Nucleic Acids Research, 2003, Vol. 31, No. 15 4354-4360
© 2003 Oxford University Press
Intracellular mRNA cleavage by 3' tRNase under the direction of 2'-O-methyl RNA heptamers
Department of Biochemistry, Kagoshima University Dental School, Kagoshima, Kagoshima 890-8544, Japan, 1 Biological Function Division, National Food Research Institute, Tsukuba, Ibaraki 305-8642 Japan and 2 Department of Applied Life Sciences, Niigata University of Pharmacy and Applied Life Sciences, Niitsu, Niigata 956-8603, Japan
*To whom correspondence should be addressed at Department of Applied Life Sciences, Niigata University of Pharmacy and Applied Life Sciences, Higashijima 265-1, Niitsu, Niigata 956-8603, Japan. Tel: +81 250 25 5119; Fax: +81 250 25 5021; Email: mnashimoto{at}niigatayakudai.jp
Received May 12, 2003; Revised and Accepted June 5, 2003
| ABSTRACT |
|---|
|
|
|---|
Mammalian tRNA 3' processing endoribonuclease (3'-tRNase) can cleave any RNA at any site under the direction of small guide RNA (sgRNA) in vitro. sgRNAs can be as short as heptamers, which are much smaller than small interfering RNAs of
21 nt. Together with such flexibility in substrate recognition, the ubiquity and the constitutive expression of 3'-tRNase have suggested that this enzyme can be utilized for specific cleavage of cellular RNAs by introducing appropriate sgRNAs into living cells. Here we demonstrated that the expression of chloramphenicol acetyltransferase can be downregulated by an appropriate sgRNA which is introduced into MadinDarby canine kidney epithelial cells as an expression plasmid or a synthetic 2'-O-methyl RNA. We also showed that 2'-O-methyl RNA heptamers can attack luciferase mRNAs with a high specificity and induce 3'-tRNase-mediated knock-down of the mRNAs in 293 cells. Furthermore, the MTT cell viability assay suggested that an RNA heptamer can downregulate the endogenous Bcl-2 mRNA in Sarcoma 180 cells. This novel sgRNA/3'-tRNase strategy for destroying specific cellular RNAs may be utilized for therapeutic applications. | INTRODUCTION |
|---|
|
|
|---|
In mammalian cells, tRNA 3' processing endoribonuclease (3'-tRNase) is an essential enzyme to remove 3' trailers from pre-tRNAs (17). This enzyme is unique in that it possesses the property of being able to cleave any RNA at any site under the direction of small guide RNA (sgRNA) in vitro like an RNA-induced silencing complex underlying RNA interference (RNAi) (812). For instance, 3'-tRNase works as the 4-nt-recognizing RNA cutter RNase 65 by forming a complex with a 3'-truncated tRNA (8). Partial human immunodeficiency type 1 (HIV-1) RNA targets can be cleaved site specifically by the enzyme when the targets form pre-tRNA-like structures with the aid of appropriate 5'-half-tRNAs (9). Surprisingly, the enzyme can recognize a lin-4lin-14 RNA complex of Caenorhabditis elegans and cleave the lin-14 mRNA, although we do not know yet that this activity occurs in the cells (10). Together with such flexibility in substrate recognition, the ubiquity and the constitutive expression of 3'-tRNase have suggested that this enzyme can be utilized for specific cleavage of cellular RNAs by introducing appropriate sgRNAs into living cells.
RNA heptamers, when they form acceptor stem-like duplexes with their targets through base pairing, can also direct specific cleavages of target RNAs by 3'-tRNase in vitro as efficiently as the original 5'-half-tRNAs (11). In this case, however, the target sites are restricted to immediate downstream regions of stable hairpin structures resembling the T stemloop. This is advantageous because a heptamer can direct efficient RNA cleavage with a specificity of an
12-nt sequence and not merely a 7-nt sequence due to the need for a stable hairpin structure (11).
The use of RNA heptamers to knock-down specific mRNAs has additional advantages over long RNAs such as conventional antisense RNAs (13), ribozymes (14) and small interfering RNAs (siRNAs) (12). First, heptamers are much easier and cheaper to synthesize than long ones. Secondly, cells can take up RNA heptamers relatively easily without any stimulating reagents. When we incubated human 293 cells in culture medium containing 10% fetal bovine serum (FBS) with fluorescein-labeled 2'-O-methyl heptamers for 8 h without cationic reagent, the fluorescence was detected in most of the cells (unpublished data).
Small RNAs (such as 5'-half-tRNAs and RNA heptamers) that can direct RNA cleavage by 3'-tRNase are referred to as sgRNAs. In this study, we demonstrate that intracellular target mRNAs can be specifically cleaved presumably by endogenous 3'-tRNase under the direction of appropriate sgRNAs which are introduced into the cells as expression plasmids or synthetic 2'-O-methyl RNAs.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Plasmid constructions
A synthetic double-stranded DNA containing a tRNAArg promoter, an RNA polymerase III terminator and an effector sequence (sgCAT, sgCATM or antiCAT) was cloned between the EcoRI and HindIII sites of pBluescript SK+ (Stratagene) to generate the effector expression plasmids psgCAT, psgCATM or pantiCAT. The synthetic sense strand DNA sequences for psgCAT and pantiCAT are 5'-AATTCGTACGTCGCAGGAATTC (ctcaacc for psgCATM) TGGCGCAATGGATAACGCGGCAAG (gaatg for psgCATM) CTACGGAT CAGAAGATTCCAGGTTCGACTCCTGGCTGGCTCGTTTTA-3' and 5'-AATTCGTACGTCGCACTCAACCTGGCGCAATGGGGAATTCCGGATGAGCATTCATCAGAGATTCCAGGTTCGACTCCTGGCTGGCTCGTTTTA-3', respec tively. The regions complementary to the CAT mRNA are underlined.
To construct the 5'-modified luciferase expression plasmids p5LucWT, p5LucM1 and p5LucM2, we inserted synthetic double-stranded DNAs containing the DNA sequences WT, M1 and M2, respectively, into the NcoI site (immediately before the initiation codon) of the pGL3-control vector (Promega). The 3'-modified luciferase expression plasmids p3LucWT, p3LucM1 and p3LucM2 were generated by cloning the synthetic double-stranded DNAs containing the DNA sequences WT, M1 and M2, respectively, into the XbaI site (immediately after the stop codon) of the pGL3-control vector. The synthetic sense DNA containing the WT sequence (indicated by underlining) is 5'-TCAAAGCTTCTAGACCATGGCC (aa in M2) AGGTTCGACTCCTGGCTG (c in M1) GC (a in M1) TCGGTGCCATGGTCTAGAAGCTTTGA-3'.
2'-O-methyl RNA synthesis for in vivo assays
The following 5'-phosphorylated 2'-O-methyl sgRNAs were synthesized by Nippon Bioservice: sgCAT, 5'-pGGAAUUCUGGCGCAAUGGAUAACGCGGCAAG-3'; sgCATM, 5'-pCUCAACCUGGCGCAAUGGAUAACGCGGAAUG-3'; antiCAT, 5'-pGGAAUUCCGGAUGAGCAUUCAUCAG-3'; CAT7, 5'-pGGAAUUC-3'; Hep1, 5'-pGGGCCAG-3'; Hep2, 5'-pGAUCGAG-3'; and Bclhep, 5'-pGGGGGCA-3'.
DNA transfection, CAT assays and luciferase assays
The MadinDarby canine kidney epithelial (MDCK) cells or 293 cells were plated at a density of 1 x 105 cells/ml on 12-well (for CAT assay) or 24-well (for luciferase assay) dishes in Dulbeccos modified Eagles medium (DMEM) supplemented with 10% FBS. After incubation at 37°C for 24 h, the cells were co-transfected with a reporter (CAT or luciferase) expression plasmid, an effector expression plasmid or MeRNA, and the pSV-ß-galactosidase control vector (Promega) using Lipofectamine 2000 (Invitrogen). The cells were further cultured at 37°C for 48 h unless specified. The CAT protein amounts were measured using a CAT enzyme-linked immunosorbent assay (ELISA) kit (Roche) (15). The luciferase activity was quantitated with a PicaGene kit (Toyo-inks) using the luminescence reader BLR201 (Aloka) (15). The CAT activity and the luciferase activity were normalized against the amount of the ß-galactosidase activity.
RNA isolation and northern blot analysis
Total cellular RNA was prepared 24 h after transfection by the acid guanidinium thiocyanatephenolchloroform extraction method (16), and northern blot analysis was performed as described (17). The intensity of RNA bands was quantitated using the software ImageQuant (Molecular Dynamics), and the reporter mRNA levels were normalized against the internal control mRNA levels.
MTT cell viability assays
Sarcoma 180 cells were plated at a density of 2 x 105 cells/ml on 24-well dishes in 0.4 ml of DMEM supplemented with 10% FBS. After incubation at 37°C for 24 h, the cells were transfected with the MeRNA heptamer Hepbcl using Lipofectamine 2000 and cultured in the absence or presence of human recombinant hepatocyte growth factor (HGF) (a generous gift from T. Ishii) for a further 72 h. After the incubation, the MTT assay was performed as described (18).
RNA synthesis for in vitro analysis
The target RNA SPH2 was synthesized with T7 RNA polymerase (Takara Shuzo) from a synthetic double-stranded DNA containing a T7 promoter (11). The transcription reaction was carried out in the presence or absence of [
-32P]UTP (Amersham Pharmacia Biotech) under the conditions specified by the manufacturer (Takara Shuzo). The synthesized SPH2 was gel purified before assays.
Chemically modified 5'-phosphorylated RNA heptamers, 2'-O-methyl RNA (MeRNA), phosphorothioate RNA (SRNA), DNA and phosphorothioate DNA (SDNA) together with unmodified RNA were synthesized with a DNA/RNA synthesizer and purified by high-performance liquid chromatography before various assays. The synthesis of these heptamers was carried out by Nippon Bioservice. 5'-Biotinylated SPH2 was synthesized and purified by Xeragon.
BIACORE kinetic assays
To obtain dissociation constants (Kd) of SPH2heptamer complexes, we determined association (ka) and dissociation (kd) rate constants by using surface plasmon resonance biosensors of a BIACORE3000 instrument. Kinetic assays were performed basically according to the instructions supplied by BIACORE Inc. About 2700 resonance units (RU) of 5'-end-biotinylated SPH2 were non-covalently immobilized on flow cell 2 of Sensor Chip SA, which contained streptavidin covalently immobilized on its carboxymethylated dextran matrix. Several different concentrations (1002000 nM) of unmodified or chemically modified RNA heptamers were tested for kinetic constants. Each sample in a buffer containing 10 mM TrisHCl pH 7.5 and 3.2 mM MgCl2 was injected at 20 µl/min through flow cell 1 (as reference) and flow cell 2 in the instrument equilibrated at 25°C. After a 120 s injection, both flow cells were washed with the same buffer without heptamers to monitor duplex dissociation. The surface of Sensor Chip SA was regenerated by washing with 6 M urea before each assay.
BIACORE sensorgrams obtained through the kinetic assays were analyzed with the computer software, BIAevaluation version 3.0 (BIACORE Inc.), to calculate ka and kd values for each heptamer. The data were subjected to global fitting based on a one-to-one binding model, and the fittings were sufficiently good judging from small
2 values (0.130.41), which represent deviations from fitted curves.
Kinetic analysis for 3'-tRNase cleavage
The 3'-tRNase cleavage of a complex of SPH2 with each heptamer was examined at various concentrations of SPH2. A reaction mixture (6 µl) contained 10 mM TrisHCl pH 7.5, 1.5 mM dithiothreitol, 3.2 mM MgCl2, 10 µM RNA heptamer and 0.173.3 µM SPH2. After pre-incubation at 25°C for 10 min, the reactions were started by adding the pig 3'-tRNase fraction (15 ng) after glycerol gradient centrifugation (4), and continued at 25°C for 5 min. The reaction products were resolved on a 10% polyacrylamide8 M urea gel and then quantitated with a PhosphorImager (Molecular Dynamics). Actual concentrations of SPH2heptamer complexes were calculated using the Kd value from the BIACORE analysis. Km and Vmax values were obtained from the best-fit line on a LineweaverBurk plot.
5'-End-labeling of heptamers and nuclease stability assays
The 5'-phosphates of unmodified or chemically modified RNA heptamers were removed with bacterial alkaline phosphatase (Takara Shuzo). After the reaction, the heptamers were extracted with phenol, precipitated with ethanol, and redissolved in water. Each heptamer was 5'-end-labeled with [
-32P]ATP (Amersham Pharmacia Biotech) using T4 polynucleotide kinase (Takara Shuzo), and purified on a 20% polyacrylamide8 M urea gel.
The 32P-labeled heptamers (1 pmol) were assayed for nuclease stability by incubating them with 10 µl of DMEM containing 10% FBS at 37°C for various time periods. After the incubation, the products were analyzed on a 20% polyacrylamide8 M urea gel, and quantitated with a PhosphorImager (Molecular Dynamics).
| RESULTS AND DISCUSSION |
|---|
|
|
|---|
Downregulation of CAT expression by an sgRNA expressed under the control of the tRNAArg promoter
First of all, we investigated whether sgRNAs can direct specific mRNA cleavage in living cells by introducing an expression plasmid encoding a 5'-half-tRNA. We tested the CAT mRNA (GenBank accession No. X65321 [GenBank] ) for 3'-tRNase-specific cleavage in MDCK cells. Because the sgRNA sgCAT36 has been shown to direct CAT mRNA cleavage in vitro after the 222nd nucleotide U from the initiation codon (10), we constructed the pBluescript-based plasmid psgCAT that produces the transcript containing the sgCAT36 sequence under the control of the tRNAArg promoter (Fig. 1A). We also generated two control plasmids, psgCATM and pantiCAT, which produce the transcripts containing 7-nt substitutions in the CAT mRNA-binding regions and a conventional 25-nt antisense sequence, respectively.
|
After co-transfection of MDCK cells with the CAT expression vector pcDNA3/CAT (Invitrogen) and one of the effector plasmids, we measured the amount of CAT protein in cell lysates. The CAT protein levels were significantly reduced in a dose-dependent manner, and the degree of reduction was higher than that in pantiCAT-transfected cells, while the transfection with psgCATM did not reduce the CAT protein level (Fig. 1B). The CAT mRNA levels were also decreased in accordance with the protein levels (Fig. 1C). By northern blot analysis, we confirmed that the transcripts containing sgCAT, sgCATM and antiCAT sequences were equivalently expressed in the cells (data not shown). In spite of less stable binding to the mRNA, the downregulation by the sgRNA was more efficient than that by the conventional antisense RNA. It is likely that this is because the mRNA can be cleaved by 3'-tRNase under the direction of the sgRNA and subsequently degraded beyond the conventional antisense effect. Similar effects of the co-transfection were observed in 293 cells (data not shown). These results suggest that our sgRNA/3'-tRNase RNA cleavage method really works in living cells.
3'-tRNase RNA cleavage in vitro under the direction of chemically modified sgRNAs
When we introduce synthetic RNA heptamers into living cells, we need to make the heptamers more stable than natural RNAs to avoid their degradation by cellular nucleases. Various chemically modified RNA heptamers such as MeRNA, SRNA, DNA and SDNA together with unmodified RNA were tested for their efficiency to direct the specific RNA cleavage and for nuclease stability. The 3'-half portion of human tRNAArg SPH2 was used as an RNA target, which is well characterized and is known to be cleaved efficiently by 3'-tRNase under the direction of the unmodified RNA heptamer (11). The efficiency was examined by measuring Kd values for heptamertarget complexes and Vmax/Km values for 3'-tRNase cleavage, and the stability was investigated by estimating their half-lives in culture media.
The Kd values for MeRNA and SRNA were smaller and slightly larger, respectively, than that for unmodified RNA, and the Kd values for DNA and SDNA were much more elevated (Table 1). The Vmax/Km values differed depending on heptamers, and that for MeRNA was second best behind unmodified RNA (Table 1). MeRNA and SDNA were much more stable against nucleases than unmodified RNA, SRNA and DNA (Table 1). These results suggest that the MeRNA heptamer would greatly exceed the others in guiding 3'-tRNase RNA cleavage in living cells.
|
Knock-down of the cellular CAT mRNA by a 2'-O-methyl sgRNA
Before examining the efficacy of MeRNA heptamers in the cells, we tested 2'-O-methyl 5'-half-tRNAs for their guiding ability. We co-transfected MDCK cells with pcDNA3/CAT and synthetic 2'-O-methyl sgCAT, sgCATM or antiCAT. The CAT protein levels decreased up to
45% in a dose-dependent manner in 48 h in the presence of 2'-O-methyl sgCAT (Fig. 1B). While 2'-O-methyl sgCATM did not show a meaningful effect, 2'-O-methyl antiCAT decreased CAT protein levels up to
70%. This decrease would be not due to an RNAi effect but to a simple antisense effect, because MeRNA cannot induce RNAi (19). The CAT mRNA level was reduced to
70% in the presence of 2'-O-methyl sgCAT (Fig. 1C). Similar effects of the co-transfection were observed in 293 cells (data not shown). These results suggest that a 2'-O-methyl 5'-half-tRNA can direct specific mRNA cleavage and downregulate the protein level in mammalian cells.
2'-O-methyl heptamers downregulate the luciferase expression
We next challenged targeting modified firefly luciferase mRNAs (GenBank accession no. U47296
[GenBank]
) using synthetic MeRNA heptamers in the cells. Based upon the luciferase expression vector pGL3-control, we constructed its six derivatives, each of which can express a luciferase mRNA containing one of three different target sequences (WT, M1 and M2) of 3'-tRNase (11) in either the 5'- or 3'-untranslated region (UTR, Fig. 2A). These target sequences are based on the well-characterized SPH2. The 5'-modified luciferase mRNAs from the resultant plasmids p5LucWT, p5LucM1 and p5LucM2 have single 7-nt sequences complementary to the 2'-O-methyl heptamers Hep1, Hep2 and Hep1, respectively (Fig. 2A). In the same fashion, the 3'-modified luciferase transcripts from the plasmids p3LucWT, p3LucM1 and p3LucM2 contain single heptamer-binding sites. Because the WT and M1 sequences can fold to form 5-bp stemloops, the complexes of Hep1WT and Hep2M1 can form co-axially stacked perfect 12-bp stemloops. Hep1M2 can form a similar stemloop with two mismatches due to the presence of 2-nt substitutions in M2. Hep1M1, Hep2WT and Hep2M2 can also form similar stemloops containing two, two and four mismatches, respectively. Judging from the previous observations in in vitro 3'-tRNase assays (10,11), only Hep1WT and Hep2M1 complexes could be cleaved efficiently by endogenous 3'-tRNase.
|
We co-transfected 293 cells with one of these plasmids together with one of the heptamers. After incubation for 48 h, the cells were harvested and luciferase activities were measured. The unrelated heptamer CAT7 was used as a control. As expected, significant reduction of the luciferase activity was observed only in the cells where the Hep1WT or Hep2M1 complex can be formed in either the 5'- or 3'-UTR of the luciferase mRNA (Fig. 2B). The cellular luciferase activity was not significantly affected by heptamers that form imperfect stemloop complexes with the mRNA (Fig. 2B). Hep1 started to downregulate the cellular luciferase activity from the 5'-WT-modified mRNA at the concentration of 0.2 µM, and continued to reduce the activity up to
35% at 2 µM (Fig. 2C). The downregulation by 1 µM Hep1 was observed in 12 h and maintained for at least 48 h (Fig. 2D). We confirmed that the luciferase mRNA levels were reduced in the cells co-transfected with p5LucWT and Hep1, and with p5LucM1 and Hep2 to
55 and
60%, respectively (Fig. 2E). These results suggest that the MeRNA heptamers can attack target mRNAs with a high specificity and induce 3'-tRNase-mediated cleavage of the mRNA in living cells.
An RNA heptamer knocks-down the endogenous Bcl-2 mRNA
Furthermore, in order to examine whether an RNA heptamer can direct endogenous mRNA cleavage by 3'-tRNase, we selected the Bcl-2 mRNA as a target. It is known that downregulation of Bcl-2 induces apoptosis (20,21) and that human recombinant HGF induces the apoptosis signaling pathway in Sarcoma 180 cells (18). We transfected Sarcoma 180 cells with the 2'-O-methyl heptamer Bclhep, which is designed to bind immediately downstream of a potential T-stemloop-like hairpin structure, to the 126th to 132nd nucleotide from the initiation codon of the Bcl-2 mRNA (GenBank accession No. M16506
[GenBank]
) and to induce 3'-tRNase cleavage. The introduction of Bclhep caused a reduction in the viability of Sarcoma 180 cells in the presence or absence of HGF up to
50% (Fig. 3). This observation supports the efficacy of the heptamer/3'-tRNase strategy in the cells.
|
Heptamer potentiality for therapeutic agents
Here we showed that intracellular target mRNAs can be specifically downregulated under the direction of appropriate sgRNAs which are introduced into the cells as expression plasmids or synthetic 2'-O-methyl RNAs. Although our data suggest that the observed downregulation is attributed to specific mRNA cleavage by endogenous 3'-tRNase, further experiments would be needed to corroborate this mechanism. Experiments to see if the sgRNA-directed downregulation can be canceled after knocking-down the 3'-tRNase expression by siRNAs or ribozymes would be very useful.
The number of the total human genes has been estimated to be
32 000 (22), while the estimated average length of human mRNAs excluding poly(A) tails is
2500 nt (23). From these values, the whole human mRNA sequence space can be calculated to be
80 million nucleotides. In theory, the frequency of appearance of potential heptamer-directed cleavage sites is 1/412, or once every
17 million nucleotides, resulting in the appearance of roughly five potential mRNA cleavage sites per heptamer. In the experiment of in vitro 3'-tRNase cleavage of the CAT mRNA, we have not detected cleavage at about four-fifths of the selected potential target sites probably due to tight RNA folding to refuse access to sgRNAs (data not shown). Therefore, we can expect that one specific heptamer may be able to direct cellular mRNA cleavage at one unique site among the
80 million nucleotide sequence space. Because 47, or 16 384, heptamers of different sequences can be generated, about half of the human mRNAs could be targeted under the direction of heptamers. Hopefully, a significant number of the heptamers could be selected as therapeutic agents.
| ACKNOWLEDGEMENTS |
|---|
This work was supported by the grant for the Ribosome Engineering Project from the Organized Research Combination System of the Science and Technology Agency of Japan.
| REFERENCES |
|---|
|
|
|---|
- Nashimoto,M. (1997) Distribution of both lengths and 5' terminal nucleotides of mammalian pre-tRNA 3' trailers reflects properties of 3' processing endoribonuclease. Nucleic Acids Res., 25, 11481155.
[Abstract/Free Full Text] - Nashimoto,M., Tamura,M. and Kaspar,R.L. (1999) Minimum requirements for substrates of mammalian tRNA 3' processing endoribonuclease. Biochemistry, 38, 1208912096.[CrossRef][Medline]
- Nashimoto,M., Tamura,M. and Kaspar,R.L. (1999) Selection of cleavage site by mammalian tRNA 3' processing endoribonuclease. J. Mol. Biol., 287, 727740.[CrossRef][Web of Science][Medline]
- Nashimoto,M., Wesemann,D.R., Geary,S., Tamura,M. and Kaspar,R.L. (1999) Long 5' leaders inhibit removal of a 3' trailer from a precursor tRNA by mammalian tRNA 3' processing endoribonuclease. Nucleic Acids Res., 27, 27702776.
[Abstract/Free Full Text] - Mohan,A., Whyte,S., Wang,X., Nashimoto,M. and Levinger,L. (1999) The 3' end CCA of mature tRNA is an antideterminant for eukaryotic 3'-tRNase. RNA, 5, 245256.[Abstract]
- Takaku,H., Minagawa,A., Takagi,M. and Nashimoto,M. (2003) A candidate prostate cancer susceptibility gene encodes tRNA 3' processing endoribonuclease. Nucleic Acids Res., 31, 22722278.
[Abstract/Free Full Text] - Schurer,H., Schiffer,S., Marchfelder,A. and Morl,M. (2001) This is the end: processing, editing and repair at the tRNA 3'-terminus. Biol. Chem., 382, 11471156.[CrossRef][Web of Science][Medline]
- Nashimoto,M. (1995) Conversion of mammalian tRNA 3' processing endoribonuclease to four-base-recognizing RNA cutters. Nucleic Acids Res., 23, 36423647.
[Abstract/Free Full Text] - Nashimoto,M. (1996) Specific cleavage of target RNAs from HIV-1 with 5' half tRNA by mammalian tRNA 3' processing endoribonuclease. RNA, 2, 25232524.
- Nashimoto,M. (2000) Anomalous RNA substrates for mammalian tRNA 3' processing endoribonuclease. FEBS Lett., 472, 179186.[CrossRef][Web of Science][Medline]
- Nashimoto,M., Geary,S., Tamura,M. and Kaspar,R. (1998) RNA heptamers that direct RNA cleavage by mammalian tRNA 3' processing endoribonuclease. Nucleic Acids Res., 26, 25652571.
[Abstract/Free Full Text] - McManus,M.T. and Sharp,P.A. (2002) Gene silencing in mammals by small interfering RNAs. Nature. Rev. Genet., 3, 737747.[CrossRef][Web of Science][Medline]
- Lebedeva,I. and Stein,C.A. (2001) Antisense oligonucleotides: promise and reality. Annu. Rev. Pharmacol. Toxicol., 41, 403419.[Medline]
- Freelove,A.C. and Zheng,R. (2002) The power of ribozyme technologies: the logical way ahead for molecular medicine and gene therapy? Curr. Opin. Mol. Ther., 4, 419422.[Web of Science][Medline]
- Tamura,M. and Noda,M. (1994) Identification of a DNA sequence involved in osteoblast-specific gene expression via interaction with helixloophelix (HLH)-type transcriptional factors. J. Cell Biol., 126, 773782.
[Abstract/Free Full Text] - Chomczynski,P. and Sacchi,N. (1987) Single-step method of RNA isolation by acid guanidinium thiocyanatephenolchloroform extraction. Anal. Biochem., 162, 156159.[Web of Science][Medline]
- Tamura,M., Arakaki,N., Tsubouchi,H., Takada,H. and Daikuhara,Y. (1993) Enhancement of human hepatocyte growth factor production by interleukin-1
and -1ß and tumor necrosis factor-
by fibroblasts in culture. J. Biol. Chem., 268, 81408145.[Abstract/Free Full Text] - Arakaki,N., Kajihara,T., Arakaki,R., Ohnishi,T., Kazi,J.A., Nakashima,H. and Daikuhara,Y. (1999) Involvement of oxidative stress in tumor cytotoxic activity of hepatocyte growth factor/scatter factor. J. Biol. Chem., 274, 1354113546.
[Abstract/Free Full Text] - Elbashir,S.M., Martinez,J., Patkaniowska,A., Lendeckel,W. and Tuschl,T. (2001) Functional anatomy of siRNAs for mediating efficient RNAi in Drosophila melanogaster embryo lysate. EMBO J., 20, 68776888.[CrossRef][Web of Science][Medline]
- Jansen,B. and Zangemeister-Wittke,U. (2002) Antisense therapy for cancerthe time of truth. Lancet Oncol., 3, 672683.[CrossRef][Web of Science][Medline]
- Skorski,T. (2002) BCR/ABL regulates response to DNA damage: the role in resistance to genotoxic treatment and in genomic instability. Oncogene, 21, 85918604.[CrossRef][Web of Science][Medline]
- International Human Genome Sequencing Consortium (2001) Initial sequencing and analysis of the human genome. Nature, 409, 860921.[CrossRef][Medline]
- Wiemann,S., Weil,B., Wellenreuther,R., Gassenhuber,J., Glassl,S., Ansorge,W., Bocher,M., Blocker,H., Bauersachs,S., Blum,H. et al. (2001) Toward a catalog of human genes and proteins: sequencing and analysis of 500 novel complete protein coding human cDNAs. Genome Res., 11, 422435.
[Abstract/Free Full Text]
This article has been cited by other articles:
![]() |
M. M. Sato, A. Nakashima, M. Nashimoto, Y. Yawaka, and M. Tamura Bone morphogenetic protein-2 enhances Wnt/beta-catenin signaling-induced osteoprotegerin expression. Genes Cells, February 1, 2009; 14(2): 141 - 153. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. J. Scherer, R. Frank, and J. J. Rossi Optimization and characterization of tRNA-shRNA expression constructs Nucleic Acids Res., April 10, 2007; (2007) gkm103v1. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. S. Shibata, H. Takaku, M. Takagi, and M. Nashimoto The T Loop Structure Is Dispensable for Substrate Recognition by tRNase ZL J. Biol. Chem., June 10, 2005; 280(23): 22326 - 22334. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Habu, N. Miyano-Kurosaki, M. Kitano, Y. Endo, M. Yukita, S. Ohira, H. Takaku, M. Nashimoto, and H. Takaku Inhibition of HIV-1 gene expression by retroviral vector-mediated small-guide RNAs that direct specific RNA cleavage by tRNase ZL Nucleic Acids Res., January 12, 2005; 33(1): 235 - 243. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Takaku, A. Minagawa, M. Takagi, and M. Nashimoto The N-terminal half-domain of the long form of tRNase Z is required for the RNase 65 activity Nucleic Acids Res., August 18, 2004; 32(15): 4429 - 4438. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Takaku, A. Minagawa, M. Takagi, and M. Nashimoto A novel 4-base-recognizing RNA cutter that can remove the single 3' terminal nucleotides from RNA molecules Nucleic Acids Res., June 28, 2004; 32(11): e91 - e91. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||











