Nucleic Acids Research, 2003, Vol. 31, No. 4 e12
© 2003 Oxford University Press
Rapid generation of inducible mouse mutants
ARTEMIS Pharmaceuticals GmbH, Neurather Ring 1, 51063 Cologne, Germany, 1 Whitehead Institute for Biomedical Research and Department of Biology, Massachusetts, Institute of Technology, Cambridge, MA, USA and 2 Center for Blood Research, Harvard Medical School, Boston, MA, USA
*To whom correspondence should be addressed. Tel: +49 221 9645315; Fax: +49 221 9645321; Email: f.schwenk{at}artemispharma.de
Received August 6, 2002; Revised November 7, 2002; Accepted December 5, 2002
| ABSTRACT |
|---|
|
|
|---|
We have generated an optimized inducible recombination system for conditional gene targeting based on a Cre recombinasesteroid receptor fusion. This configuration allows efficient Cre-mediated recombination in most organs of the mouse upon induction, without detectable background activity. An ES cell line, was established that carries the inducible recombinase and a loxP-flanked lacZ reporter gene. Out of this line, completely ES cell-derived mice were efficiently produced through tetraploid blastocyst complementation, without the requirement of mouse breeding. Our findings provide a new concept allowing the generation of inducible mouse mutants within 6 months, as compared to 14 months using the current protocol.
| INTRODUCTION |
|---|
|
|
|---|
Conditional gene targeting has become increasingly used in reverse mouse genetics, as it facilitates setting the site and time of gene inactivation in the body (13). This is achieved by the expression of the site-specific DNA recombinase Cre in conjunction with the target gene containing two Cre recognition sites (loxP). In the conditional mouse mutant, inactivation of the target gene is restricted in a spatial and/or temporal manner, depending on the expression pattern of the recombinase. Since the initial demonstration of this technology in 1994 (4), an increasing number of conditional knockout experiments have been published, most of which employed tissue-specific promoters to control Cre expression. Spatially regulated gene inactivation has proven to be powerful in dissecting the role of different cell types in a physiological process, as demonstrated for example by studies concerning the role of insulin receptor signaling in glucose homeostasis (5). The method of choice for precise gene function analyses in adult mice, however, is the temporal control of gene inactivation as it can prevent impaired embryonic development until the time of induction. In particular, inducible gene targeting in all organs would be a useful tool if the major site of gene action is not precisely defined. Optimally, such a system should permit a tight control of gene inactivation, efficient recombination in every single cell of the body upon induction, and the opportunity to produce sufficient numbers of inducible mouse mutants within a short time.
The major drawback of the current strategy is the long time frame required for the derivation of a conditional mouse mutant. Since two copies of the loxP-flanked allele must be combined with the recombinase transgene, at least three breeding steps (3 months each) are required to obtain a reasonable number of mice with the desired genotype (see Fig. 5A). While the first conditional mouse mutants can be expected within 14 months, additional time for breeding is usually needed to obtain sufficient numbers of mice for phenotypic analysis. To date, only a few mouse strains permitting ubiquitously inducible gene targeting are available, all of which suffer from incomplete recombination upon induction or background activity in the absence of inducer (610). Recently, a mouse strain has been generated by the insertion of a tamoxifen-inducible CreER fusion protein gene into the ubiquitously expressed Rosa26 gene (11). While this strain represented the most efficient tool for ubiquitously inducible gene targeting so far, a low affinity ER domain was used that requires high doses of the inducer 4-hydroxytamoxifen to achieve the maximal rate of recombination. Therefore, the side effects of the inducer may interfere with the phenotypic outcome of target gene inactivation. Taken together, there is a need for improved methods which both enable efficient gene knockout in all organs at non-toxic concentrations of the inducer and which accelerate the production of inducible mouse mutants.
|
In this paper we describe a novel approach for the rapid generation of inducible mouse mutants, which overcomes the drawbacks of the current technology. The approach is based on a ubiquitously expressed, high affinity CreER fusion protein that allows the efficient inducible inactivation of a loxP-flanked target gene in most organs. In addition, we demonstrate that hybrid ES cells tolerate at least three consecutive gene targeting cycles including selection with the antibiotics G418 and hygromycin B without affecting the potency to complement tetraploid blastocysts. Our findings provide a new concept allowing the rapid production of ES cell-derived, inducible knockout mice.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Construction of vectors
CreERT2. The Cre gene was amplified by PCR (Expand High Fidelity PCR system; Clontech) from PGKCrebpA using the oligos PR-A (TAACTAGCGGCCGCGTCGACCATGTCC AATTTACTGACCGTACAC) and creER5 (TCTCATGTCT CCAGCAGAATCGCCATCTTCCAGCAGGCG). In parallel the ER domain was amplified from the CreED2 vector (12) using the oligos creER4 (CTGGAAGATGGCGATTCTGC TGGAGACATGAGAGCTGCC) and creER1 (TAGTTAG CGGCCGCTCAGACTGTGGCAGGGAAACCCTC). Both PCR products were used as overlapping templates in a PCR with the primers PR-A and creER1. The resulting 2 kb product was digested with NotI and inserted into the NotI site of pBS. Site-directed mutagenesis (Stratagene) was applied to introduce a G400V mutation using primers ER-G400Vs (CATGGAGCACCCAGTGAAGCTACTGTTTG) and ER-G400Vas (CAAACAGTAGCTTCACTGGGTGCTCCATG). For the introduction of two amino acid changes, M543A/L544A, the primers ER AA2' s EagI (ATGACCTGCTG CTGGAGGCGGCCGACGCCCACCGCCTAC) and ER AA2 as EagI (GTAGGCGGTGGGCGTCGGCCGCCTCCAGCA GCAGGTCAT) were used in a site-directed mutagenesis. The creERT2 was inserted into an expression vector containing a CMV promoter, an intron and a polyadenylation signal resulting in the vector CMV-CreER.
Rosa targeting vector. A 129 SV/EV-BAC library (Incyte Genomics) was screened with a probe against exon 2 of the Rosa26 locus [amplified from mouse genomic DNA using Rscreen1s (GACAGGACAGTGCTTGTTTAAGG) and Rscreen1as (TGACTACACAATATTGCTCGCAC)]. Out of the identified BAC clone an 11 kb EcoRV subfragment was inserted into the HindII site of pBS. Two fragments (a 1 kb SacIIXbaI and a 4 kb XbaI fragment) were used as homology arms and inserted into a vector consisting of a FRT-flanked neomycin resistance gene (unpublished) and a splice acceptor site from adenovirus (13).
CreERT2 knock-in vector. The CreERT2 coding sequence and a polyadenylation site was inserted into the Rosa-targeting vector.
Rosa(lacZ reporter) knock-in vector. The neo gene of the Rosa-targeting vector was deleted through transformation of FLP-expressing bacteria (14). In the resulting vector a cassette containing a loxP-flanked PGK-hygro-pA followed by lacZ was inserted.
ect2 Targeting vector. The vector was generated by insertion of PCR fragments (with attached restriction sites) amplified from BAC DNA (129SVJ) into a vector consisting of a FRT-flanked neomycin resistance gene flanked by two loxP sites (G. Kauselmann, unpublished results). The 989 bp PCR fragment of the 5' targeting arm was inserted with NotI/SgfI 5' of the loxP sites and the 4023 bp PCR fragment of the 3' arm with XhoI/PmeI 3' of the loxP sites. The 428 bp PCR fragment of exon 6 and the flanking intronic region were inserted with AscI/FseI between the loxP sites.
Cell culture
Culture and targeted mutagenesis of ES cells were carried out as previously described (15) with ES cell lines derived from both inbred and F1 embryos.
Generation of ect2flox ES cells. The C57BL/6 cell line Bruce4 was electroporated with the described targeting vector, and out of 480 clones 3 homologous recombined clones were detected.
Mice
All mice were kept in the animal facility at Artemis Pharmaceuticals GmbH in microisolator cages (Tecniplast Sealsave). B6D2F1 mice for the generation of tetraploid blastocysts were obtained from Janvier. The polßflox/rosa(CreERT2) and ect2flox/rosa(CreERT2) mice were generated by breeding of rosa(CreERT2) ES mice with ßT14 (4) and ect2flox females (unpublished), respectively.
Production of ES mice by tetraploid embryo complementation
The production of mice by tetraploid embryo complementation was essentially performed as described (16).
Ligand administration
An aliquot of 100 mg tamoxifen-free base (T5648; Sigma) was suspended in 100 µl ethanol and dissolved in 1 ml sunflower oil (Sigma). This 10 mg/100 µl tamoxifen solution was sonicated for 12 min and then stored at 20°C. For p.o. administration the solution was thawed at 55°C and administrated to 48-week-old mice by a feeding needle (18061-20FST; Fine Science Tools GmbH).
Western blot analysis
Western blot analysis was performed using SDSPAGE (NuPAGE; Invitrogen) and the Breeze Immunodetection System (Invitrogen) according to the manufacturers protocols. Immunodetection was done using HC-20 against ER, PRB-106C against cre, I-19 against actin and rabbit polyclonal IgG antibodies (Santa Cruz Biotechnology Inc.).
| RESULTS |
|---|
|
|
|---|
Design of F1 ES cells carrying an inducible Cre transgene
To derive an optimized system for inducible gene targeting in mice, we generated a fusion protein consisting of Cre recombinase and the mutated ligand-binding domain of the estrogen receptor ERT2 (17). The ERT2 domain is composed of amino acids 282595 of the human estrogen receptor and carries three mutations (G400V/M543A/L544A) that confer a 10x enhanced sensitivity to the synthetic ligand 4-hydroxytamoxifen in mice as compared to the previously used ERT (G521R) domain (18). The CreERT2 coding region was inserted into the ubiquitously expressed Rosa26 locus through homologous recombination to obtain a configuration that allows the inducible inactivation of genes in all organs (Fig. 1). The Rosa26 targeting vector containing the CreERT2 gene is depicted in Figure 1A. We used the hybrid ES cell lines V6.5 [(C57BL/6 x 129S4Sv/Jae) F1] and ART4.12 [(C57BL/6 x 129S6/SvEvTac) F1] for homologous recombination, since these lines are capable of producing completely ES cell-derived mice (ES mice) through tetraploid blastocyst complementation with high efficiency (16). Independent recombinant ES cell clones were obtained at a frequency of 2% as verified by Southern blot analysis (Fig. 1B). Deletion of the neo gene did not affect the level of CreERT2 expression as determined by western blot analysis (Fig. 1D). A loxP-flanked hygromycin resistance gene was introduced into the second allele of Rosa26 (Fig. 1A and C) to provide a similar test substrate for Cre as the widely used Rosa26 reporter (19,20). In ES cells carrying both the rosa(CreERT2) and the rosa(lacZ reporter) alleles, complete recombination of the loxP-flanked segment was achieved upon treatment with 500 nM 4-hydroxytamoxifen for 4.5 days (Fig. 1E). Half-maximal activation of CreERT2 occurred at a concentration of 10 nM 4-hydroxytamoxifen (Fig. 1F) as compared to 100 nM for the CreERT fusion protein (12).
|
Generation of ES cell-derived mice
The three types of recombinant and wild-type V6.5 and ART4.12 ES cells were injected into tetraploid blastocysts and ES mice were obtained upon transfer of these blastocysts into pseudopregnant females. The proportion of transferred blastocysts that further developed into live born pups was in the range 817% and did not significantly decrease when ES cells were used that had undergone up to three sequential rounds of transfection (Fig. 2A). In contrast, the production of ES mice using inbred ES cells was inefficient (0.2%), confirming the hybrid vigor effect described in Eggan et al. (16) (Fig. 2A). Southern blot analysis of genomic DNA using a Rosa26-specific probe showed that the V6.5/CreER/flox ES mice were indeed solely derived from the recombinant ES cells and did not contain any detectable tetraploid cells from the injected blastocysts (Fig. 2B). These results demonstrate that mice can be produced by tetraploid blastocyst complementation using cells that have undergone three consecutive rounds of transfection, including two drug selection cycles.
|
Ubiquitously inducible gene targeting in mice
For the induction of CreERT2 in mice, we applied 15 mg tamoxifen orally for 5 days in the following experiments. We preferred to use this protocol, as the LD50 of tamoxifen in mice is 15-fold higher via the oral route than by i.p. injection (200 mg versus 5 g/kg) (21). It has been recently demonstrated that the oral application of tamoxifen is as efficient as i.p. injection of 4-hydroxytamoxifen for the activation of CreER (22). Rosa(CreERT2/lacZ reporter) mice were fed with daily 5 mg tamoxifen for 5 days and recombination of the lacZ reporter was analyzed 3 days after the last administration. Southern analysis of genomic DNA from different organs showed up to 50% recombination, without detectable background activity in untreated animals (Fig. 3A). This is a significantly higher degree of inducible recombination as compared to the results obtained with the Rosa26-CreERT strain (11), indicating that the ERT2 domain is indeed more sensitive to 4-hydroxytamoxifen. Upon recombination, the lacZ gene turned out to be inserted non-functionally, presumably due to a second start codon upstream of the coding region.
|
Since the Rosa26 locus has a limited accessibility for Cre (11), we were interested to test the rosa(CreERT2) configuration in the context of other loxP-flanked loci. As the second substrate, we used the loxP-flanked DNA polymerase ß gene segment (polßflox) (4). This allele had been used to characterize a number of tissue-specific (4,12,2326) as well as inducible Cre strains (6,12), and shows an intermediate accessibility for Cre (F. Schwenk and J. Seibler, unpublished observations). The polßflox/rosa(CreERT2) mice were fed with 5 mg tamoxifen/day for 5 days and analyzed 3 days later. Southern blot analysis revealed that the loxP-flanked polymerase ß gene segment was excised in more than 90% of cells in all organs except brain, whereas no background recombination was detected in untreated mice (Fig. 3B). As a third substrate, we used a 2.5 kb loxP-flanked segment of the ect2 gene. Again, up to 100% recombination in most tissues was achieved upon tamoxifen treatment of ect2flox/rosa(CreERT2) mice, without detectable background recombination in uninduced controls (Fig. 3C). A similar degree of recombination was achieved when a shorter (0.5 kb) loxP-flanked segment in the same position of the ect2 gene was used (Fig. 3D). Low dose application of 5 x 1 mg tamoxifen was sufficient to achieve complete recombination of the ect2flox allele in most organs, further demonstrating the improved sensitivity of the ERT2 domain in vivo.
To investigate whether the low recombination efficiency in brain was due to low CreERT2 expression we performed western analysis using antibodies specific for the human estrogen receptor. The 74 kDa band corresponding to the CreERT2 fusion protein was detectable in all organs including brain, with the highest levels in thymus, small intestine and testis (Fig. 4). The limited degree of recombination in brain may thus reflect a lower local concentration of 4-hydroxytamoxifen rather than a reduced expression level of CreERT2.
|
| DISCUSSION |
|---|
|
|
|---|
We describe an optimized system that allows ubiquitously inducible gene targeting in mice. This system is based on a fusion protein consisting of Cre recombinase and a mutated ligand-binding domain of the estrogen receptor that is expressed under the control of the ubiquitously active Rosa26 promoter (19). In contrast to the Rosa26-CreERT mouse strain published by Vooijs et al. (11), we used the ERT2 domain that responds at an
10-fold lower dose of the synthetic inducer 4-hydroxytamoxifen as compared to the ERT domain (17,18). In mice, the rosa(CreERT2) configuration achieved nearly complete inducible excision of multiple loxP-flanked gene segments in all organs except brain, without background recombination in the absence of inducer (Fig. 3). Thus, our system permits the tight temporal control of ubiquitous gene inactivation, allowing precise gene function analysis in animals that have undergone normal embryonic development. The lower degree of deletion observed with the Rosa26 allele (lacZ reporter) confirms the position dependency of Cre-mediated recombination described by Vooijs et al. (11). Since all other targets tested so far achieved near complete excision with the rosa(CreERT2) configuration (Fig. 2 and unpublished observations), a limited accessibility may be restricted to only a minority of loxP-flanked loci. As the rosa(CreERT2) allele permits inducible gene inactivation in all organs, it should find broad application as a research tool in reverse mouse genetics. We have employed the tetraploid blastocyst complementation approach for in vivo analysis of the rosa(CreERT2) configuration, allowing the generation of ES cell-derived mice (ES mice) in a single step without the requirement of time-consuming breeding. Tetraploid blastocysts are not capable of completing normal development, but, when complemented by the introduction of diploid ES cells, support the development of solely ES cell-derived mice. The efficient generation of such ES mice using non-transgenic hybrid ES cells has been recently demonstrated (16). In this study, the authors also succeeded in generating a single ES mouse through tetraploid blastocyst complementation using transfected cells that had undergone two consecutive rounds of selection. However, it remained unclear whether ES cells maintain their potency to complement tetraploid embryos with sufficient efficiency and reproducibility even after additional genetic modifications, which is a prerequisite for the strategy depicted in Figure 5B. We introduced both the CreERT2 coding region and a lacZ reporter construct into hybrid ES cells by targeted insertion into the Rosa26 locus. The targeting strategy involved three consecutive rounds of transfection and selection with the antibiotics G418 and hygromycin B. We found that all targeted ES cell clones produced ES-derived mice with high efficiency. The proportion of transferred blastocysts that developed into live born pups was in the range 817% and did not significantly decrease using ES cells that had undergone three consecutive transfections (Fig. 2A). Thus, we demonstrate that hybrid ES cells can be exposed to at least three transfection cycles without affecting the potency to complement tetraploid embryos, allowing the analysis of complex genetic alterations in ES cell-derived mice within the time of a single mouse generation.
Our findings provide the proof of principle for a new concept allowing the rapid production of inducible knockout mice using tetraploid blastocyst complementation. So far, the derivation of conditional mouse mutants had been a time-consuming undertaking since three breeding steps (3 months each) are usually required to obtain mice combining two copies of the loxP-flanked allele and the recombinase transgene (Fig. 5A). To address this limitation, we propose a new strategy that involves the tetraploid blastocyst complementation approach for the one step generation of conditional mouse mutants from genetically engineered ES cells. The generation of ES cells from Cre transgenic mice is feasible using standard protocols (15), as demonstrated by OGorman and colleagues (27). Three transfection cycles are sufficient to introduce loxP sites into both alleles of the target gene in ES cells, following the strategy depicted in Figure 5B. Thus, by using Cre transgenic ES cell lines for the generation of the loxP-flanked alleles, it will be possible to produce conditional mouse mutants directly from the targeted ES cells through tetraploid blastocyst complementation. Using this scheme, adult (2 months old) inducible mouse mutants available for phenotypic analyses can be obtained within 6 months, required for three gene targeting steps (1 month each) and one mouse generation time (3 months) (Fig. 5B). This saves more than 50% of time as compared to the current conditional gene targeting protocol, which requires 14 months including two targeting steps and four mouse generations (Fig. 5A). Since the described approach is simple and technically not more demanding than the current knockout protocol, we expect that this strategy will become a widely used tool in reverse mouse genetics.
| ACKNOWLEDGEMENTS |
|---|
We thank Francis Stewart (MPI for Cell Biology and Genetics, Dresden), Frank Edenhofer, Thomas Wunderlich (Institute for Genetics, University of Cologne) and Sandra Niehaves (Artemis Pharmaceuticals, Cologne) for scientific discussions and technical advice. We are grateful to Gordon Stott and Jens Tampe (Artemis Pharmaceuticals, Cologne) for critically reading the manuscript. This work was supported by the German Ministry for Education and Science (BMBF) grant no. 0311956.
| REFERENCES |
|---|
|
|
|---|
- Rajewsky,K., Gu,H., Kühn,R., Betz,U.A., Muller,W., Roes,J. and Schwenk,F. (1996) Conditional gene targeting. J. Clin. Invest., 98, 600603.[Web of Science][Medline]
- Lewandoski,M. (2001) Conditional control of gene expression in the mouse. Nature Rev. Genet., 2, 743755.[CrossRef][Web of Science][Medline]
- Kwan,K.M. (2002) Conditional alleles in mice: practical considerations for tissue-specific knockouts. Genesis, 32, 4962.[CrossRef][Web of Science][Medline]
- Gu,H., Marth,J.D., Orban,P.C., Mossmann,H. and Rajewsky,K. (1994) Deletion of a DNA polymerase beta gene segment in T cells using cell type specific gene targeting. Science, 265, 103106.
[Abstract/Free Full Text] - Kahn,C.R., Bruning,J.C., Michael,M.D. and Kulkarni,R.N. (2000) Knockout mice challenge our concepts of glucose homeostasis and the pathogenesis of diabetes mellitus. J. Pediat. Endocrinol. Metab., 13, 13771383.
- Kühn,R., Schwenk,F., Aguet,M. and Rajewsky,K. (1995) Inducible gene targeting in mice. Science, 269, 14271429.
[Abstract/Free Full Text] - Feil,R., Brocard,J., Mascrez,B., LeMeur,M., Metzger,D. and Chambon,P. (1996) Ligand-activated site-specific recombination in mice. Proc. Natl Acad. Sci. USA, 93, 1088710890.
[Abstract/Free Full Text] - Holzenberger,M., Zaoui,R., Leneuve,P., Hamard,G. and Le Bouc,Y. (2000) Ubiquitous postnatal LoxP recombination using a doxycycline auto-inducible Cre transgene (DAI-Cre). Genesis, 26, 157159.[CrossRef][Web of Science][Medline]
- Dietrich,P., Dragatsis,I., Xuan,S., Zeitlin,S. and Efstratiadis,A. (2000) Conditional mutagenesis in mice with heat shock promoter-driven cre transgenes. Mamm. Genome, 11, 196205.[CrossRef][Web of Science][Medline]
- Guo,C., Yang,W. and Lobe,C.G. (2002) A Cre recombinase transgene with mosaic, widespread tamoxifen-inducible action. Genesis, 32, 818.[CrossRef][Web of Science][Medline]
- Vooijs,M., Jonkers,J. and Berns,A. (2001) A highly efficient ligand-regulated Cre recombinase mouse line shows that LoxP recombination is position dependent. EMBO Rep., 2, 292297.[CrossRef][Web of Science][Medline]
- Schwenk,F., Kühn,R., Angrand,P.O., Rajewsky,K. and Stewart,A.F. (1998) Temporally and spatially regulated somatic mutagenesis in mice. Nucleic Acids Res., 26, 14271432.
[Abstract/Free Full Text] - Friedrich,G. and Soriano,P. (1991) Promoter traps in embryonic stem cells: a genetic screen to identify and mutate developmental genes in mice. Genes Dev., 9, 15131523.
- Buchholz,F., Angrand,P.O. and Stewart,A.F. (1996) A simple assay to determine the functionality of Cre or FLP recombination targets in genomic manipulation constructs. Nucleic Acids Res., 24, 31183119.
[Abstract/Free Full Text] - Hogan,B., Beddington,R., Costantini,F. and Lacy,E. (1994) Manipulating the Mouse Embryo: A Laboratory Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, pp. 253289.
- Eggan,K., Akutsu,H., Loring,J., Jackson-Grusby,L., Klemm,M., Rideout,W.M.,III, Yanagimachi,R. and Jaenisch,R. (2001) Hybrid vigor, fetal overgrowth and viability of mice derived by nuclear cloning and tetraploid embryo complementation. Proc. Natl Acad. Sci. USA, 98, 62096214.
[Abstract/Free Full Text] - Feil,R., Wagner,J., Metzger,D. and Chambon,P. (1997) Regulation of Cre recombinase activity by mutated estrogen receptor ligand-binding domains. Biochem. Biophys. Res. Commun., 237, 752757.[CrossRef][Web of Science][Medline]
- Indra,A.K., Warot,X., Brocard,J., Bornert,J.M., Xiao,J.H., Chambon,P. and Metzger,D. (1999) Temporally-controlled site-specific mutagenesis in the basal layer of the epidermis: comparison of the recombinase activity of the tamoxifen-inducible Cre-ER(T) and Cre-ER(T2) recombinases. Nucleic Acids Res., 27, 43244327.
[Abstract/Free Full Text] - Soriano,P. (1999) Generalized lacZ expression with the ROSA26 Cre reporter strain. Nature Genet., 21, 7071.[CrossRef][Web of Science][Medline]
- Mao,X., Fujiwara,Y. and Orkin,S.H. (1999) Improved reporter strain for monitoring Cre recombinase-mediated DNA excisions in mice. Proc. Natl Acad. Sci. USA, 96, 50375042.
[Abstract/Free Full Text] - Furr,B.J.A. and Jordan,V.C. (1984) The pharmacology and clinical uses of tamoxifen. Pharmacol. Ther., 25, 127205.[CrossRef][Web of Science][Medline]
- Kuhbandner,S., Brummer,S., Metzger,D., Chambon,P., Hofmann,F. and Feil,R. (2000) Temporally controlled somatic mutagenesis in smooth muscle. Genesis, 28, 1522.[CrossRef][Web of Science][Medline]
- Schwenk,F., Baron,U. and Rajewsky,K. (1995) A cre-transgenic mouse strain for the ubiquitous deletion of loxP-flanked gene segments including deletion in germ cells. Nucleic Acids Res., 23, 50805081.
[Free Full Text] - Betz,U.A.K., Voßhenrich,C.A.J., Rajewsky,K. and Müller,W. (1996) Bypass of lethality with mosaic mice generated by Cre-loxP mediated recombination. Curr. Biol., 6, 13071316.[CrossRef][Web of Science][Medline]
- Rickert,R.C., Roes,J. and Rajewsky,K. (1997) B lymphocyte-specific, Cre-mediated mutagenesis in mice. Nucleic Acids Res., 25, 13171318.
[Abstract/Free Full Text] - Clausen,B.E., Burkhardt,C., Reith,W., Renkawitz,R. and Forster,I. (1999) Conditional gene targeting in macrophages and granulocytes using LysMcre mice. Transgenic Res., 8, 265277.[CrossRef][Web of Science][Medline]
- OGorman,S., Dagenais,N.A., Qian,M. and Marchuk,Y. (1997) Protamine-Cre recombinase transgenes efficiently recombine target sequences in the male germ line of mice, but not in embryonic stem cells. Proc. Natl Acad. Sci. USA, 94, 1460214607.
[Abstract/Free Full Text]
This article has been cited by other articles:
![]() |
Y. Sabbagh, S. P. O'Brien, W. Song, J. H. Boulanger, A. Stockmann, C. Arbeeny, and S. C. Schiavi Intestinal Npt2b Plays a Major Role in Phosphate Absorption and Homeostasis J. Am. Soc. Nephrol., November 1, 2009; 20(11): 2348 - 2358. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Freude, M. M. Hettich, C. Schumann, O. Stohr, L. Koch, C. Kohler, M. Udelhoven, U. Leeser, M. Muller, N. Kubota, et al. Neuronal IGF-1 resistance reduces A{beta} accumulation and protects against premature death in a model of Alzheimer's disease FASEB J, October 1, 2009; 23(10): 3315 - 3324. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Welle, K. Burgess, C. A. Thornton, and R. Tawil Relation between extent of myostatin depletion and muscle growth in mature mice Am J Physiol Endocrinol Metab, October 1, 2009; 297(4): E935 - E940. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. B. Ernst, C. M. Wunderlich, S. Hess, M. Paehler, A. Mesaros, S. B. Koralov, A. Kleinridders, A. Husch, H. Munzberg, B. Hampel, et al. Enhanced Stat3 Activation in POMC Neurons Provokes Negative Feedback Inhibition of Leptin and InsulinSignaling in Obesity J. Neurosci., September 16, 2009; 29(37): 11582 - 11593. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Y. Higashi, T. Ikawa, M. Muramatsu, A. N. Economides, A. Niwa, T. Okuda, A. J. Murphy, J. Rojas, T. Heike, T. Nakahata, et al. Direct Hematological Toxicity and Illegitimate Chromosomal Recombination Caused by the Systemic Activation of CreERT2 J. Immunol., May 1, 2009; 182(9): 5633 - 5640. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Hikida, S. Casola, N. Takahashi, T. Kaji, T. Takemori, K. Rajewsky, and T. Kurosaki PLC-{gamma}2 is essential for formation and maintenance of memory B cells J. Exp. Med., March 16, 2009; 206(3): 681 - 689. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. J. Adams and L. van der Weyden Contemporary approaches for modifying the mouse genome Physiol Genomics, August 1, 2008; 34(3): 225 - 238. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Guillermet-Guibert, K. Bjorklof, A. Salpekar, C. Gonella, F. Ramadani, A. Bilancio, S. Meek, A. J. H. Smith, K. Okkenhaug, and B. Vanhaesebroeck The p110{beta} isoform of phosphoinositide 3-kinase signals downstream of G protein-coupled receptors and is functionally redundant with p110{gamma} PNAS, June 17, 2008; 105(24): 8292 - 8297. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Endoh, T. A. Endo, T. Endoh, Y.-i. Fujimura, O. Ohara, T. Toyoda, A. P. Otte, M. Okano, N. Brockdorff, M. Vidal, et al. Polycomb group proteins Ring1A/B are functionally linked to the core transcriptional regulatory circuitry to maintain ES cell identity Development, April 15, 2008; 135(8): 1513 - 1524. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Takeda, H. L. Aguila, N. S. Parikh, X. Li, K. Lamothe, L.-J. Duan, H. Takeda, F. S. Lee, and G.-H. Fong Regulation of adult erythropoiesis by prolyl hydroxylase domain proteins Blood, March 15, 2008; 111(6): 3229 - 3235. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Hameyer, A. Loonstra, L. Eshkind, S. Schmitt, C. Antunes, A. Groen, E. Bindels, J. Jonkers, P. Krimpenfort, R. Meuwissen, et al. Toxicity of ligand-dependent Cre recombinases and generation of a conditional Cre deleter mouse allowing mosaic recombination in peripheral tissues Physiol Genomics, September 11, 2007; 31(1): 32 - 41. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Waisman, M. Kraus, J. Seagal, S. Ghosh, D. Melamed, J. Song, Y. Sasaki, S. Classen, C. Lutz, F. Brombacher, et al. IgG1 B cell receptor signaling is inhibited by CD22 and promotes the development of B cells whose survival is less dependent on Ig{alpha}/{beta} J. Exp. Med., April 16, 2007; 204(4): 747 - 758. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Seibler, A. Kleinridders, B. Kuter-Luks, S. Niehaves, J. C. Bruning, and F. Schwenk Reversible gene knockdown in mice using a tight, inducible shRNA expression system Nucleic Acids Res., April 1, 2007; 35(7): e54 - e54. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Janoschek, L. Plum, L. Koch, H. Munzberg, S. Diano, M. Shanabrough, W. Muller, T. L. Horvath, and J. C. Bruning gp130 signaling in proopiomelanocortin neurons mediates the acute anorectic response to centrally applied ciliary neurotrophic factor PNAS, July 11, 2006; 103(28): 10707 - 10712. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Doring, O. Shynlova, P. Tsui, D. Eckardt, U. Janssen-Bienhold, F. Hofmann, S. Feil, R. Feil, S. J. Lye, and K. Willecke Ablation of connexin43 in uterine smooth muscle cells of the mouse causes delayed parturition J. Cell Sci., May 1, 2006; 119(9): 1715 - 1722. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Mao, J. Barrow, J. McMahon, J. Vaughan, and A. P. McMahon An ES cell system for rapid, spatial and temporal analysis of gene function in vitro and in vivo Nucleic Acids Res., October 12, 2005; 33(18): e155 - e155. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Plum, F. T. Wunderlich, S. Baudler, W. Krone, and J. C. Bruning Transgenic and Knockout Mice in Diabetes Research: Novel Insights into Pathophysiology, Limitations, and Perspectives Physiology, June 1, 2005; 20(3): 152 - 161. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Seibler, B. Kuter-Luks, H. Kern, S. Streu, L. Plum, J. Mauer, R. Kuhn, J. C. Bruning, and F. Schwenk Single copy shRNA configuration for ubiquitous gene knockdown in mice Nucleic Acids Res., April 14, 2005; 33(7): e67 - e67. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||


neo alleles are 6.6, 7.6 and 9.0 kb, respectively. (C) Southern blot analysis of genomic DNA extracted from double-targeted ES cells carrying the rosa(CreERT2) and rosa(lacZ reporter) alleles. Homologous recombination at the Rosa26 locus is detectable using EcoRV-digested genomic DNA and probe 1, resulting in an 11.7 kb band for the wild-type and a 2.5 kb band for the targeted allele. (D) Western blot analysis of CreERT2 expression in targeted ES cells before and after neo deletion. The western blot was probed with a Cre antiserum as described in Materials and Methods. (E) Southern blot analysis of inducible recombination of the rosa(lacZ reporter) allele. Cells were treated for 4.5 days with 500 nM 4-hydroxytamoxifen (4-OHT). Southern blot analysis of EcoRV-digested DNA was performed using the rosa26-specific probe 1 depicted in (A). (F) Titration of 4-OHT inducible recombination. Cells were treated for 3 days with increasing concentrations of 4-OHT as indicated. Southern blot analysis of EcoRV-digested DNA was performed using the rosa26-specific probe 1.














