Skip Navigation

This Article
Right arrow Abstract Freely available
Right arrow Print PDF (375K) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrowRequest Permissions
Right arrow Commercial Re-use Guidelines
for Open Access NAR Content
Google Scholar
Right arrow Articles by Miyamoto-Sato, E.
Right arrow Articles by Yanagawa, H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Miyamoto-Sato, E.
Right arrow Articles by Yanagawa, H.
Related Collections
Right arrow RNA characterisation and manipulation
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Nucleic Acids Research, 2003, Vol. 31, No. 15 e78
© 2003 Oxford University Press

Highly stable and efficient mRNA templates for mRNA–protein fusions and C-terminally labeled proteins

Etsuko Miyamoto-Sato, Hideaki Takashima, Shinichiro Fuse, Kaori Sue, Masamichi Ishizaka, Seiji Tateyama, Kenichi Horisawa, Tatsuya Sawasaki1, Yaeta Endo1 and Hiroshi Yanagawa*

Department of Biosciences and Informatics, Faculty of Science and Technology, Keio University, 3-14-1, Hiyoshi, Kohoku-ku, Yokohama 223-8522, Japan and 1 Department of Applied Chemistry, Faculty of Engineering, Ehime University, Matsuyama 790-8577, Japan

*To whom correspondence should be addressed. Tel: +81 45 566 1775; Fax: +81 45 566 1440; Email: hyana{at}bio.keio.ac.jp

Received May 1, 2003; Revised and Accepted June 3, 2003


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS AND DISCUSSION
 REFERENCES
 
For high-throughput in vitro protein selection using genotype (mRNA)–phenotype (protein) fusion formation and C-terminal protein labeling as a post-selection analysis, it is important to improve the stability and efficiency of mRNA templates for both technologies. Here we describe an efficient single-strand ligation (90% of the input mRNAs) using a fluorescein-conjugated polyethylene glycol puromycin (Fluor-PEG Puro) spacer. This ligation provides a stable c-jun mRNA with a flexible Fluor-PEG Puro spacer for efficient fusion formation (70% of the input mRNA with the PEG spacer) in a cell-free wheat germ translation system. When using a 5' untranslated region including SP6 promoter and {Omega}29 enhancer (a part of tobacco mosaic virus {Omega}), an A8 sequence (eight consecutive adenylate residues) at the 3' end is suitable for fusion formation, while an XA8 sequence (XhoI and the A8 sequence) is suitable for C-terminal protein labeling. Further, we report that Fluor-PEG N-t-butyloxycarbonylpuromycin [Puro(Boc)] spacer enhances the stability and efficiency of c-jun mRNA template for C-terminal protein labeling. These mRNA templates should be useful for puromycin-based technologies (fusion formation and C-terminal protein labeling) to facilitate high-throughput in vitro protein selection for not only evolutionary protein engineering, but also proteome exploration.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS AND DISCUSSION
 REFERENCES
 
In vitro protein selection experiments using ‘in vitro virus’ (IVV) (1), RNA–peptide fusion (24), mRNA display (57), ribosome display (810) and STABLE (11) have been developed for evolutionary protein engineering and are expected to be applicable for genome analyses (12,13). However, current in vitro protein selection techniques (17,12,13) require an improvement in the stability of mRNA–protein fusions to minimize mRNA degradation in cell-free translation systems (11). They also require an improvement in the efficiency of formation of mRNA–protein fusions to provide large libraries and highly efficient enrichment, as well as to simplify tedious processes such as the post-translational maturation step (4).

In the course of development of IVV (1), two useful puromycin-based techniques, named ‘puromycin technology’, have been established on the basis of the interesting phenomenon that puromycin can bond to a full-length protein at the C-terminus (14). One technique is IVV formation (1), in which an in vitro-translated full-length protein (phenotype) is attached to its encoding mRNA (genotype), and the other is C-terminal protein labeling (1416), in which a puromycin derivative bearing a fluorescein moiety is used to label the C-terminal end of a full-length protein. Accordingly, high-throughput in vitro protein selection can be achieved by combining IVV and post-selection using C-terminally labeled proteins, especially for proteome exploration (post-selection analysis is necessary to confirm protein–protein interactions). In fact, we have already reported in vitro analyses of protein–protein interactions using C-terminally labeled proteins (15,16). Thus, in the present study, we attempted to obtain efficient mRNA templates that could improve puromycin technology (IVV formation and C-terminal labeling of proteins).

Since the flexibility of mRNA–puromycin conjugates is an important factor in mRNA–protein fusion formation (3,17), we chose simple enzymatic ligation using T4 RNA ligase. The previous ligation methods, such as splint ligation (4) and photo-linked ligation (17), require hybridization sequences that impair the flexibility at the 3' end of mRNA, as opposed to our single-strand ligation. Here we demonstrate that, with c-jun mRNA template, single-strand ligation using the flexible fluorescein-conjugated polyethylene glycol puromycin (Fluor-PEG Puro) spacer provides an improvement of mRNA stability and IVV formation. By utilizing particular 5' and 3' end sequences of c-jun mRNA (Fig. 1A), we can obtain efficient mRNA templates for IVV formation (Fig. 1B) and C-terminal protein labeling (Fig. 1C, I). Further, we show that the Fluor-PEG N-t-butyloxycarbonylpuromycin [Puro(Boc)] spacer (Fig. 1C, II) enhances the stability and efficiency of c-jun mRNA for C-terminal protein labeling.



View larger version (34K):
[in this window]
[in a new window]
 
Figure 1. The mRNA template and puromycin-based technologies of IVV formation and C-terminal labeling of proteins. (A) The mRNA template is comprised of 5' UTR, T7 tag, ORF, Flag tag and 3' tail. Five mRNA templates have different 5' UTR sequences: SP6 + {Omega}29 [SP6 RNA polymerase transcription promoter (SP6) and translation enhancer {Omega}29 (CAACAACAACAACAAACAACAACAAAATG), which is a part of tobacco mosaic virus {Omega} sequence (23)], SP6 + {Omega}, T7 + {Omega}29 [T7 RNA polymerase promoter (T7) and {Omega}29], T7 + delta-TMV [T7 and delta-TMV sequence (2)] and T7 + K [T7 and Kozak (K) sequence (24)]. Four mRNA templates have different 3' tail sequences: XA8 (CTCGAGAAAAAAAA), X'A8 (CATCACAAAAAAAA), X(CTCGAG) and A8 (AAAAAAAA). The standard template has SP6 + {Omega}29 as a 5' UTR and XA8 as a 3' tail. (B) IVV formation on the ribosome (1). Puromycin at the 3'-terminal end of a spacer (Fluor-PEG Puro) ligated to mRNA can enter the ribosomal A-site to covalently bind to the C-terminal end of its encoding protein. Puro represents puromycin. (C) C-terminal labeling of proteins on the ribosome (14,15). A puromycin derivative (Fluor-dCpuro; 16) can enter the ribosomal A-site to bind covalently to the C-terminal end of the protein when mRNA without a spacer (I) or mRNA with a Fluor-PEG Puro(Boc) spacer (II) is used as a template. Puro(Boc) represents N-t-butyloxycarbonylpuromycin, which is incapable of forming IVV.

 

    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS AND DISCUSSION
 REFERENCES
 
Synthesis of Fluor-PEG Puro and Puro(Boc) spacers
Protected deoxycytidine phosphoramidite (dC-amidite), thymidine(fluorescein) phosphoramidite [T(Fluor)-amidite] and chemical phosphorylation reagent II (CPR II) were purchased from Glen Research Corporation (VA). Polyethylene glycol (PEG, average mol. wt 2000) was purchased from NOF Corporation (Tokyo, Japan). N-Fluorenylmethoxycarbonyl puromycin and N-t-butyloxycarbonylpuromycin attached to controlled-pore glass supports [Puro(Fmoc)-CPG and Puro(Boc)-CPG] were synthesized according to the published procedure (18). Synthesis of (4,4'-dimethoxytrityl)-PEG-(2-cyanoethyl-N,N-diisopropyl)phosphoramidite (PEG-amidite) was done according to the published procedure (19). Fluor-PEG Puro spacer [p(dCp)2-T(Fluor)p-PEGp-(dCp)2-puromycin] was synthesized from Puro(Fmoc)-CPG, and Fluor-PEG Puro(Boc) spacer [p(dCp)2-T(Fluor)p-PEGp-(dCp)2-N-t-butyloxycarbonylpuromycin] was synthesized from Puro(Boc)-CPG, with dC-amidite, PEG-amidite, T(Fluor)-amidite and CPR II according to the standard phosphoramidite method (19). After deprotection with concentrated NH4OH/EtOH (3:1) at 25°C for 14 h, the spacers were purified by reverse-phase HPLC on a YMC-Pack ODS-A SH-343-5 (YMC, Kyoto, Japan) with 0.1 M triethylammonium acetate (pH 7.0) as solvent A and acetonitrile as solvent B at a flow rate of 10 ml/min. A linear gradient of 10–60% solvent B over 30 min was used for elution.

Preparation of DNA
PCR amplification was conducted through 35 cycles (98°C, 20 s; 55°C, 60 s; 72°C, 180 s) with the primers listed in Table 1. DNA templates of c-jun from pUC-Jun containing a part of c-Jun (179–335) cloned from a mouse testis cDNA library (Takara) were amplified in two PCR steps. The first PCR was performed with primers 5'T7Jun and 3'JunFlagA, and then the second PCR was done using the first PCR product as a template with the 5' primers 5'SP6(O-29)T7 having SP6 + {Omega}29, 5'T7g-SP6 having SP6 + {Omega}, and 5'T7(O-29)T7 having T7 + {Omega}29, and the 3' primers 3'FlagA having XA8, 3'Flag2 having X, 3'FlagA(C3) having X'A8, 3'Flag1A having A8, 3'FlagHisXA having XA8, and 3'FlagHisA having A8. DNA templates of c-fos from pCMV-FosCBPzz including a part of c-Fos (118–211) cloned from a mouse testis cDNA library (Takara) were amplified with the 5' primer 5'SP6(O29/F.H)Fos and the 3' primer 3'FosFlagA with XA8 or 3'FosFlag1A with A8. DNA templates of cyclin B1 (cB1) from pCMVzzCBPcB1 containing full-length cB1 were amplified with the 5' primer 5'SP6(O29)cB1 and the 3' primer 3'(646)FlagA with XA8 or 3'(646)Flag1A with A8.


View this table:
[in this window]
[in a new window]
 
Table 1. Primers used in this study
 
Ligation of mRNA to a Fluor-PEG Puro or Puro(Boc) spacer
The transcription was performed using the RiboMaxTM Large Scale RNA Production System (Promega) with the PCR products as DNA templates, as described in Preparation of DNA. The transcription product of 200 nM mRNA was ligated to 40 µM Fluor-PEG Puro spacer or Puro(Boc) spacer with T4 RNA ligase (Takara) at 15°C in the presence of 120 µM free PEG (average mol. wt 2000) and then excess spacer was removed by using RNeasy Mini Kits (Qiagen). Ligation products were analyzed by 8 M urea/4% PAGE after staining with ethidium bromide. The fluorescence of mRNA with a Fluor-PEG spacer on the gel was easily and directly visualized with a fluorescence image analyzer (Molecular Imager FX, Bio-Rad).

IVV formation and C-terminal protein labeling
The standard IVV formation protocol was performed by using 200 nM mRNA ligated to a Fluor-PEG Puro spacer as a template in a cell-free wheat germ translation system (Wheat Germ Extract, Promega) at 26°C for 1 h. The translation product was analyzed by 8 M urea/10% SDS–PAGE. The fluorescence of the resulting IVV on the gel was easily and directly visualized with Molecular Imager FX (Bio-Rad). The Fluor-PEG Puro spacer offers the easy detection of IVV without using any radioisotopes. The C-terminal labeling of proteins was carried out using 200 nM mRNA as a template in the presence of 20 µM Fluor-dCpuro (16) at 26°C for 1 h. The yield of C-terminal labeled proteins was evaluated by scanning the fluorescence on a 15% SDS–polyacrylamide gel with a Molecular Imager FX (Bio-Rad). IVV formation and C-terminal labeling of proteins were also confirmed by western blotting. Western blots were probed with antibodies against T7-tag (Novagen) or Flag-tag (Sigma) using ECF Western blotting reagent packs (Amersham).


    RESULTS AND DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS AND DISCUSSION
 REFERENCES
 
Ligation efficiency with Fluor-PEG Puro spacer
Enzymatic ligation for the preparation of IVV requires a cumbersome gel purification of the mRNA template ligated to the spacer because of low ligation efficiency (13), thus slowing down template preparation. We took note of the fact that T4 RNA ligase prefers a C-rich sequence at the 5' end as a donor and an A-rich sequence at the 3' end as an acceptor (20). Ligation by using T4 RNA ligase was done with a Fluor-PEG Puro spacer with two consecutive deoxycytidylate residues as a donor. Two different mRNA templates with eight consecutive adenylate residues as a common acceptor were efficiently ligated to the spacer (Fig. 2A, Ib and IIb) compared with the templates without the acceptor (Fig. 2A, Ia and IIa). The ligation yield was finally increased from 80% (Fig. 2A, Ib, Fig. 2B, filled circles) to 90% (Fig. 2B, open circles; 80% within 1 h) of the input mRNA by the addition of free PEG (mol. wt 2000). This ligation can be applied not only to a Fluor-PEG Puro spacer for IVV formation (Fig. 1B), but also to a Fluor-PEG Puro(Boc) spacer for C-terminal labeling of proteins (Fig. 1C, II) in the same manner. This ligation method should allow efficient formation of both IVV and C-terminally labeled proteins without requiring a cumbersome gel purification of the mRNA template ligated to the spacer, thus speeding up template preparation.



View larger version (49K):
[in this window]
[in a new window]
 
Figure 2. Efficiency of ligation and stability of mRNA with a Fluor-PEG Puro spacer. (A) The ligation of c-jun mRNA having different 3' tail sequences described in Figure 1A, X (I) or X' (II) without (a) or with an A8 sequence (b) was analyzed with 8 M urea/4% PAGE followed by staining with ethidium bromide. Ligation efficiency is given as a percentage relative to input mRNA. (B) The time course of ligation of c-jun mRNA to a spacer described in (A, Ib) in the presence (open circles) or absence (closed circles) of free PEG (mol. wt 2000). (C) The remaining mRNA and IVV of c-jun mRNA were ligated to Fluor-PEG Puro spacer (I) containing 20% DNA, TEG spacer (II) (pdA20dT(fluorescein)[C9]3dAdCdCPuromycin) (3) containing 80% DNA, or DNA spacer (III) (pdA21dT(fluorescein)dA6dCdCPuromycin) (1,2) containing 100% DNA in a cell-free wheat germ translation system for 60 min in the presence (lane 2 of I–III) or absence (lane 3 of I–III) of 400 µM puromycin. The length of three spacers corresponds to approximately 30 nucleotide units. The input mRNA ligated to each spacer corresponds to 100% (lane 1 of I–III).

 
Stability of mRNA with Fluor-PEG Puro spacer
We examined the stability of mRNA with different flexible spacers (Fig. 2C). The Fluor-PEG Puro spacer most markedly enhanced the stability of c-jun mRNA template among these spacers (Fig. 2C, lane 2 in I–III) and the template remained almost entirely intact (>90%) within 60 min in a cell-free wheat germ translation system (Fig. 2C, lane 2 in I). The PEG spacer (Fig. 2C, I), which is the most flexible spacer containing the least percentage of DNA (20%), also gave the most efficient c-Jun IVV formation among these spacers (Fig. 2C, lane 3 in I–III). This result is consistent with previous findings that flexibility of the spacer is an important factor in mRNA–protein fusion formation (3,17). Thus, we obtained a stable and flexible c-jun mRNA template that could be easily handled in a cell-free translation system for IVV formation by means of ligation using the Fluor-PEG Puro spacer. Further, previous ligation methods, such as splint ligation (4), require sequences capable of hybridizing with a splint DNA, whereas single-strand ligation does not require hybridization sequences. Therefore, we can examine the effects of not only 5'-, but also 3'-terminal sequences on the efficiency of mRNA templates for puromycin technology (IVV and C-terminal protein labeling).

Optimized 5'- and 3'-terminal sequences of c-jun mRNA for puromycin technology
We have investigated the efficiency of IVV formation (Fig. 1B) and the formation efficiency of C-terminally labeled proteins (Fig. 1C, I) using five c-jun mRNA templates with different 5' untranslated region (UTR) sequences (Fig. 3A, lanes 1–5) in a cell-free wheat germ translation system. The efficiency of IVV formation increased (Fig. 3A, I) in parallel with the formation efficiency of C-terminally labeled proteins (Fig. 3A, II). The combination of SP6 as a promoter and {Omega}29 as an enhancer gave the best c-jun mRNA template for both IVV formation (Fig. 3A, I, lane 1) and C-terminal labeling of proteins (Fig. 3A, II, lane 1). Also, SP6 promoter (Fig. 3A, lane 1) is more suitable than T7 promoter (Fig. 3A, lane 3), and full-length {Omega} enhancer (Fig. 3A, lane 2) is not always better than shorter enhancers such as {Omega}29 (Fig. 3A, lane 1) in a cell-free wheat germ translation system (T.Sawasaki and Y.Endo, unpublished data). In contrast, the efficiency of IVV formation (Fig. 3B, I) of four c-jun mRNA templates with different 3' sequences (Fig. 3B, lanes 1–4) did not increase in parallel with increasing the formation efficiency of C-terminally labeled proteins (Fig. 3B, II). Thus, the results suggest that the formation efficiency of C-terminally labeled proteins does not necessarily correspond to the efficiency of IVV formation (Fig. 3A and B).



View larger version (60K):
[in this window]
[in a new window]
 
Figure 3. Effect of 5' UTR and 3' tail sequences of mRNA on puromycin technology. (A) The efficiency of IVV formation (I) and C-terminally labeled protein formation (II) with five different 5' UTR sequences (lanes 1–5). Individual sequences of 5' UTR are as described in Figure 1A. Lane 1, SP6 + {Omega}29; lane 2, SP6 + {Omega}; lane 3, T7 + {Omega}29; lane 4, T7 + delta-TMV; lane 5, T7 + K. Efficiency is normalized to the efficiency of lane 1. Data represent the mean SD of two separate experiments. (B) The efficiency of IVV formation (I) and C-terminally labeled protein formation (II) with four different 3' tail sequences (lanes 1–4). Individual sequences of 3' tail are as described in Figure 1A. Lane 1, XA8; lane 2, X'A8; lane 3, X; lane 4, A8. Efficiency is normalized to the efficiency of lane 1. Data represent the mean ± SD of two separate experiments.

 
3' tail sequences of mRNA favoring efficient IVV formation
Two factors influence the efficiency of IVV formation, i.e. the input mRNA ligated to a spacer (Fig. 3A and B, I) and the total synthesized protein. The total synthesized protein corresponds to the sum of IVV and free proteins produced during IVV formation. We examined the effect of concentrations of c-jun mRNA with XA8 and A8 sequences (Fig. 3B, lanes 1 and 4) on the efficiency of IVV formation. The efficiency of IVV formation of the input c-jun mRNA with the XA8 sequence ligated to the spacer was much the same as that with the A8 sequence (Fig. 4A, XA8 and A8). This is consistent with the finding that the efficiency of IVV formation of the input mRNA ligated to the spacer was hardly affected by these 3' tail sequences (Fig. 3B, I). In contrast, the efficiency of IVV formation of the total synthesized protein was affected (Fig. 4B, XA8 and A8), and the A8 sequence is more suitable for IVV formation. Accordingly, we optimized IVV formation of the input mRNA with the spacer (Fig. 4C, I; 70%) and IVV formation of the total synthesized proteins (Fig. 4C, II; 90%) using c-jun mRNA with SP6 + {Omega}29 as a 5' UTR and the A8 sequence as a 3' tail.



View larger version (43K):
[in this window]
[in a new window]
 
Figure 4. Effect of the 3' tail of mRNA on IVV formation. (A) The IVV formation was examined at various concentrations of the input c-jun mRNA. Lanes 1–6 correspond to 10, 50, 100, 200, 400 and 800 nM input c-jun mRNA, respectively. IVV formation efficiency represents a relative percentage with respect to the input mRNA ligated to a Fluor-PEG Puro spacer. (B) The formation of free protein was examined by C-terminal protein labeling at various concentrations of the input mRNA. Formation efficiency of free proteins represents a relative percentage with respect to resulting total synthesized proteins, corresponding to IVV and free proteins. Lanes indicate the concentrations of input mRNA as described in (A). (C) IVV formation using 50 nM c-jun mRNA ligated to a Fluor-PEG Puro spacer was carried out in a cell-free wheat germ translation system for 1 h. The efficiency was determined by detecting fluorescein (I) in the spacer and by western blotting for T7 tag (II). (D) The efficiency of IVV formation and the yield of free proteins examined using 200 nM c-fos (lane 1), c-jun (lane 2) and cB1 (lane 3) mRNAs having SP6 + {Omega}29 as a 5' UTR and XA8 or A8 sequence as a 3' tail ligated to Fluor-PEG Puro spacer, respectively.

 
Furthermore, we investigated the effect of the 3' tail sequences on the IVV formation using not only c-Jun, but also c-Fos and cyclin B1 to examine whether the effect on the efficiency of IVV formation is general or not. The IVV formation of all c-fos, c-jun and cB1 mRNA templates having the SP6 + {Omega}29 sequence as a 5' UTR and the XA8 or A8 sequence as a 3' tail was efficient and in much the same range of 45–55% at a concentration of 200 nM mRNA (the concentration used in Fig. 4A, lane 4), though the yield of free proteins followed the order of XA8 > A8 sequence (Fig. 4D). This suggests that when using the SP6 + {Omega}29 sequence as a 5' UTR, the effect of the A8 sequence as a 3' tail would apply to general mRNA templates in an IVV library for in vitro protein selection.

Efficient IVV formation using a Fluor-PEG Puro spacer
According to previous reports, the optimized efficiency of formation of fusions was 40% of the input mRNA ligated to a spacer and 50% of the total synthesized protein in a cell-free rabbit reticulocyte lysate translation system (3,4,17), and the rabbit reticulocyte lysate system was superior to the wheat germ system (3). However, we obtained the optimized efficient IVV formation in a cell-free wheat germ translation system (Fig. 4C). We have examined IVV formations of more than 10 genes based on both the total proteins and the input mRNAs with the A8 sequence ligated to the Fluor-PEG Puro spacer, and the range of the efficiency was much the same as that in Figure 4D, A8 (data not shown). In addition, this IVV formation procedure does not require any post-translational treatment, such as a maturation step (3,4,17). This indicates that the single-strand mRNA template ligated to the Fluor-PEG Puro spacer is able to form IVV rapidly and efficiently because of its superior flexibility. Here, the flexibility is provided by the flexible Fluor-PEG Puro spacer containing the least percentage of DNA (20%; Fig. 2C) and the single-strand mRNA template without hybridization sequences that impair the flexibility at the 3' end of mRNA. We consider that highly efficient IVV formation thus obtained is a key factor in allowing the preparation of larger libraries [up to 1014/ml, compared with the previously reported 1013/ml (3); calculated from Fig. 4A] with few free proteins in a cell-free wheat germ translation system for in vitro protein selection experiments. Such highly efficient IVV formation should also allow high-throughput in vitro selection both without a maturation procedure (3,4,17) and without purification (3,4,17) of mRNA–protein fusions after translation.

3' tail sequences of mRNA favoring efficient C-terminal protein labeling
We expected that the effect of XA8 > A8 sequence on the yield of free proteins (Fig. 4B, XA8 and A8) might not be irrelevant to the effect on the yield of proteins (Fig. 3B, lanes 1 and 4 in II). To establish whether the XA8 sequence enhances the yield of C-terminally labeled proteins more effectively than does the A8 sequence (Fig. 3B, lanes 1 and 4 in II) in general, we investigated the formation efficiency of C-terminally labeled proteins of c-Jun, c-Fos and cB1 with a Flag tag (Fig. 5A, Jun-Flag, Fos-Flag and CB1-Flag), and also c-Jun having a His tag (Fig. 5A, Jun-His). The formation efficiency of C-terminally labeled proteins of all mRNA templates of c-jun, c-fos and cB1 with an XA8 sequence at the 3' end was 3- to 5-fold higher than that in the case of an A8 sequence, confirming the XA8 > A8 sequence effect on the formation efficiency of C-terminally labeled proteins (Fig. 5A). Figure 5A also indicates that the formation efficiency of C-terminally labeled proteins was independent of the upstream sequence of XA8, such as a Flag tag or His tag. We can conclude that mRNA templates with the XA8 sequence are clearly preferable to those with the A8 sequence for the C-terminal labeling of proteins.



View larger version (57K):
[in this window]
[in a new window]
 
Figure 5. Effect of the 3' tail of mRNA on C-terminal protein labeling. (A) The formation of C-terminally labeled proteins was examined using 200 nM c-jun (Jun-Flag), c-fos (Fos-Flag), cB1 (cB1-Flag) and c-jun (Jun-His) mRNAs having a Flag tag or His tag followed by an XA8 or A8 sequence, respectively. The formation efficiency of C-terminally labeled proteins was normalized to the formation efficiency using Jun-Flag (XA8). (B) The remaining mRNA template having an XA8 (closed circles) or XA8 sequence ligated to the Fluor-PEG Puro(Boc) spacer (open circles) was examined in a cell-free wheat germ translation system in the presence of 400 µM puromycin. (C) The yield of C-terminally labeled proteins was examined using an mRNA template having an A8 (I), XA8 (II) or XA8 sequence ligated to the Fluor-PEG Puro(Boc) spacer (III). Translation was done in a cell-free wheat germ translation system at 26°C for 3 h. The yield of C-terminally labeled proteins was normalized to the yield of c-jun mRNA having an A8 sequence (I).

 
Efficient C-terminal protein labeling using a Fluor-PEG Puro(Boc) spacer
The half-life of c-jun mRNA with an XA8 sequence ligated to a Fluor-PEG Puro(Boc) spacer at the 3' end (Fig. 5B, open circles) was 5 h, whereas that of mRNA with an XA8 sequence (Fig. 5B, filled circles), but without a Fluor-PEG Puro(Boc) spacer at the 3' end, was 1 h. This result is consistent with the finding that the use of the Fluor-PEG Puro spacer led to an improvement of mRNA stability (Fig. 2C). Since enhanced stability of mRNA affects the improvement of translation efficiency (21,22), a spacer like the Fluor-PEG Puro(Boc) spacer that is unable to form IVV may enhance the formation efficiency of C-terminally labeled proteins (Fig. 1C, II). As expected, the formation efficiency of C-terminally labeled proteins of c-jun mRNA with an XA8 sequence ligated to the Fluor-PEG Puro(Boc) spacer (Fig. 5C, III) was twice that of the XA8 sequence without the spacer (Fig. 5C, II) and eight times higher than that in the case of an A8 sequence without the spacer (Fig. 5C, I). The result suggests that the Fluor-PEG Puro(Boc) spacer enhances the yield of C-terminally labeled proteins. Thus, we obtained an mRNA template with a Fluor-PEG Puro(Boc) spacer as a new tool for the efficient C-terminal labeling of proteins (Fig. 5C).

In conclusion, we obtained highly stable and efficient mRNA templates for puromycin technology by single-strand ligation with a flexible PEG spacer including the Fluor-PEG Puro spacer for IVV or the Fluor-PEG(Boc) Puro spacer for C-terminally labeled proteins. After the optimization of 5'- and 3'-terminal sequences using c-jun mRNA, the mRNA template offers the advantages of easy handling because of high stability and efficiency for IVV formation (70% of the input mRNA with the Fluor-PEG Puro spacer; 90% of total proteins), simplifying formerly tedious processes. To facilitate high-throughput in vitro protein selection for proteome exploration, as well as evolutionary protein engineering, the mRNA template with SP6 + {Omega}29 as a 5' UTR and the A8 sequence as a 3' sequence should be utilized for IVV formation in a selection of functional proteins, and the mRNA template with SP6 + {Omega}29 as a 5' UTR and XA8 sequence as a 3' sequence for C-terminal protein labeling in conjunction with protein microarrays and fluorescence cross-correlation spectroscopy (16) in a post-selection of functional proteins.


    ACKNOWLEDGEMENTS
 
We thank Dr N. Doi for gifts of pUC-Jun and pCMVV-FosCBPzz, Drs H. Okayama (University of Tokyo) and N. Matsumura for the gift of pCMVzzCBPcB1, and M. Nakamura, K. Miyatake and M. Matsumoto for their help throughout the experiments. This work was supported by Special Coordination Funds of the Science and Technology Agency (Ministry of Education, Culture, Sports, Science and Technology) of the Japanese Government.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS AND DISCUSSION
 REFERENCES
 

  1. Nemoto,N., Miyamoto-Sato,E., Husimi,Y. and Yanagawa,H. (1997) In vitro virus: bonding of mRNA bearing puromycin at the 3'-terminal end to the C-terminal end of its encoded protein on the ribosome in vitro. FEBS Lett., 414, 405–408.[CrossRef][Web of Science][Medline]

  2. Roberts,R.W. and Szostak,J.W. (1997) RNA–peptide fusions for the in vitro selection of peptides and proteins. Proc. Natl Acad. Sci. USA, 94, 12297–12302.[Abstract/Free Full Text]

  3. Liu,R., Barrick,J.E., Szostak,J.W. and Roberts,R.W. (2000) Optimized synthesis of RNA–protein fusions for in vitro protein selection. Methods Enzymol., 318, 268–293.[Web of Science][Medline]

  4. Barrick,J.E., Takahashi,T.T., Balakin,A. and Roberts,R.W. (2001) Selection of RNA-binding peptides using mRNA–peptide fusions. Methods, 23, 287–293.[CrossRef][Web of Science][Medline]

  5. Cho,G., Keefe,A.D. and Szostak,J.W. (2000) Constructing high complexity synthetic libraries of long ORFs using in vitro selection. J. Mol. Biol., 297, 309–319.[CrossRef][Web of Science][Medline]

  6. Wilson,D.S., Keefe,A.D. and Szostak,J.W. (2001) The use of mRNA display to select high-affinity protein-binding peptides. Proc. Natl Acad. Sci. USA, 98, 3750–3755.[Abstract/Free Full Text]

  7. Keefe,A.D. and Szostak,J.W. (2001) Functional proteins from a random-sequence library. Nature, 410, 715–718.[CrossRef][Medline]

  8. Mattheakis,L.C., Bhatt,R.R. and Dower,W.J. (1994) An in vitro polysome display system for identifying ligands from very large peptide libraries. Proc. Natl Acad. Sci. USA, 91, 9022–9026.[Abstract/Free Full Text]

  9. Hanes,J. and Plückthun,A. (1997) In vitro selection and evolution of functional proteins by using ribosome display. Proc. Natl Acad. Sci. USA, 94, 4937–4942.[Abstract/Free Full Text]

  10. Hanes,J., Schaffitzel,C., Knappik,A. and Plückthun,A. (2000) Picomolar affinity antibodies from a fully synthetic naive library selected and evolved by ribosome display. Nat. Biotechnol., 12, 1287–1292.

  11. Doi,N. and Yanagawa,H. (1999) STABLE: protein–DNA fusion system for screening of combinatorial protein libraries in vitro. FEBS Lett., 457, 227–230.[CrossRef][Web of Science][Medline]

  12. Hammond,P.W., Alpin,J., Rise,C.E., Wright,M.C. and Kreider,B.L. (2001) In vitro selection and characterization of Bcl-XL binding proteins from a mix of tissue-specific mRNA display libraries. J. Biol. Chem., 276, 20898–20906.[Abstract/Free Full Text]

  13. McPherson,M., Yang,Y., Hammond,P.W. and Kreider,B.L. (2002) Drug receptor identification from multiple tissues using cellular-derived mRNA display libraries. Chem. Biol., 9, 691–698.[CrossRef][Web of Science][Medline]

  14. Miyamoto-Sato,E., Nemoto,N., Kobayashi,K. and Yanagawa,H. (2000) Specific bonding of puromycin to full-length protein at the carboxyl terminus. Nucleic Acids Res., 28, 1176–1182.[Abstract/Free Full Text]

  15. Nemoto,N., Miyamoto-Sato,E. and Yanagawa,H. (1999) Fluorescence labeling of the C-terminus of proteins with a puromycin analogue in cell-free translation systems. FEBS Lett., 462, 43–46.[CrossRef][Web of Science][Medline]

  16. Doi,N. Takashima,H., Kinjo,M., Sakata,K., Kawahashi,Y., Oishi,Y., Oyama,R., Miyamoto-Sato,E., Sawasaki,T., Endo,Y. et al. (2002) Novel fluorescence labeling and high-throughput assay technologies for in vitro analysis of protein interactions. Genome Res., 12, 487–492.[Abstract/Free Full Text]

  17. Kurz,M., Gu,K. and Lohse,P.A. (2000) Psoralen photo-crosslinked mRNA–puromycin conjugates: a novel template for the rapid and facile preparation of mRNA–protein fusions. Nucleic Acids Res., 28, e83.[Abstract/Free Full Text]

  18. Jäschke,A., Fürste,J.P., Cech,D. and Erdmann,V.A. (1993) Automated incorporation of polyethylene glycol into synthetic oligonucleotides. Tetrahedron Lett., 34, 301–304.[CrossRef]

  19. Ikeda,S. and Saito,I. (1998) Facile synthesis of puromycin-tethered oligonucleotides at the 3'-end. Tetrahedron Lett., 39, 5975–5978.[CrossRef]

  20. Romaniuk,E., McLaughlin,L.W., Neilson T. and Romaniuk,P.J. (1982) The effect of acceptor oligoribonucleotide sequence on the T4 RNA ligase reaction. Eur. J. Biochem., 125, 639–643.[Web of Science][Medline]

  21. Madin,K., Sawasaki,T. Ogasawara,T. and Endo,Y. (2000) A highly efficient and robust cell-free protein synthesis system prepared from wheat embryos: plants apparently contain a suicide system directed at ribosomes. Proc. Natl Acad. Sci. USA, 97, 559–564.[Abstract/Free Full Text]

  22. Sachs,A.B., Sarrow,P. and Hentze,M.W. (1997) Starting at the beginning, middle and end: translation initiation in eukaryotes. Cell, 89, 831–838.[CrossRef][Web of Science][Medline]

  23. Sleat,D.E., Gallie,D.R., Jefferson,R.A., Bevan,M.W., Turner,P.C. and Wilson,T.M. (1987) Characterization of the 50-leader sequence of tobacco mosaic virus RNA as a general enhancer of translation in vitro. Gene, 60, 217–225.[CrossRef][Web of Science][Medline]

  24. Kozak,M. (1986) Point mutations define a sequence flanking the AUG initiator codon that modulates translation by eukaryotic ribosomes. Cell, 44, 283–292.[CrossRef][Web of Science][Medline]


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
Nucleic Acids ResHome page
J. Yamaguchi, M. Naimuddin, M. Biyani, T. Sasaki, M. Machida, T. Kubo, T. Funatsu, Y. Husimi, and N. Nemoto
cDNA display: a novel screening method for functional disulfide-rich peptides by solid-phase synthesis and stabilization of mRNA-protein fusions
Nucleic Acids Res., September 1, 2009; 37(16): e108 - e108.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. ProteomicsHome page
X. Shen, G. Xi, Y. Radhakrishnan, and D. R. Clemmons
Identification of Novel SHPS-1-associated Proteins and Their Roles in Regulation of Insulin-like Growth Factor-dependent Responses in Vascular Smooth Muscle Cells
Mol. Cell. Proteomics, July 1, 2009; 8(7): 1539 - 1551.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
N. Tabata, Y. Sakuma, Y. Honda, N. Doi, H. Takashima, E. Miyamoto-Sato, and H. Yanagawa
Rapid antibody selection by mRNA display on a microfluidic chip
Nucleic Acids Res., May 1, 2009; 37(8): e64 - e64.
[Abstract] [Full Text] [PDF]


Home page
J BiochemHome page
Y. Kawahashi, N. Doi, Y. Oishi, C. Tsuda, H. Takashima, T. Baba, H. Mori, T. Ito, and H. Yanagawa
High-throughput Fluorescence Labelling of Full-length cDNA Products Based on a Reconstituted Translation System
J. Biochem., January 1, 2007; 141(1): 19 - 24.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
I. Fukuda, K. Kojoh, N. Tabata, N. Doi, H. Takashima, E. Miyamoto-Sato, and H. Yanagawa
In vitro evolution of single-chain antibodies using mRNA display
Nucleic Acids Res., November 14, 2006; 34(19): e127 - e127.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
R. Oyama, H. Takashima, M. Yonezawa, N. Doi, E. Miyamoto-Sato, M. Kinjo, and H. Yanagawa
Protein-protein interaction analysis by C-terminally specific fluorescence labeling and fluorescence cross-correlation spectroscopy
Nucleic Acids Res., September 1, 2006; 34(14): e102 - e102.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
S. Tateyama, K. Horisawa, H. Takashima, E. Miyamoto-Sato, N. Doi, and H. Yanagawa
Affinity selection of DNA-binding protein complexes using mRNA display
Nucleic Acids Res., February 14, 2006; 34(3): e27 - e27.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
N. Muranaka, T. Hohsaka, and M. Sisido
Four-base codon mediated mRNA display to construct peptide libraries that contain multiple nonnatural amino acids.
Nucleic Acids Res., January 1, 2006; 34(1): e7 - e7.
[Abstract] [Full Text] [PDF]


Home page
Genome ResHome page
E. Miyamoto-Sato, M. Ishizaka, K. Horisawa, S. Tateyama, H. Takashima, S. Fuse, K. Sue, N. Hirai, K. Masuoka, and H. Yanagawa
Cell-free cotranslation and selection using in vitro virus for high-throughput analysis of protein-protein interactions and complexes
Genome Res., May 1, 2005; 15(5): 710 - 717.
[Abstract] [Full Text] [PDF]


Home page
J BiochemHome page
K. Horisawa, N. Doi, H. Takashima, and H. Yanagawa
Application of Quantitative Real-Time PCR for Monitoring the Process of Enrichment of Clones on In Vitro Protein Selection
J. Biochem., February 1, 2005; 137(2): 121 - 124.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
K. Horisawa, S. Tateyama, M. Ishizaka, N. Matsumura, H. Takashima, E. Miyamoto-Sato, N. Doi, and H. Yanagawa
In vitro selection of Jun-associated proteins using mRNA display
Nucleic Acids Res., December 2, 2004; 32(21): e169 - e169.
[Abstract] [Full Text] [PDF]


Home page
J BiochemHome page
M. Yonezawa, N. Doi, T. Higashinakagawa, and H. Yanagawa
DNA Display of Biologically Active Proteins for In Vitro Protein Selection
J. Biochem., March 1, 2004; 135(3): 285 - 288.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Print PDF (375K) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrowRequest Permissions
Right arrow Commercial Re-use Guidelines
for Open Access NAR Content
Google Scholar
Right arrow Articles by Miyamoto-Sato, E.
Right arrow Articles by Yanagawa, H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Miyamoto-Sato, E.
Right arrow Articles by Yanagawa, H.
Related Collections
Right arrow RNA characterisation and manipulation
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?