE sequence. It is possible that these interactions may play a role in modulating HBV replication in vivo during IFN therapy despite the absence of an effect of IFN on viral replication in cell culture.
| ACKNOWLEDGEMENTS |
|---|
We are grateful to Dr Stephen Goodbourn (University of London, London, UK) for the plasmid p[(AAGTGA)4]5tk
(39)lucter, Dr David E. Levy (New York University School of Medicine, New York, NY) for the plasmids ISG54LUC, pCMVSTAT1
, pCMVSTAT2, pCMVISGF3
p48, pBPSRT1IRF3 and pCMVIRF7, and Dr John Hiscott (McGill University, Montreal, Canada) for the plasmids pCMVIRF1 and pCMVIRF2. This work was supported by a post-doctoral fellowship from the West China University of Medical Sciences of the Peoples Republic of China to H.T. and Public Health Service Grant AI30070 from the National Institutes of Health.
| FOOTNOTES |
|---|
* To whom correspondence should be addressed. Tel: +1 858 784 8097; Fax: +1 858 784 2513; Email: mclach{at}scripps.edu
| REFERENCES |
|---|
|
|
|---|
- Ganem,D. (1982) Persistent infection of humans with hepatitis B virus: mechanisms and consequences. Rev. Infect. Dis., 4, 10261047.[Web of Science][Medline]
- Ganem,D. and Varmus,H.E. (1987) The molecular biology of the hepatitis B viruses. Annu. Rev. Biochem., 56, 651693.[Web of Science][Medline]
- Beasley,R.P., Hwang,L.-Y., Lin,C.-C. and Chien,C.-S. (1981) Hepatocellular carcinoma and hepatitis B virusa prospective study of 22707 men in Taiwan. Lancet, 2, 11291133.[Web of Science][Medline]
- Beasley,R.P. (1988) Hepatitis B virus: the major etiology of hepatocellular carcinoma. Cancer, 61, 19421956.[Web of Science][Medline]
-
Malik,A.H. and Lee,W.M. (2000) Chronic hepatitis B virus infection: treatment strategies for the next millennium. Ann. Intern. Med., 132, 723731.
[Abstract/Free Full Text] - Lin,O.S. and Keeffe,E.B. (2001) Current treatment strategies for chronic hepatitis B and C. Annu. Rev. Med., 52, 2949.[Web of Science][Medline]
-
Hoofnagle,J.H. and Di Bisceglie,A.M. (1997) The treatment of chronic viral hepatitis. N. Engl. J. Med., 336, 347356.
[Free Full Text] -
Niederau,C., Heintges,T., Lange,S., Goldmann,G., Niederau,C.M., Mohr,L. and Haussinger,D. (1996) Long-term follow-up of HBeAg-positive patients treated with interferon alfa for chronic hepatitis B. N. Engl. J. Med., 334, 14221427.
[Abstract/Free Full Text] - Krogsgaard,K., Bindslev,N., Christensen,E., Craxi,A., Schlichting,P., Schalm,S., Carreno,V., Trepo,C., Gerken,G., Thomas,H.C. et al. (1994) The treatment effect of alpha interferon in chronic hepatitis B is independent of pre-treatment variables. Results based on individual patient data from 10 clinical controlled trials. J. Hepatol., 21, 646655.[Web of Science][Medline]
- Narkewicz,M.R., Smith,D., Silverman,A., Vierling,J. and Sokol,R.J. (1995) Clearance of chronic hepatitis B virus infection in young children after alpha interferon treatment. J. Pediatr., 127, 815818.[Web of Science][Medline]
- Naoumov,N.V., Thomas,M.G., Mason,A.L., Chokshi,S., Bodicky,C.J., Farzaneh,F., Williams,R. and Perrillo,R.P. (1995) Genomic variations in the hepatitis B core gene: a possible factor influencing response to interferon alfa treatment. Gastroenterology, 108, 505514.[Web of Science][Medline]
- Raney,A.K. and McLachlan,A. (1991) In McLachlan,A. (ed.), Molecular Biology of the Hepatitis B Virus. CRC Press, Boca Raton, FL, pp. 137.
- Schaller,H. and Fischer,M. (1991) Transcriptional control of hepadnavirus gene expression. Curr. Top. Microbiol. Immunol., 168, 2139.[Web of Science][Medline]
- Yen,T.S.B. (1993) Regulation of hepatitis B virus gene expression. Semin. Virol., 4, 3342.
- Kosovsky,M.J., Qadri,I. and Siddiqui,A. (1998) In Koshy,R. and Caselmann,W.H. (eds), Hepatitis B Virus: Molecular Mechanisms in Disease and Novel Strategies for Therapy. Imperial College Press, London, UK, pp. 2150.
-
Ou,J.-H., Bao,H., Shih,C. and Tahara,S.M. (1990) Preferred translation of human hepatitis B virus polymerase from core protein- but not from precore protein-specific transcript. J. Virol., 64, 45784581.
[Abstract/Free Full Text] - Hirsch,R.C., Lavine,J.E., Chang,L.-J., Varmus,H.E. and Ganem,D. (1990) Polymerase gene products of hepatitis B viruses are required for genomic RNA packaging as well as for reverse transcription. Nature, 344, 552555.[Medline]
- Junker-Niepmann,M., Bartenschlager,R. and Schaller,H. (1990) A short cis-acting sequence is required for hepatitis B virus pregenome encapsidation and sufficient for packaging of foreign RNA. EMBO J., 9, 33893396.[Web of Science][Medline]
-
Bartenschlager,R., Junker-Niepmann,M. and Schaller,H. (1990) The P gene product of hepatitis B virus is required as a structural component for genomic RNA encapsidation. J. Virol., 64, 53245332.
[Abstract/Free Full Text] -
Will,H., Reiser,W., Weimer,T., Pfaff,E., Buscher,M., Sprengle,R., Cattaneo,R. and Schaller,H. (1987) Replication strategy of human hepatitis B virus. J. Virol., 61, 904911.
[Abstract/Free Full Text] - Yamada,G., Sakamoto,Y., Mizuno,M., Nishihara,T., Kobayashi,T., Takahashi,T. and Nagashima,H. (1982) Electron and immunoelectron microscopic study of Dane particle formation in chronic hepatitis B virus infection. Gastroenterology, 83, 348356.[Web of Science][Medline]
- Gerber,M.A., Sells,M.A., Chen,M.-L., Thung,S.N., Tabibzadeh,S.S., Hood,A. and Acs,G. (1988) Morphologic, immunohistochemical and ultrastructural studies of the production of hepatitis B virus in vitro. Lab. Invest., 59, 173180.[Web of Science][Medline]
- Kamimura,T., Yoshikawa,A., Ichida,F. and Sasaki,H. (1981) Electron microscopic studies of Dane particles in hepatocytes with special reference to intracellular development of Dane particles and their relation with HBeAg in serum. Hepatology, 1, 392397.[Web of Science][Medline]
-
Tang,H. and McLachlan,A. (2001) Transcriptional regulation of hepatitis B virus by nuclear hormone receptors is a critical determinant of viral tropism. Proc. Natl Acad. Sci. USA, 98, 18411846.
[Abstract/Free Full Text] -
Nakao,K., Nakata,K., Yamashita,M., Tamada,Y., Hamasaki,K., Ishikawa,H., Kato,Y., Eguchi,K. and Ishii,N. (1999) p48 (ISGF-3
) is involved in interferon-
-induced suppression of hepatitis B virus enhancer-1 activity. J. Biol. Chem., 274, 2807528078.[Abstract/Free Full Text] - Fujii,Y., Shimizu,T., Kusumoto,M., Kyogoku,Y., Taniguchi,T. and Hakoshima,T. (1999) Crystal structure of an IRF-DNA complex reveals novel DNA recognition and cooperative binding to a tandem repeat of core sequences. EMBO J., 18, 50285041.[Web of Science][Medline]
-
Rang,A., Heise,T. and Will,H. (2001) Lack of a role of the interferon-stimulated response element-like region in interferon
-induced suppression of hepatitis B virus in vitro. J. Biol. Chem., 276, 35313535.[Abstract/Free Full Text] -
Levy,D.E., Kessler,D.S., Pine,R., Reich,N. and Darnell,J.E.,Jr (1988) Interferon-induced nuclear factors that bind a shared promoter element correlate with positive and negative transcriptional control. Genes Dev., 2, 383393.
[Abstract/Free Full Text] -
Tanaka,N., Kawakami,T. and Taniguchi,T. (1993) Recognition DNA sequences of interferon regulatory factor 1 (IRF-1) and IRF-2, regulators of cell growth and the interferon system. Mol. Cell. Biol., 13, 45314538.
[Abstract/Free Full Text] -
Kessler,D.S., Veals,S.A., Fu,X.Y. and Levy,D.E. (1990) Interferon-alpha regulates nuclear translocation and DNA-binding affinity of ISGF3, a multimeric transcriptional activator. Genes Dev., 4, 17531765.
[Abstract/Free Full Text] - Marie,I., Durbin,J.E. and Levy,D.E. (1998) Differential viral induction of distinct interferon-alpha genes by positive feedback through interferon regulatory factor-7. EMBO J., 17, 66606669.[Web of Science][Medline]
- Harada,H., Fujita,T., Miyamoto,M., Kimura,Y., Maruyama,M., Furia,A., Miyata,T. and Taniguchi,T. (1989) Structurally similar but functionally distinct factors, IRF-1 and IRF-2, bind to the same regulatory elements of IFN and IFN-inducible genes. Cell, 58, 729739.[Web of Science][Medline]
- Sambrook,J., Fritsch,E.F. and Maniatis,T. (1989) Molecular Cloning: A Laboratory Manual, 2nd Edn. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.
-
Dubois,M.F., Pourcel,C., Rousset,S., Chany,C. and Tiollais,P. (1980) Excretion of hepatitis B surface antigen particles from mouse cells transformed with cloned viral DNA. Proc. Natl Acad. Sci. USA, 77, 45494553.
[Abstract/Free Full Text] -
Raney,A.K., Milich,D.R., Easton,A.J. and McLachlan,A. (1990) Differentiation specific transcriptional regulation of the hepatitis B virus large surface antigen gene in human hepatoma cell lines. J. Virol., 64, 23602368.
[Abstract/Free Full Text] -
Raney,A.K., Easton,A.J. and McLachlan,A. (1994) Characterization of the minimal elements of the hepatitis B virus large surface antigen promoter. J. Gen. Virol., 75, 26712679.
[Abstract/Free Full Text] - Wathelet,M.G., Lin,C.H., Parekh,B.S., Ronco,L.V., Howley,P.M. and Maniatis,T. (1998) Virus infection induces the assembly of coordinately activated transcription factors on the IFN-beta enhancer in vivo. Mol. Cell, 1, 507518.[Web of Science][Medline]
-
Reich,N., Evans,B., Levy,D., Fahey,D., Knight,E.,Jr and Darnell,J.E.,Jr (1987) Interferon-induced transcription of a gene encoding a 15-kDa protein depends on an upstream enhancer element. Proc. Natl Acad. Sci. USA, 84, 63946398.
[Abstract/Free Full Text] -
Bluyssen,H.A. and Levy,D.E. (1997) Stat2 is a transcriptional activator that requires sequence-specific contacts provided by stat1 and p48 for stable interaction with DNA. J. Biol. Chem., 272, 46004605.
[Abstract/Free Full Text] -
Whiteside,S.T., King,P. and Goodbourn,S. (1994) A truncated form of the IRF-2 transcription factor has the properties of a postinduction repressor of interferon-beta gene expression. J. Biol. Chem., 269, 2705927065.
[Abstract/Free Full Text] -
Sanger,F., Nicklen,S. and Coulson,A.R. (1977) DNA sequencing with chain-terminating inhibitors. Proc. Natl Acad. Sci. USA, 74, 54635467.
[Abstract/Free Full Text] -
Lin,R., Mustafa,A., Nguyen,H., Gewert,D. and Hiscott,J. (1994) Mutational analysis of interferon (IFN) regulatory factors 1 and 2. Effects on the induction of IFN-beta gene expression. J. Biol. Chem., 269, 1754217549.
[Abstract/Free Full Text] -
Sorge,J., Wright,D., Erdman,V.D. and Cutting,A.E. (1984) Amphotropic retrovirus vector system for human cell gene transfer. Mol. Cell. Biol., 4, 17301737.
[Abstract/Free Full Text] - Graham,F.L. and Van der Eb,A.J. (1973) A new technique for the assay of infectivity of human adenovirus 5 DNA. Virology, 52, 456467.[Web of Science][Medline]
- Raney,A.K., Johnson,J.L., Palmer,C.N.A. and McLachlan,A. (1997) Members of the nuclear receptor superfamily regulate transcription from the hepatitis B virus nucleocapsid promoter. J. Virol., 71, 10581071.[Abstract]
-
De Wet,J.R., Wood,K.V., DeLuca,M., Helinski,D.R. and Subramani,S. (1987) Firefly luciferase gene: structure and expression in mammalian cells. Mol. Cell. Biol., 7, 725737.
[Abstract/Free Full Text] -
McLachlan,A., Milich,D.R., Raney,A.K., Riggs,M.G., Hughes,J.L., Sorge,J. and Chisari,F.V. (1987) Expression of hepatitis B virus surface and core antigens: influences of pre-s and precore sequences. J. Virol., 61, 683692.
[Abstract/Free Full Text] -
Summers,J., Smith,P.M., Huang,M. and Yu,M. (1991) Morphogenetic and regulatory effects of mutations in the envelope proteins of an avian hepadnavirus. J. Virol., 65, 13101317.
[Abstract/Free Full Text] - Chomczynski,P. and Sacchi,N. (1987) Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal. Biochem., 162, 156159.[Web of Science][Medline]
-
Patel,N.U., Jameel,S., Isom,H. and Siddiqui,A. (1989) Interactions between nuclear factors and the hepatitis B virus enhancer. J. Virol., 63, 52935301.
[Abstract/Free Full Text] -
Ben-Levy,R., Faktor,O., Berger,I. and Shaul,Y. (1989) Cellular factors that interact with the hepatitis B virus enhancer. Mol. Cell. Biol., 9, 18041809.
[Abstract/Free Full Text] - Ori,A., Zauberman,A., Doitsh,G., Paran,N., Oren,M. and Shaul,Y. (1998) p53 binds and represses the HBV enhancer: an adjacent enhancer element can reverse the transcription effect of p53. EMBO J., 17, 544553.[Web of Science][Medline]
- Caselmann,W.H., Meyer,M., Scholz,S., Hofschneider,P.H. and Koshy,R. (1992) Type I interferons inhibit hepatitis B virus replication and induce hepatocellular gene expression in cultured liver cells. J. Infect. Dis., 166, 966971.[Web of Science][Medline]
- Rang,A., Günther,S. and Will,H. (1999) Effect of interferon alpha on hepatitis B virus replication and gene expression in transiently transfected human hepatoma cells. J. Hepatol., 31, 791799.[Web of Science][Medline]
-
Hayashi,Y. and Koike,K. (1989) Interferon inhibits hepatitis B virus replication in a stable expression system of transfected viral DNA. J. Virol., 63, 29362940.
[Abstract/Free Full Text] -
McClary,H., Koch,R., Chisari,F.V. and Guidotti,L.G. (2000) Relative sensitivity of hepatitis B virus and other hepatotropic viruses to the antiviral effects of cytokines. J. Virol., 74, 22552264.
[Abstract/Free Full Text] - Nguyen,H., Hiscott,J. and Pitha,P.M. (1997) The growing family of interferon regulatory factors. Cytokine Growth Factor Rev., 8, 293312.[Medline]
-
Siddiqui,A., Jameel,S. and Mapoles,J. (1987) Expression of the hepatitis B virus X gene in mammalian cells. Proc. Natl Acad. Sci. USA, 84, 25132517.
[Abstract/Free Full Text] -
Treinin,M. and Laub,O. (1987) Identification of a promoter element located upstream from the hepatitis B virus X gene. Mol. Cell. Biol., 7, 545548.
[Abstract/Free Full Text] - Hu,K.-Q. and Siddiqui,A. (1991) Regulation of the hepatitis B virus gene expression by the enhancer element I. Virology, 181, 721726.[Web of Science][Medline]
-
Landschulz,W.H., Johnson,P.F., Adashi,E.Y., Graves,B.J. and McKnight,S.L. (1988) Isolation of a recombinant copy of the gene encoding C/EBP. Genes Dev., 2, 786800.
[Abstract/Free Full Text] - Chen,M., Hieng,S., Qian,X., Costa,R. and Ou,J.H. (1994) Regulation of hepatitis B virus ENI activity by hepatocyte-enriched transcription factor HNF3. Virology, 205, 127132.[Web of Science][Medline]
- Ori,A. and Shaul,Y. (1995) Hepatitis B virus enhancer binds and is activated by the hepatocyte nuclear factor 3. Virology, 207, 98106.[Web of Science][Medline]
-
Garcia,A.D., Ostapchuk,P. and Hearing,P. (1993) Functional interaction of nuclear factors EF-C, HNF-4 and RXR
with hepatitis B virus enhancer I. J. Virol., 67, 39403950.[Abstract/Free Full Text] -
Huan,B. and Siddiqui,A. (1992) Retinoid X receptor RXR
binds to and trans-activates the hepatitis B virus enhancer. Proc. Natl Acad. Sci. USA, 89, 90599063.[Abstract/Free Full Text] -
Huan,B., Kosovsky,M.J. and Siddiqui,A. (1995) Retinoid X receptor
transactivates the hepatitis B virus enhancer 1 element by forming a heterodimeric complex with the peroxisome proliferator-activated receptor. J. Virol., 69, 547551.[Abstract]
-
Siegrist,C.A., Durand,B., Emery,P., David,E., Hearing,P., Mach,B. and Reith,W. (1993) RFX1 is identical to enhancer factor C and functions as a transactivator of the hepatitis B virus enhancer. Mol. Cell. Biol., 13, 63756384.
[Abstract/Free Full Text] -
Ostapchuk,P., Scheirle,G. and Hearing,P. (1989) Binding of nuclear factor EF-C to a functional domain of the hepatitis B virus enhancer region. Mol. Cell. Biol., 9, 27872797.
[Abstract/Free Full Text] -
Maguire,H.F., Hoeffler,J.P. and Siddiqui,A. (1991) HBV X protein alters the DNA binding specificity of CREB and ATF-2 by protein-protein interactions. Science, 252, 842844.
[Abstract/Free Full Text]
This article has been cited by other articles:
![]() |
S. L. Uprichard, S. F. Wieland, A. Althage, and F. V. Chisari Transcriptional and posttranscriptional control of hepatitis B virus gene expression PNAS, February 4, 2003; 100(3): 1310 - 1315. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||




