Nucleic Acids Research, 2003, Vol. 31, No. 21 e130
© 2003 Oxford University Press
Short bioactive Spiegelmers to migraine-associated calcitonin gene-related peptide rapidly identified by a novel approach: Tailored-SELEX
NOXXON Pharma AG, Max-Dohrn-Strasse 810, D-10589 Berlin, Germany
*To whom correspondence should be addressed. Tel: +49 30 726247 240; Fax: +49 30 726247 243; Email: sklussmann{at}noxxon.net
The authors wish to be known that, in their opinion, the first two authors should be regarded as joint First Authors
Received August 7, 2003; Revised and Accepted September 10, 2003
| ABSTRACT |
|---|
|
|
|---|
We developed an integrated method to identify aptamers with only 10 fixed nucleotides through ligation and removal of primer binding sites within the systematic evolution of ligands by exponential enrichment (SELEX) process. This Tailored-SELEX approach was validated by identifying a Spiegelmer (mirror-image aptamer) that inhibits the action of the migraine-associated target calcitonin gene-related peptide 1 (
-CGRP) with an IC50 of 3 nM at 37°C in cell culture. Aptamers are oligonucleotide ligands that can be generated to bind to targets with high affinity and specificity. Stabilized aptamers and Spiegelmers have shown activity in vivo and may be used as therapeutics. Aptamers are isolated by in vitro selection from combinatorial nucleic acid libraries that are composed of a central randomized region and additional fixed primer binding sites with
3040 nt. The identified sequences are usually not short enough for efficient chemical Spiegelmer synthesis, post-SELEX stabilization of aptamers and economical production. If the terminal primer binding sites are part of the target recognizing domain, truncation of aptamers has proven difficult and laborious. Tailored-SELEX results in short sequences that can be tested more rapidly in biological systems. Currently, our identified CGRP binding Spiegelmer serves as a lead compound for in vivo studies. | INTRODUCTION |
|---|
|
|
|---|
Since the invention of in vitro selection of oligonucleotides from combinatorial nucleic acid libraries, also known as systematic evolution of ligands by exponential enrichment (SELEX), the use of these molecules (termed aptamers) as therapeutics, e.g. for the specific interruption of disease-related proteinprotein interactions, has been predicted and aspired (13). Aptamers usually show binding constants to their respective protein or peptide targets in the same range as most receptorligand interactions and exhibit a high substrate specificity (46).
In order to move aptamers from the bench to the clinic, several hurdles have to be taken. The most prominent ones are the issues of aptamer stability in biological fluids and production costs. Stabilization of aptamers against abundant nucleases has been improved by the introduction of chemically modified nucleic acid libraries (pre-SELEX modifications) in combination with post-SELEX modifications, that both rely on the substitution of the RNAs 2'-OH group (710). In a second strategy, chiral principles were introduced into the SELEX process in order to generate nuclease resistant aptamers on the basis of L-RNA or L-DNA, so-called Spiegelmers (from the German Spiegel, meaning mirror) (11). Spiegelmers are identified through in vitro selection of an unmodified D-RNA or D-DNA library against the mirror-image configuration (enantiomer) of a drug target. The selected aptamer sequences are then synthesized in their unnatural enantiomeric configuration as L-RNAs or L-DNAs. Following the rules of symmetry, these Spiegelmers bind to the natural target of interest just like the aptamers bind to the mirror-image selection target (1113). Aptamers with pre- and post-SELEX modifications as well as Spiegelmers have been reported to be stable for many hours in biological fluids (11,14).
For both strategies, the ability to chemically synthesize the lead candidates is crucial, since neither post-SELEX-modified aptamers nor Spiegelmers can be synthesized enzymatically due to the lack of appropriate enzymes. However, aptamers and Spiegelmers that are identified through the standard SELEX process usually comprise 6090 nt, since they are typically selected from nucleic acid libraries with 3040 nt long randomized regions plus fixed primer sites of
1525 nt on each side. Standard chemical oligoribonucleotide synthesis, however, is only efficiently applicable up to 60 nt, with decreasing yields and escalating production costs for every incorporated base.
Therefore, the identified lead oligonucleotides need rational and experimental truncation before they can be further tested in biological systems (15). Whether or not the truncation of a given lead aptamer or Spiegelmer will eventually succeed, may not be foreseen. The flanking fixed regions sometimes participate in forming the scaffold that surrounds the binding interface and may thus not simply be omitted (1618).
Here we describe a methodology that allows the direct and rapid isolation of target binding RNA sequences that only require 10 fixed nucleotides in addition to the random region. The novel procedure, which we named Tailored-SELEX, relies on customized primers/adapters that are added by ligation before and removed within the amplification processes.
In order to prove the efficiency of Tailored-SELEX, we carried out an in vitro selection approach against the optical antipode of the neuropeptide calcitonin gene-related peptide 1 (
-CGRP) of rat.
-CGRP has been recognized as a potent vasodilator and has recently attracted attention as a novel target in acute migraine treatment (1922).
| MATERIALS AND METHODS |
|---|
|
|
|---|
Oligonucleotides and peptides
All oligonucleotides were synthesized at NOXXON Pharma AG using standard phosphoramidite chemistry. C-terminal biotinylated rat D-
-CGRP [all-D-(SerCysAsnThrAlaThrCysValThrHisArgLeuAlaGlyLeuLeuSerArgSerGlyGlyValValLysAspAsnPheValProThrAsnValGlySerGluAlaPhe)-
-biotinyl-Lys-NH2] and rat L-
-CGRP were purchased from Bachem (Bubendorf, Switzerland).
In vitro selection procedure
Three complexities of a combinatorial RNA library (5'-GGAC-N40-GACAGG) of 1015 different molecules, that was obtained by in vitro transcription of a synthetic ssDNA library (5'-COMeCOMeTGTC-N40-GTCCTATAGTGAGTCGTATTAGTAGTCGC) in the presence of a 1.5-fold excess of the forward primer (5'-GCGACTACTAATACGACTCACTATAGGAC), were used as the starting library. The last two nucleotides of the 5' terminus of the DNA library were modified with 2'-methoxy-cytidines in order to reduce the non-templated nucleotide addition at the 3' terminus of the in vitro transcripts.
Before each selection round, the RNA library was dissolved in 10 mM HEPES/KOH pH 7.4, 150 mM NaCl, 4 mM KCl and denatured (95°C, 5 min). It was then allowed to cool to 23 or 37°C for 15 min and CaCl2 (final 1 mM), MgCl2 (final 1 mM) and Tween (final 0.05%) were added to give the final selection buffer. In the first five rounds the biotinylated rat D-
-CGRP concentration was 10 µM. In later rounds the peptide concentration was consecutively reduced to reach 1 nM in round 14. The selection process was carried out at 23°C for rounds 19 and at 37°C for rounds 1015 (see Fig. 5). Neutravidin Agarose or Streptavidin Ultralink beads (Pierce, Rockford, IL) were utilized as selection matrices for the immobilization of the RNApeptide complexes. The matrix was equilibrated with selection buffer before use. The selection process included a pre-column to prevent accumulation of non-specific matrix binders (pure selection matrix, 30 min incubation) from round 2 onwards. The binding reaction of RNA and peptide was done in solution for 2 up to 12 h. The complexes of RNA and biotinylated rat D-
-CGRP were immobilized for 30 min on the selection matrix. Non-binding oligonucleotides were removed by washing with 1025 matrix volumes of selection buffer. Bound RNA was eluted twice (8 M urea, 10 mM EDTA, 65°C, 15 min), extracted with phenol/chloroform/isoamyl alcohol, precipitated with ethanol and dissolved in water.
|
Ligation and amplification
The ligation reaction was done at 25°C for 12 h [71.4 or 357 nM RNA with 36 or 7.2 UT4 DNA ligase/pmolRNA (Fermentas, St Leon-Roth, Germany), respectively, depending on the amount of eluted RNA, 1x ligation buffer (Fermentas), 5% PEG 4000, 0.5 µl of RNaseOUT (Invitrogen, Karlsruhe, Germany), a 20-fold excess of forward adapter and a 20-fold excess of reverse adapters]. The adapters are double-stranded oligonucleotides: forward adapter [forward ligate (RNA, 5'-GCG ACUACUAAUACGACUCACUAUA) plus forward bridge (DNA, 5'-GTCCTATAGTGAGTCG-3'dT) with 2'-3'-dideoxythymidine at the 3' terminus], reverse adapter 1 [reverse ligate 1 (DNA, pACGCTGAGCTGAACTCG-3'dC, 5'-phosphorylated and 3'-blocked) plus reverse bridge 1 (DNA, 5'-GCGAGT TCAGCUOHCAGCGUOHCCTGTC) with two incorporated ribonucleotides] and reverse adapter 2 [reverse ligate 2 (DNA, 5'-pCGCTGAGCTGAACTCG-3'dC, 5'-phosphorylated and 3'-blocked) plus reverse bridge 2 (DNA, 5'-GCGAGTTCAGCUOHCAGCGIOHCCTGTC) with two incorporated ribonucleotides]. Reverse adapter 2 was added to the ligation reaction (10-fold excess of reverse adapter 1 and 2 each) from round 2 onwards. The reverse transcription reaction was carried out without intermediate purification at a final RNA concentration of 30 or 150 nM for 20 min at 51°C and 10 min at 54°C [1x First strand buffer (Invitrogen), 1x Q solution (Qiagen, Hilden, Germany), 0.5 mM dNTPs (Larova, Teltow, Germany), 4 U/µl Superscript Reverse Transcriptase II (Invitrogen), 10 mM DTT]. The cDNA was directly transferred to the PCR [110 nM cDNA, 1x PCR buffer (Roche), 5 µM forward primer, 5 µM reverse primer, 0.2 mM dNTPs (Larova), 0.05 U/µl Taq DNA polymerase (Roche, Mannheim, Germany), annealing temperature at 68°C, 715 cycles]. The cleavage of the PCR reverse strand was done by alkaline fission of the ribonucleotides [310 mM (final) NaOH, 10 min at 95°C, neutralization with HCl, buffered with 0.1 mM (final) sodium acetate]. The PCR product was ethanol precipitated before in vitro transcription [80 mM HEPES/KOH pH 7.5, 22 mM MgCl2, 1 mM spermidine, 10 mM DTT, 1.2 µg/µl BSA, [
-32P]GTP (Hartmann, Braunschweig, Germany), 4 mM NTPs (Larova), 32 mM 5'-GMP (Sigma, Taufkirchen, Germany), 1 µl RNaseOUT (Invitrogen), 0.1 U/µl T7 RNA polymerase (Stratagene, La Jolla, CA) at 37°C for 612 h]. The transcribed RNA was gel-purified (23). The enriched library from round 15 was ligated and PCR amplified with all DNA primers before cloning and sequencing (GATC, Konstanz, Germany).
Bioassay
The bioassay was performed with SK-N-MC human neuroblastoma cells (DSMZ, Braunschweig, Germany) which endogenously express the CGRP1 receptor. Cells were grown at 37°C and 5% CO2 in DMEM (1 mg/l glucose), further containing 10% heat-inactivated fetal calf serum, 4 mM L-alanyl-L-glutamine, 50 U/ml penicillin, 50 µg/ml streptomycin, and, for experiments, seeded at 4 x 104 in 96-well microtiter plates. The Spiegelmers were pre-incubated in different concentrations with 1 nM rat
-CGRP in Hanks balanced salt solution plus 1 mg/ml BSA (60 min, 37°C). Twenty minutes before the stimulation, the cells were pre-treated with 1 mM isobutyl-1-methylxanthin (IBMX). IBMX (1 mM) was also added to the CGRP/Spiegelmer solutions. For stimulation, the medium was removed and the CGRP/Spiegelmer mixtures were added to the cells. After 30 min stimulation at 37°C, the cells were lysed and the cAMP content of the cell extract was quantified using cAMP-ScreenTM System kits (Applied Biosystems, Foster City, CA). The luminescence signal was detected by a POLARstar Galaxy multi-detection microplate reader (BMG, Offenburg, Germany).
| RESULTS |
|---|
|
|
|---|
The conventional SELEX process, which comprises alternating steps of selection and amplification, is carried out with oligonucleotide libraries consisting of 6090 nt. The method we have devised is performed with a 50 nt long library that consists of a 40 nt long randomized region plus a total of 10 fixed flanking nucleotides. The fixed regions are necessary for an efficient ligation of the primer binding sites that are needed for the amplification steps. These oligonucleotides (referred to as ligates) are enzymatically ligated to the core library with the assistance of bridging oligonucleotides (bridges) that are complementary to one of the ligates and the respective fixed sequence of the RNA library (Fig. 1A).
|
All reactions that contribute to the amplification, including ligation and removal of the primers before the next selection round, may be pursued in a single reaction vessel without the need for additional purification steps (Fig. 2).
|
Ligation
Since the ligation of the primer binding sites takes place with a finite number of molecules that survived the selection step, high ligation yields are desirable in order to propagate the binding sequences. This is particularly true in the first rounds, where only a few copies of each molecule are present. Ligation yields of 80% were attained with highly concentrated T4 DNA ligase and a DNA bridge assisted ligation strategy (24). The bridging is achieved by the overhanging reverse strands of double-stranded adapter molecules that are complementary to the fixed nucleotides of the library. Four and six fixed nucleotides at the 5' and 3' ends, respectively, proved to be the minimum required length of the fixed sequence parts. Nevertheless, three fixed nucleotides are necessary on the 5' end to accommodate the transcription initiation sequence GG-purine. Furthermore, the ligation strategy proved functional not only for RNA, but also for 2'-F-pyrimidine-RNA.
Design of the forward adapter
The forward adapter consists of the forward ligate (the oligonucleotide that is ligated to the RNA) and the forward bridge. The adapter has a recessive 3' end that is complementary to the four fixed nucleotides at the 5' end of the library. While the forward bridge was made of DNA, the forward ligate was made from RNA, since RNA is a better substrate in the subsequent reverse transcription step. The forward adapter was chosen to contain a T7 RNA polymerase promoter directly upstream of the ligation site. The forward bridge was made up of only 17 nt to prevent hindrance of cDNA synthesis during reverse transcription at elevated temperatures.
Unused adapter molecules are carried over into the PCR, because no purification step between ligation and amplification is foreseen. PCR mispriming, however, is a common event during the amplification of nucleic acid libraries, due to the heterogeneous nature of the randomized region and the high primer concentrations commonly used. In order to avoid elongation of the forward bridge and potential ligation side products, we introduced a 2'-3'-dideoxy nucleotide at its 3' end.
Design of the reverse adapters
Two different kinds of reverse adaptersboth made predominantly from DNAwere used. The reverse adapter 1 was designed to accommodate RNA molecules with the 6 nt long 3' fixed region at its 5' recessive end. The reverse ligate 1 carries a 5' phosphate since it is the phosphate donor in the ligation reaction. The 3' end is blocked by a 2'-3'-dideoxynucleotide in analogy to the forward bridge. The reverse bridge 1 was not blocked since it serves as cDNA and PCR primer. In order to dispose of the primer region before the next selection step, two ribonucleotides were incorporated in the reverse bridge 1 so as to create predetermined breaking points at alkaline pH.
However, up to 50% of the products of run-off in vitro transcriptions with T7 RNA polymerase contain an additional nucleotide at their 3' ends (25). This phenomenon, which is known as 3' microheterogeneity, strongly confines the 3' ligation efficiency of the bridge-assisted ligation because no undistorted duplex can be formed at the ligation site (26).
Hence, for an efficient ligation of the inevitable N + 1 transcripts that are formed within the repetitive SELEX process, we designed a reverse adapter 2. It consists of the 5' phosphorylated 3' blocked reverse ligate 2 that lacks the first 5' nucleotide in order to accommodate the additional base of the N + 1 transcripts (Fig. 1B). Hybridized to the reverse ligate 2 is the reverse bridge 2, which is identical to reverse bridge 1 in all but one position: we substituted the uridine at the 3' cleavage site with the universal nucleobase analog inosine that can base pair with any base at the transcripts N + 1 position, so that T4 DNA ligase will ligate the paired ends. Analogous to the uridine in the reverse bridge 1, the inosine nucleotide also served as a predetermined fission point at alkaline pH. By using an equimolar mixture of the reverse adapters 1 and 2, overall ligation yields were improved from 40 up to 80% (Fig. 3).
|
Reverse transcription, PCR and alkaline fission
Reverse transcription was performed at the highest possible temperature in order to resolve RNA secondary structures and to ease the removal of the forward bridge, which might interfere with cDNA synthesis.
Twenty to 100 pmol of PCR product accumulated from 10 fmol to 5 pmol of template per 100 µl of PCR within 715 cycles. The forward primer resembles the forward ligate but additionally extends into the GC-rich 5' fixed region of the nucleic acid pool to improve priming efficiency. The PCR reverse primer is identical to the reverse bridge. It contains two ribonucleotides to provide for alkaline fission. The second ribonucleotide is incorporated in order to prevent the cleaved reverse primer from re-hybridizing to the forward strand that might lead to a possible read-through of the RNA polymerase.
Cleavage of the PCR product under alkaline conditions leads to strands of unequal length, as the reverse strand lacks the unwanted reverse primer site (Fig. 4).
|
In vitro transcription
The cleaved PCR product then serves as a template for the in vitro transcription. Since the T7 RNA polymerase promoter is located in the forward primer and the forward ligate upstream of the ligation site, the transcripts commence with the identical initiation sequence that is equal to the 5' fixed sequence of the nucleic acid library. The sequence was designed to provide for a high transcription yield (27) and a good ligation efficiency. Additionally, we included an excess of guanosine monophosphate as an initiation nucleotide into the transcription reaction, so that the majority of the transcripts contain a 5' monophosphate that is required for the next ligation step.
Identification of
-CGRP binding Spiegelmers
As a proof of concept, we carried out 15 rounds of in vitro selection against the unnatural enantiomer of rat
-CGRP. After the fifth selection round, enrichment of binding sequences became visible. In subsequent selection rounds, the peptide concentration was successively decreased from the initial 10 µM to 30 nM in round 9, without loss of pool binding. We also increased the stringency by switching from room temperature to 37°C after round 9. In round 15, no more progress could be achieved (Fig. 5). With regard to pool binding or variations in sequence length, the system proved to be stable within the conducted 15 rounds of selection/amplification. The enriched pool of round 15 was cloned and 38 sequences were determined, 14 of which were different (Fig. 6). Their length varied between 48 and 52 nt, which is probably due to errors of the polymerases involved. By sequence alignment we identified four motifs that occurred in every sequence, either alone or in combination with each other. One of these motifs was found to occur in three families both as a full-length motif (24 nt) or as a truncated version (11 nt).
|
Biological activity of the Spiegelmers
Nine sequences were synthesized as Spiegelmers, without the need for prior truncation and further modification for their testing in cell culture. All Spiegelmers tested blocked rat
-CGRP-induced cAMP formation with an IC50 of 500 nM or better, but with no clear preference for any of the four primary sequence motifs. The best inhibition was observed with Spiegelmer STAR-F12 with an IC50 of 3 nM (Fig. 7). The inverse Sequence STAR-F12inv served as a control and showed no inhibitory effect. While the 5' fixed sequence of the Spiegelmer STAR-F12 was needed for target binding, the six 3' terminal fixed nucleotides could be removed. The resulting 42mer STAR-F12-
4348 had an IC50 of 3 nM, the same inhibition potency as the full-length Spiegelmer.
|
Since the relationship between intracellular cAMP production and the concentration of free extracellular CGRP was linear under our experimental conditions, the dissociation constant KD almost equals the IC50. However, due to the almost equimolar concentrations of Spiegelmer and CGRP at the IC50, the apparent IC50 is slightly higher than the dissociation constant KD. The calculation of KD following the equation KD = IC50 0.5 x [CGRP] leads to a dissociation constant of 2.5 nM.
| DISCUSSION |
|---|
|
|
|---|
Since the invention of the SELEX process, a large number of aptamers and several Spiegelmers active against a variety of biologically relevant targets have been generated (6). However, the transition from the biochemical and biophysical laboratory into living systems like cell culture, animals or even man, has been achieved only in a small number of them so far (28). One of the challenges is still the biological stability of oligonucleotides. Even for 2'-F- or 2'-NH2-pyrimidine-RNA aptamers, the introduction of additional 2' modifications at as many purine positions as possible is desirable. Such post-SELEX-modified aptamers can only be produced by chemical methods. Spiegelmers are biostable due to their unnatural configuration and require chemical synthesis as well. This is not accomplished easily since the partially stabilized aptamer candidates that are identified by the SELEX process are between 60 and 90 nt in length and to date only shorter RNAs with <60 nt are efficiently produced chemically at reasonable costs. As yields decrease with every coupling step, shorter sequences will be preferable for economical reasons, as soon as larger batches for animal tests are to be produced. Therefore, time-consuming experimental truncation processes that do not always lead to the desired results need to be carried out before Spiegelmers or biostable aptamers are available.
We have developed the Tailored-SELEX strategy to afford the identification of short aptamers by ligation and removal of primer binding sites within the amplification part of the selection-amplification scheme. The candidates are only 10 nt longer than the randomized region of the initial library.
Alternative strategies, e.g. blocking of primer binding sites by hybridization of complementary oligonucleotides, fishing of truncated sequences with full-length complementary strands and further ligation strategies, have been proposed by Toole et al. and Pagratis et al. in the patent literature (29,30).
Tailored-SELEX is simple and requires only a little more hands-on time than a conventional SELEX process. The two extra steps, namely ligation of primers and alkaline fission of the PCR product, compare favorably with the time needed for post-SELEX truncation protocols. This holds especially true for the generation of aptamers against flexible peptides that require a structurally rigid binding partner. In these instances, the aptamer provides a scaffold and an epitope for high affinity binding, which is often governed by an induced fit mechanism by the peptide (31). Since the length of the aptamers target binding sequence could generally not be influenced by the experimental set-up, truncated peptide-directed aptamers were found to involve at least 50 nt, which is substantially longer than truncated protein-directed aptamers. An exception is provided by the truncated aptamers binding the arginine-rich core motif of the HIV-1 Rev-protein, which are only 27 and 35 nt in length, probably because binding of arginines to nucleic acids is very advantageous (32).
The calculated affinity (KD = 2.5 nM at 37°C) of the best rat
-CGRP binding Spiegelmer (STAR-F12) almost reaches the binding constant of the neuropeptide to its receptor (EC50 = 1 nM). The dissociation constants can be compared well with those of aptamers that were directed against larger proteins such as IgE (10 nM, 37°C) (17), tyrosine phosphatase (18 nM, room temperature) (18) or complement C5 (20 and 2 nM after reselection, 37°C) (33). Peptide-directed aptamers usually display higher dissociation constants for their respective targets, as reported for aptamers against substance P (190 nM, room temperature) (16), the arginine-rich peptide fragment of HIV Rev (19 nM, 47°C) (34), K-Ras derived farnesylated peptide (139 nM, 23°C) (35) and neuropeptide Y (370 nM at 37°C) (36) or the Spiegelmers against vasopressin (900 nM, room temperature) (12), GnRH (20100 nM, room temperature) (13,37) or a 25 amino acid domain of Staphylococcal Enterotoxin B (200 nM, room temperature) (38). A different measure has to be applied to aptamers directed to nucleic acid and heparin binding proteins. Due to the favorable biophysical nature of these targets, resulting aptamers frequently show picomolar dissociation constants (6).
In conclusion, the above data confirm that Tailored-SELEX is suitable to identify not only short, but also high-affinity, aptamers/Spiegelmers. Additionally, the reported methods are ready to be implemented into an automated selection protocol. Further studies will address target and species specificity of our nuclease-resistant rat
-CGRP binding Spiegelmer in cell culture. Its potential to act as a CGRP antagonist in vivo and its feasibility in the treatment of migraine will be tested in animal models in the near future.
| ACKNOWLEDGEMENTS |
|---|
The authors wish to thank Nura Sayed Suleiman and Angelika Dahlke for their technical assistance, Axel Wettich for his ideas, Petra Burgstaller, the oligonucleotide synthesis team at NOXXON Pharma AG, Steffen Helmling and Lara Zilberkweit for their critical reviews of the manuscript and Christian Mihm for the artwork in Figure 1. We are also grateful for the help of Clemens Gillen and the molecular pain research group at Grünenthal GmbH, Aachen, Germany.
| REFERENCES |
|---|
|
|
|---|
- Ellington,A.D. and Szostak,J.W. (1990) In vitro selection of RNA molecules that bind specific ligands. Nature, 346, 818822.[CrossRef][Medline]
- Tuerk,C. and Gold,L. (1990) Systematic evolution of ligands by exponential enrichment: RNA ligands to bacteriophage T4 DNA polymerase. Science, 249, 505510.
[Abstract/Free Full Text] - Ellington,A.D. and Szostak,J.W. (1992) Selection in vitro of single-stranded DNA molecules that fold into specific ligand-binding structures. Nature, 355, 850852.[CrossRef][Medline]
- Gold,L., Polisky,B., Uhlenbeck,O. and Yarus,M. (1995) Diversity of oligonucleotide functions. Annu. Rev. Biochem., 64, 763797.[CrossRef][ISI][Medline]
- Conrad,R., Keranen,L.M., Ellington,A.D. and Newton,A.C. (1994) Isozyme-specific inhibition of protein kinase C by RNA aptamers. J. Biol. Chem., 269, 3205132054.
[Abstract/Free Full Text] - James,W. (2000) Aptamers. In Meyers,R.A. (ed.), Encyclopedia of Analytical Chemistry. John Wiley & Sons, Chichester, UK, pp. 48484871.
- Lin,Y., Qiu,Q., Gill,S.C. and Jayasena,S.D. (1994) Modified RNA sequence pools for in vitro selection. Nucleic Acids Res., 22, 52295234.
[Abstract/Free Full Text] - Eaton,B.E. and Pieken,W.A. (1995) Ribonucleosides and RNA. Annu. Rev. Biochem., 64, 837863.[CrossRef][ISI][Medline]
- Ruckman,J., Green,L.S., Beeson,J., Waugh,S., Gillette,W.L., Henninger,D.D., Claesson-Welsh,L. and Janjic,N. (1998) 2'-Fluoropyrimidine RNA-based aptamers to the 165-amino acid form of vascular endothelial growth factor (VEGF165). Inhibition of receptor binding and VEGF-induced vascular permeability through interactions requiring the exon 7-encoded domain. J. Biol. Chem., 273, 2055620567.
[Abstract/Free Full Text] - Green,L.S., Jellinek,D., Bell,C., Beebe,L.A., Feistner,B.D., Gill,S.C., Jucker,F.M. and Janjic,N. (1995) Nuclease-resistant nucleic acid ligands to vascular permeability factor/vascular endothelial factor. Chem. Biol., 2, 683695.[CrossRef][ISI][Medline]
- Klussmann,S., Nolte,A., Bald,R., Erdmann,V.A. and Furste,J.P. (1996) Mirror-image RNA that binds D-adenosine. Nat. Biotechnol., 14, 11121115.[CrossRef][ISI][Medline]
- Williams,K.P., Liu,X.H., Schumacher,T.N., Lin,H.Y., Ausiello,D.A., Kim,P.S. and Bartel,D.P. (1997) Bioactive and nuclease-resistant L-DNA ligand of vasopressin. Proc. Natl Acad. Sci. USA, 94, 1128511290.
[Abstract/Free Full Text] - Leva,S., Lichte,A., Burmeister,J., Muhn,P., Jahnke,B., Fesser,D., Erfurth,J., Burgstaller,P. and Klussmann,S. (2002) GnRH binding RNA and DNA Spiegelmers: a novel approach toward GnRH antagonism. Chem. Biol., 9, 351359.[CrossRef][ISI][Medline]
- Pagratis,N.C., Bell,C., Chang,Y.F., Jennings,S., Fitzwater,T., Jellinek,D. and Dang,C. (1997) Potent 2'-amino- and 2'-fluoro-2'-deoxyribonucleotide RNA inhibitors of keratinocyte growth factor. Nat. Biotechnol., 15, 6873.[CrossRef][ISI][Medline]
- White,R.R., Sullenger,B.A. and Rusconi,C.P. (2000) Developing aptamers into therapeutics. J. Clin. Invest., 106, 929934.[ISI][Medline]
- Nieuwlandt,D., Wecker,M. and Gold,L. (1995) In vitro selection of RNA ligands to substance P. Biochemistry, 34, 56515659.[CrossRef][Medline]
- Wiegand,T.W., Williams,P.B., Dreskin,S.C., Jouvin,M.H., Kinet,J.P. and Tasset,D. (1996) High-affinity oligonucleotide ligands to human IgE inhibit binding to Fc epsilon receptor I. J. Immunol., 157, 221230.[Abstract]
- Bell,S.D., Denu,J.M., Dixon,J.E. and Ellington,A.D. (1998) RNA molecules that bind to and inhibit the active site of a tyrosine phosphatase. J. Biol. Chem., 273, 1430914314.
[Abstract/Free Full Text] - Wimalawansa,S.J. (1996) Calcitonin gene-related peptide and its receptors: molecular genetics, physiology, pathophysiology and therapeutic potentials. Endocr. Rev., 17, 533585.[CrossRef][ISI][Medline]
- Renfrey,S., Downton,C. and Featherstone,J. (2003) The painful reality. Nature Rev. Drug Discov., 2, 175176.[CrossRef][ISI][Medline]
- Lassen,L.H., Haderslev,P.A., Jacobsen,V.B., Iversen,H.K., Sperling,B. and Olesen,J. (2002) CGRP may play a causative role in migraine. Cephalalgia, 22, 5461.[CrossRef][ISI][Medline]
- Edvinsson,L. (2003) New therapeutic target in primary headachesblocking theCGRP receptor. Expert Opin. Ther. Targets, 7, 377383.[ISI][Medline]
- Sambrook,J., Fritsch,E.F. and Maniatis,T. (1989) Molecular Cloning: A Laboratory Manual, 2nd Edn. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York, NY.
- Kleppe,K., Van de Sande,J.H. and Khorana,H.G. (1970) Polynucleotide ligase-catalyzed joining of deoxyribo-oligonucleotides on ribopolynucleotide templates and of ribo-oligonucleotides on deoxyribopolynucleotide templates. Proc. Natl Acad. Sci. USA, 67, 6873.
[Abstract/Free Full Text] - Kao,C., Rudisser,S. and Zheng,M. (2001) A simple and efficient method to transcribe RNAs with reduced 3' heterogeneity. Methods, 23, 201205.[CrossRef][ISI][Medline]
- Moore,M.J. and Query,C.C. (1998) Uses of site specifically modified RNAs constructed by RNA-ligation. In Smith,C.W.J. (ed.), RNA:Protein Interactions: A Practical Approach. Oxford University Press, Oxford, UK, Vol. 192, pp. 75108.
- Milligan,J.F. and Uhlenbeck,O.C. (1989) Synthesis of small RNAs using T7 RNA polymerase. Methods Enzymol., 180, 5162.[ISI][Medline]
- Vater,A. and Klussmann,S. (2003) Toward third-generation aptamers: Spiegelmers and their therapeutic prospects. Curr. Opin. Drug Discov. Devel., 6, 253261.[ISI][Medline]
- Toole,J., Griffin,L., Bock,L., Latham,J., Muenchau,D.D. and Krawczyk,S. (1992) Patent WO 92/14843.
- Pagratis,N., Gold,L., Shtatland,T. and Javornik,B. (2000) Patent WO 00/56930.
- Hermann,T. and Patel,D.J. (2000) Adaptive recognition by nucleic acid aptamers. Science, 287, 820825.
[Abstract/Free Full Text] - Ye,X., Gorin,A., Frederick,R., Hu,W., Majumdar,A., Xu,W., McLendon,G., Ellington,A. and Patel,D.J. (1999) RNA architecture dictates the conformations of a bound peptide. Chem. Biol., 6, 657669.[CrossRef][ISI][Medline]
- Biesecker,G., Dihel,L., Enney,K. and Bendele,R.A. (1999) Derivation of RNA aptamer inhibitors of human complement C5. Immunopharmacology, 42, 219230.[CrossRef][ISI][Medline]
- Xu,W. and Ellington,A.D. (1996) Anti-peptide aptamers recognize amino acid sequence and bind a protein epitope. Proc. Natl Acad. Sci. USA, 93, 74757480.
[Abstract/Free Full Text] - Gilbert,B.A., Sha,M., Wathen,S.T. and Rando,R.R. (1997) RNA aptamers that specifically bind to a K Ras-derived farnesylated peptide. Bioorg. Med. Chem., 5, 11151122.[CrossRef][Medline]
- Proske,D., Hofliger,M., Soll,R.M., Beck-Sickinger,A.G. and Famulok,M. (2002) A Y2 receptor mimetic aptamer directed against neuropeptide Y. J. Biol. Chem., 277, 1141611422.
[Abstract/Free Full Text] - Wlotzka,B., Leva,S., Eschgfaller,B., Burmeister,J., Kleinjung,F., Kaduk,C., Muhn,P., Hess-Stumpp,H. and Klussmann,S. (2002) In vivo properties of an anti-GnRH Spiegelmer: an example of an oligonucleotide-based therapeutic substance class. Proc. Natl Acad. Sci. USA, 99, 88988902.
[Abstract/Free Full Text] - Purschke,W.G., Radtke,F., Kleinjung,F. and Klussmann,S. (2003) A DNA Spiegelmer to staphylococcal enterotoxin B. Nucleic Acids Res., 31, 30273032.
[Abstract/Free Full Text]
This article has been cited by other articles:
![]() |
F. Jarosch, K. Buchner, and S. Klussmann In vitro selection using a dual RNA library that allows primerless selection Nucleic Acids Res., July 19, 2006; 34(12): e86 - e86. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. G. Purschke, D. Eulberg, K. Buchner, S. Vonhoff, and S. Klussmann An L-RNA-based aquaretic agent that inhibits vasopressin in vivo PNAS, March 28, 2006; 103(13): 5173 - 5178. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. S. Mogil, F. Miermeister, F. Seifert, K. Strasburg, K. Zimmermann, H. Reinold, J.-S. Austin, N. Bernardini, E. J. Chesler, H. A. Hofmann, et al. Variable sensitivity to noxious heat is mediated by differential expression of the CGRP gene PNAS, September 6, 2005; 102(36): 12938 - 12943. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Eulberg, K. Buchner, C. Maasch, and S. Klussmann Development of an automated in vitro selection protocol to obtain RNA-based aptamers: identification of a biostable substance P antagonist Nucleic Acids Res., March 3, 2005; 33(4): e45 - e45. [Abstract] [Full Text] [PDF] |
||||
![]() |
J.-D. Wen and D. M. Gray Selection of genomic sequences that bind tightly to Ff gene 5 protein: primer-free genomic SELEX Nucleic Acids Res., December 15, 2004; 32(22): e182 - e182. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Helmling, C. Maasch, D. Eulberg, K. Buchner, W. Schroder, C. Lange, S. Vonhoff, B. Wlotzka, M. H. Tschop, S. Rosewicz, et al. Inhibition of ghrelin action in vitro and in vivo by an RNA-Spiegelmer PNAS, September 7, 2004; 101(36): 13174 - 13179. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||








