Nucleic Acids Research, 2003, Vol. 31, No. 6 1597-1604
© 2003 Oxford University Press
DmTTF, a novel mitochondrial transcription termination factor that recognises two sequences of Drosophila melanogaster mitochondrial DNA
1 Dipartimento di Biochimica e Biologia Molecolare, Università di Bari and 2 Istituto di Biomembrane e Bioenergetica, CNR, Via Orabona 4, 70125 Bari, Italy
*To whom correspondence should be addressed at Dipartimento di Biochimica e Biologia Molecolare, Università di Bari, Via Orabona 4, 70125 Bari, Italy. Tel: +39 080 5443378; Fax: +39 080 5443403; Email: p.cantatore{at}biologia.uniba.it
Received December 18, 2002; Revised and Accepted January 28, 2003
DDBJ/EMBL/GenBank accession no. AY196479.
| ABSTRACT |
|---|
|
|
|---|
Using a combination of bioinformatic and molecular biology approaches a Drosophila melanogaster protein, DmTTF, has been identified, which exhibits sequence and structural similarity with two mitochondrial transcription termination factors, mTERF (human) and mtDBP (sea urchin). Import/processing assays indicate that DmTTF is synthesised as a precursor of 410 amino acids and is imported into mitochondria, giving rise to a mature product of 366 residues. Band-shift and DNase I protection experiments show that DmTTF binds two homologous, short, non-coding sequences of Drosophila mitochondrial DNA, located at the 3' end of blocks of genes transcribed on opposite strands. The location of the target sequences coincides with that of two of the putative transcription termination sites previously hypothesised. These results indicate that DmTTF is the termination factor of mitochondrial transcription in Drosophila. The existence of two DmTTF binding sites might serve not only to stop transcription but also to control the overlapping of a large number of transcripts generated by the peculiar transcription mechanism operating in this organism.
| INTRODUCTION |
|---|
|
|
|---|
The regulation of the expression of mitochondrial genes in animals has been studied carefully, especially in mammals (1). In these organisms, mitochondrial DNA (mtDNA) transcription is regulated at the level of initiation and termination. Three protein factors, TFAM (2), TFB1M and TFB2M (3), are required for the initiation of mitochondrial transcription at the two promoters (HSP and LSP) placed in the main non-coding region (NCR); the DNA-binding protein mTERF (4) mediates termination of transcription of the ribosomal unit, accounting for the production of the 16S and 12S rRNAs and of two tRNAs. Such a mode of regulation does not seem to be conserved during evolution due to remarkable variations in the gene order of mitochondrial genomes in the various phyla (5). In sea urchins (echinoderms) the two ribosomal genes are not adjacent; the main NCR has a reduced size and is placed downstream of the small ribosomal gene; five short AT-rich regions probably act as bidirectional promoters (6). In this organism, mitochondrial transcription takes place via multiple and partially overlapping transcription units (7). Control at the level of transcription initiation, depending on a TFAM-like protein, seems to be absent, as no such factor was ever detected in sea urchins. On the contrary, there is evidence that transcription is regulated at the level of termination. In fact, a DNA-binding protein, mtDBP, identified in Paracentrotus lividus mitochondria, is able to arrest elongating RNA polymerase by contacting two regions of mtDNA, located in the NCR and at the boundary of ND5 and ND6 genes, respectively (810). This can allow the control of the overlapping of the large number of transcripts starting from the multiple transcription initiation sites. Although mtDBP and mTERF contact mtDNA in different regions, they share the same role as transcription termination factor and also show a significant sequence similarity that suggests a common evolutionary origin for the two proteins.
Drosophila melanogaster is an interesting system for studying mitochondrial biogenesis due to the knowledge of the entire genome sequence (11) and to the possibility of testing the effect of altered expression of genes at the phenotypic and molecular levels. mtDNA gene organisation of D.melanogaster (12) is different from that of echinoderms and vertebrates: in particular, differences between mammalian and Drosophila gene order concern the translocation and/or inversion of two blocks of genes (ND4L/ND4/ND5 and 12S/16S/ND1) and of the ND6 gene. As a consequence, Drosophila mitochondrial genes form clusters alternatively distributed on the two strands and, contrary to sea urchins, the two ribosomal genes map in adjacent positions. Information on the transcription mechanism is still very limited. An early paper by Berthier et al. (13) suggested the existence of one transcription unit and one transcription termination site for each gene cluster. More recently, protein factors homologous to mammalian TFAM and TFBM have been identified (1416).
Here, in order to gain further information on mtDNA transcription in D.melanogaster, we investigated the existence of a transcription termination factor. Taking advantage of the structural and functional similarity of human and sea urchin transcription termination factors mTERF and mtDBP, we identified a Drosophila gene product homologous to both factors. The molecular characterisation of this product, that recognises two target sites on mtDNA, strongly suggests that it acts as transcription termination factor in Drosophila mitochondria.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Cloning, expression and purification of DmTTF
DmTTF cDNA was obtained by means of PCR amplification on a D.melanogaster cDNA library from 214-h embryos. Primers were BG-For (ATGATTAGAAGCCTTCTGCGCA GCT) and BG-Rev (TCATCCTTCTGATACACTTTGC GGA), nucleotide positions 118 039118 015 and 116 688 116 712 of the genomic sequence (AE003643.2), respectively. The amplification product (1233 bp) was cloned into the vector pGEMT (Promega) and sequenced.
To produce in vitro the full-length precursor form of DmTTF (DmTTFp), which includes the mitochondrial leader sequence, and the mature truncated version, which lacks the N-terminal 44 amino acids, two versions of the cDNA were cloned into pBluescript II KS vector between XhoI and BamHI sites. To generate the construct DmTTFp, the forward primer was DmTTFp-For (GCCGCTCGAGACCATGGTTAGA AGCCTTCTGCGCAGCT), containing an XhoI site (underlined) and the ATG codon (bold) in the optimal consensus context; the reverse primer was DmTTF-Rev (GCG CGGATCCTCATCCTTCTGATACACTTTG), containing a BamHI site (underlined) and the stop codon (bold). To generate the construct DmTTF (lacking the presequence), the forward primer was DmTTF-For (GCCGCTCGAGA CCATGGCCCCCAGTGGCACTTTAGGTAGC), containing an XhoI site (underlined) and an artificial ATG codon (bold) in the optimal consensus context; the reverse primer was DmTTF-Rev. These two cDNA constructs were used to programme the in vitro reticulocyte transcription-translation system TNT® (Promega) in the presence of [35S]methionine, according to the suppliers instructions.
The mature version of DmTTF was expressed in bacteria using the pCR® T7 TOPO TA Expression Kit (Invitrogen). The DmTTF construct was obtained by PCR with primers BG TOPO-For (ATGACCCCCAGTGGCACTTTAGGT), containing an artificial initiation codon (bold), and BG TOPO-Rev (GCCGCTCGAGTCATCCTTCTGATACACTTTG), containing the stop codon (bold); the product was cloned into the pCR® T7/CT TOPO vector. The recombinant plasmid was used to transform Escherichia coli BL21(DE3)pLys S cells. Bacteria were grown at 37°C to an OD600 of 0.6 and induced with isopropyl-ß-D-thiogalactopyranoside for 3 h. The protein extract was prepared by resuspending cells from 30 ml of culture in 2.5 ml of 10 mM phosphate buffer, pH 7.4, 500 mM NaCl, 2 mM EDTA, 1 mM DTT containing 120 µl of a Protease Inhibitors Cocktail (Sigma). The suspension was pulse-sonicated for 90 s, centrifuged for 15 min at 15 000 g at 4°C; the supernatant was adjusted to a glycerol concentration of 15% and stored at 80°C. The extract was diluted with 100 mM KCl, 50 mM TrisHCl pH 8.0, 1% Tween-20, 20% glycerol, 1 mM EDTA, 1 mM DTT, and used in DNA-binding reactions. For footprinting assays, bacterial DmTTF was purified by heparinSepharose chromatography. For this purpose, a protein extract from 200 ml of bacterial culture was prepared as above. The supernatant was diluted to 150 mM NaCl and loaded onto 6 ml of heparinSepharose CL-6B (Amersham Pharmacia Biotech) equilibrated with a buffer containing 150 mM KCl, 10 mM TrisHCl pH 8.0, 10 mM MgCl2, 1 mM EDTA, 10% glycerol, 1 mM DTT and protease inhibitors (Sigma). DmTTF was eluted with 500 mM KCl buffer.
Import of DmTTF into rat mitochondria
The in vitro produced 35S-labelled DmTTFp was incubated for import by rat liver mitochondria, prepared according to the procedure of Barile et al. (17). The radioactive protein present in 7.5 µl of the reticulocyte system was incubated with 0.4 mg of mitochondrial proteins in 70 mM sucrose, 220 mM mannitol, 2 mM HEPES, pH 7.4 (HMS buffer), supplemented with 2 mM MgCl2, 5 mM succinate, 2 mM phosphate, 1 mM methionine, in a final volume of 50 µl, at 30°C for 30 min. In some experiments carbonylcyanide-p-trifluoromethoxyphenyl hydrazone (FCCP) was included in the reaction mixture to 1.25 µM. After import/processing reactions, trypsin was added to the incubation mixture at 0.05 mg/ml and the samples were incubated on ice for 15 min, then the addition of 1.5 mg/ml of soybean trypsin inhibitor followed. After 5 min of incubation, mitochondria were diluted with 1.5 ml of HMS buffer and centrifuged; pellets were lysed in 1x Laemmli sample buffer. In a control experiment, the mitochondrial pellet was resuspended in 12 µl of HMS buffer and Triton X-100 was added to a final concentration of 3.5%; trypsin treatment was followed as described above.
Proteins were analysed by SDSPAGE on 12% polyacrylamide gels and the radioactive bands were visualised with a Typhoon Phosphor Imaging System (Molecular Dynamics).
Assay of DmTTF DNA-binding activity
The DNA-binding activity of DmTTF was studied by means of electrophoretic mobility-shift assays (EMSA) using the E.coli protein extract containing the recombinant protein. Probes were DNA fragments obtained by PCR and labelled with T4 polynucleotide kinase and [
-32P]ATP. The protein extract was incubated with
20 fmol of probe at 25°C for 30 min, in 20 µl of reaction mixture containing 20 mM HEPESKOH pH 7.9, 5 mM MgCl2, 75 mM KCl, 1 mM DTT, 0.1 mM EDTA, 2 µg of BSA and 2 µg of poly(dIdC)· poly(dIdC). Reaction mixtures were then loaded on native 6% polyacrylamide gels and run in 0.5x TBE at 300 V at 4°C. EMSA were also used to determine the stability of DNADmTTF complexes. Radioactive bands were visualised as before; quantitative analysis of data was performed using the Image Quant software (Molecular Dynamics).
For DNase I footprinting experiments, DNA fragments were 5' labelled and incubated with the heparinSepharose protein fraction in the same conditions used for EMSA, except that samples were 2.5-fold scaled up and poly(dIdC)· poly(dIdC) was 10-fold lowered. After incubation at room temperature for 10 min, reactions were added with an equal volume of 5 mM CaCl2, 10 mM MgCl2, and with 0.5 U/ml of DNase I (Roche). After 1 min of incubation at room temperature, reactions were stopped by adding an equal volume of 1% SDS, 200 mM NaCl, 20 mM EDTA, 250 µg/ml tRNA. Samples were phenol extracted, ethanol precipitated and loaded onto a 6% sequencing gel.
| RESULTS |
|---|
|
|
|---|
Identification of a D.melanogaster mitochondrial protein homologous to mtDBP and mTERF
A BLASTP analysis using as query the sequence of the sea urchin DNA-binding protein mtDBP against a database of translated D.melanogaster nuclear coding sequences revealed, as the most significant, a match with the gene product BG:DS01068.4. The importance of this similarity is supported by the observation that, when the sequence of this gene product was tested versus the available protein databases, the highest scores were obtained for mtDBP and mTERF. These data suggest that the Drosophila gene product could be the homologue of mtDBP and mTERF. Therefore, we termed the protein DmTTF for Drosophila mitochondrial transcription termination factor. FlyBase GadFly Genome Annotation Database reports that the DmTTF gene is 1587 bp long; it is composed of three exons and two introns and generates a transcript of 1468 nt. The cDNA of DmTTF was cloned by means of PCR on a cDNA library of D.melanogaster. The sequence of the ORF (accession no. AY196479), which is 1233 nt long and codes for a polypeptide of 410 residues, differs from that reported in the Drosophila database because of 20 nucleotide substitutions giving rise to four amino acid changes (P, A, I and T instead of S, T, V and N, in positions 46, 72, 111 and 223, respectively). The analysis of the DmTTF protein sequence with programs predicting the cellular localisation, such as MitoProt II, Target P and Predotar, resulted in a very high probability for the mitochondrial localisation, with a putative signal sequence of 44 residues according to the (R 2) rule. Therefore, the mature DmTTF (366 amino acids long) should have a calculated molecular weight of 43 100 Da and an isolectric point of 9.43.
The alignment of the putative mature version of DmTTF with mtDBP and mTERF (Fig. 1) shows that the similarity among the three proteins is rather uniformly distributed along the molecule with a higher conservation in the C-terminal region. In particular, DmTTF displays 17.8% amino acid identity and 43.6% amino acid similarity with mtDBP, and 18.8% amino acid identity and 36.5% amino acid similarity with mTERF. Sequence analysis of DmTTF shows that the protein contains a main basic domain placed between residues 210 and 221. Moreover, by using the program COILS (18), we detected four regions that could form coiled coils. Coiled-coil structures are also predictable in mtDBP and mTERF, as revealed by a similar analysis. As shown in Figure 1, the position of some of these motives is conserved in the three proteins; in particular this concerns the fourth motif of DmTTF and mtDBP, and the third motif of mTERF, which all fall in the most conserved portion of the proteins. Similarly, the first motif of DmTTF and mtDBP, and the third motif of DmTTF and the second of mtDBP, also lie in similar positions.
|
Mitochondrial localisation of DmTTF
To obtain direct evidence on the mitochondrial localisation of DmTTF, we set up an import/processing assay using isolated rat liver mitochondria. For this purpose, two versions of the cDNA (DmTTFp and DmTTF, with and without the putative signal sequence, respectively; Fig. 2A) were cloned in the vector pBluescript II and used as templates in an in vitro reticulocyte transcription/translation system. When the entire ORF was translated (Fig. 2B, lane 1), one main product, DmTTFp, starting at the first AUG codon, was obtained. Figure 2B (lane 2) shows that incubation of the in vitro translated protein with isolated mitochondria, followed by trypsin treatment, produced a faster migrating band. The polypeptide, which was resistant to trypsin, comigrated with the putative mature DmTTF synthesised in vitro that is 366 amino acids long (Fig. 2B, lane 5). The processed product became protease sensitive after solubilisation of the membranes with Triton X-100 (Fig. 2B, lane 3). Moreover, the import-processing reaction was inhibited by the uncoupler FCCP (Fig. 2B, lane 4), as expected for a mitochondrial import depending on membrane potential. The overall results are typical for a mitochondrial import reaction and are consistent with the bioinformatic prediction that DmTTF is a mitochondrial protein of 366 amino acids.
|
Target sites of DmTTF on D.melanogaster mtDNA
In order to show that DmTTF is able to bind DNA, and to identify the target sites, the protein was expressed in E.coli and used in gel-shift experiments. For this analysis we chose four regions of Drosophila mtDNA (see Fig. 3A) that, on the basis of the gene organisation and transcription map (13), could contain transcription termination sites. The region containing a few nucleotides of the 3' end of the 16S rRNA gene, the tRNALeu(CUN) gene and the 5' end of ND1 gene was selected by analogy to the position of the mTERF binding site on human mtDNA; the region comprising the tRNA genes for Met, Gln, Ile and a few nucleotides of the adjacent ND2 gene might contain the termination site of the complete transcript coded by the rRNA template strand; the region comprising the tRNA cluster and the 3' end of ND3 and ND5 genes, and that comprising the tRNASer(UCN) gene and the 3' end of ND1 and cyt b genes, might both contain bidirectional termination sites of gene clusters transcribed on opposite strands. The ND3/ND5 region was divided into four fragments. Mobility-shift experiments with fragments containing the first two regions did not produce any DNAprotein complex (data not shown). When the four fragments of the ND3/5 region were used, a slower migrating band was observed with fragment ND3/5-3 (Fig. 3B, lanes 13). The fragment, 261 bp long, contained most of the tRNAAsn gene, the tRNASer and tRNAGlu genes, an 18-nt-long non-coding sequence, and almost the entire tRNAPhe gene. The proteinDNA complex was specific, as it was unaffected by the addition of a heterologous competitor, that is, the fragment containing the 3' region of 16S rRNA gene (lanes 4 and 5). The displaced band disappeared when the binding reaction contained an excess of cold ND3/5-3 fragment (lanes 6 and 7). The proteinDNA complex was produced by the protein in the mature form, whereas the precursor form showed a weak binding activity (data not shown). This is in agreement with the behaviour of other mtDNA-binding proteins which are unable to bind DNA as precursor forms (9). The mtDNA sequence contacted by DmTTF was determined by DNase I footprinting analysis using recombinant DmTTF purified by heparinSepharose chromatography. As shown in Figure 3C, the pattern of DNase I digestion of the ND3/5-3 fragment revealed a protected region of 28 bp, from positions 6314 to 6341. This sequence, which can be considered the DmTTF target site in this region, contains the last 5 nt of the tRNAGlu gene, the entire small non-coding sequence (nucleotides 63196336) and the last 5 nt of the tRNAPhe gene. It is noteworthy that this sequence is located at the boundary of two clusters of genes transcribed on opposite strands, an ideal position for a transcription termination factor to bind DNA and exert its function.
|
DmTTF was able to also bind the cyt b/ND1 fragment (360 bp) (Fig. 3D, lanes 13). As expected, the binding was abolished by the addition of an excess of cold ND3/5-3 fragment, which contains the DmTTF target site located between tRNAGlu and tRNAPhe (lanes 4 and 5). Similarly, the binding to ND3/5-3 probe was abolished by the addition of an excess of cold cyt b/ND1 fragment (lanes 610). Interestingly, also the cyt b/ND1 region contains a short non-coding sequence (nucleotides 11 70311 719), located between the genes for tRNASer(UCN) and ND1, which displays a significant homology with that between tRNAGlu and tRNAPhe genes. In order to test whether DmTTF is able to recognise this 17 nt sequence, DNase I footprinting analysis was carried out on the cyt b/ND1 fragment (Fig. 3E). The protected region (28 bp) spans from positions 11 698 to 11 725, and contains the last 5 nt of the tRNASer(UCN) gene, the entire non-coding sequence and the last 6 nt of the ND1 gene. These results show that DmTTF is able to contact two homologous sequences of D.melanogaster mtDNA, located in two distinct regions.
To compare the relative strength of binding at the two target sites, the dissociation rate of the preformed DNADmTTF complexes was estimated. In this experiment, the radioactive probe was first incubated with the induced bacterial extract, then a 100-fold molar excess of unlabelled homologous competitor was added to each sample. After different times of incubation, reactions were loaded on a non-denaturing gel and the dissociation rate of the complex was monitored by determining the rate of disappearance of the radioactive retarded band, as shown in Figure 4. The half-life of the two complexes was determined by analysing the results according to the integrated pseudo-first-order equation (19): ln[CP] / [CPo] = Kdiss x t, where [CP] represents the concentration of the proteinDNA complex at time t and [CPo] that of the complex before the addition of the cold competitor. The half-life of the complex with fragment ND3/5-3 is
15 min, whereas that with fragment cyt b/ND1 is
7 min, corresponding to dissociation rates of 0.46 x 101 s1 and 1.03 x 101 s1, respectively.
|
| DISCUSSION |
|---|
|
|
|---|
The termination of mtDNA transcription has a relevant role in regulating the expression of the mitochondrial genome in animal organisms. This process requires protein factors that bind specifically DNA. Two transcription termination factors, mTERF in mammals and mtDBP in sea urchins, have been described to date (4,9,10). In the present work, we report the characterisation of a D.melanogaster polypeptide, DmTTF, identified on the basis of its similarity with mTERF and mtDBP. DmTTF can be imported and processed by rat liver mitochondria, giving rise to a mature protein migrating as a 366 amino acid polypeptide. The factor specifically binds two short, highly homologous non-coding sequences, located between tRNAGlu and tRNAPhe, and tRNASer(UCN) and ND1 genes, respectively (Fig. 5). DmTTFDNA complexes exhibit a similar half-life of
10 min at both binding sites. Data on the stability of the proteinDNA complex for other mitochondrial termination factors are limited to sea urchin mtDBP. In this case, the stability of the complex is remarkably different, with a value of 25 min at the ND5/ND6 binding site and of 150 min at the NCR binding site (8).
|
The comparison between mTERF, mtDBP and DmTTF indicates that they could share the mode of binding to DNA, as suggested by the presence of coiled-coil structures in all of them. It is likely that the coiled-coil heptads identified in these three proteins serve to establish intra-molecular interactions needed to place the DNA-binding domain in the right position for contacting DNA. This possibility is supported by the observation that both mtDBP and mTERF bind DNA as a monomer and not as a dimer, as it would occur if these structures were involved in intermolecular interactions.
Drosophila mitochondrial genes are almost equally distributed on the two mtDNA strands and are organised as two pairs of convergent blocks (Fig. 3A). An early study (13) on the mapping of D.melanogaster mtRNAs suggested the existence of multiple sites of transcription initiation and termination. It is remarkable that DmTTF binding sites are located just at the 3' end of the convergent gene units and coincide with two of the hypothesised transcription termination sites. These observations, all together, strongly suggest that DmTTF is the termination factor of Drosophila mitochondrial transcription.
Similarly to mtDBP, and contrary to mTERF, DmTTF does not bind immediately downstream of the 16S rRNA gene. Therefore, Drosophila, along with the sea urchin, would represent a further organism where transcription termination mediated by a protein occurs at positions different from the 3' end of the 16S rRNA gene. This is surprising given that ribosomal genes keep in Drosophila the same arrangement described in mammals. Previously, Valverde et al. (20) observed that a sequence homologous to the tridecamer termination signal found in human downstream of the 16S rRNA gene was well conserved, in equivalent position, in Drosophila and in a large number of animals. This suggested that a protein-dependent transcription termination mechanism at the 3' end of the 16S rRNA gene was largely maintained during evolution. Our findings in Drosophila, as well as in the sea urchin (21), indicate that the presence of the conserved sequence does not necessarily imply the existence of a protein factor able to bind such a target. Unless this sequence represents a protein-independent termination signal, the most likely hypothesis is that in Drosophila and in the sea urchin the 3' end of 16S rRNA is generated by a post-transcriptional processing event.
The different number and location of the binding sites for mtDBP, mTERF and DmTTF probably reflects remarkable differences in transcription mechanisms. The existence of two binding sites for DmTTF, as well as for mtDBP, as opposed to the single mTERF target site, could be related to the peculiar function played by these factors in the scenario of mtDNA transcription. While in mammals mTERF controls the relative abundance of rRNAs versus mRNAs (4), in Drosophila and in sea urchins, where mitochondrial transcription proceeds via multiple transcription units (7,13), DmTTF and mtDBP could exert more than a simple stop of transcription. In fact, they could also be involved in controlling the overlapping of the transcripts generated by those units and in avoiding the collision between the transcription machineries moving on opposite strands. In light of this, the termination of mitochondrial transcription appears to constitute in these organisms a crucial step in the control of the expression of mitochondrial genes. In conclusion, our findings support the hypothesis that, during animal evolution, the role of the transcription termination factor has been progressively adjusted to meet changes in mitochondrial gene organisation and expression which occurred in the various phyla.
| ACKNOWLEDGEMENTS |
|---|
We are very grateful to H. T. Jacobs for his valuable suggestions. The D.melanogaster embryos cDNA library was kindly provided by S. Banfi from TIGEM, Telethon Institute of Genetics and Medicine, Milan. We are greatly indebted to M. Barile and C. Brizio for their help in mitochondrial import experiments. We thank S. Alziari and R. Garesse for the kind gift of D.melanogaster mtDNA. This work was supported by grants from Ministero dellIstruzione, dellUniversità e della Ricerca: COFIN PRIN 2002; Centro di Eccellenza di Genomica in Campo Biomedico e Agrario; Piani di Potenziamento della Rete Scientifica e Tecnologica, Legge 488/92 Cluster C03; from European Union: Concerted Actions on Mitochondrial Biogenesis and Disease (Contract N. QLG1-CT-2001-00966); and from Università di Bari: Progetto di Ricerca di Ateneo.
| REFERENCES |
|---|
|
|
|---|
- Taanman,J.-W. (1999) The mitochondrial genome: structure, transcription, translation and replication. Biochim. Biophys. Acta, 1410, 103123.[Medline]
- Larsson,N.G., Wang,J., Wilhelmsson,H., Oldfors,A., Rustin,P., Lewandoski,M., Barsh,G.S. and Clayton,D.A. (1998) Mitochondrial transcription factor A is necessary for mtDNA maintenance and embryogenesis in mice. Nature Genet., 18, 231236.[CrossRef][Web of Science][Medline]
- Falkenberg,M., Gaspari,M., Rantanen,A., Trifunovic,A., Larsson,N.G. and Gustafsson,C.M. (2002) Mitochondrial transcription factors B1 and B2 activate transcription of human mtDNA. Nature Genet., 31, 289294.[CrossRef][Web of Science][Medline]
- Fernandez-Silva,P., Martinez-Azorin,F., Micol,V. and Attardi,G. (1997) The human mitochondrial transcription termination factor (mTERF) is a multizipper protein but binds to DNA as a monomer, with evidence pointing to intramolecular leucine zipper interactions. EMBO J., 5, 10661079.[CrossRef]
- Boore,J.L. (1999) Animal mitochondrial genomes. Nucleic Acids Res., 27, 17671780.
[Abstract/Free Full Text] - Cantatore,P., Roberti,M., Rainaldi,G., Gadaleta,M.N. and Saccone,C. (1989) The complete nucleotide sequence, gene organization and genetic code of the mitochondrial genome of Paracentrotus lividus. J. Biol. Chem., 264, 1096510975.
[Abstract/Free Full Text] - Cantatore,P., Roberti,M., Loguercio Polosa,P., Mustich,A. and Gadaleta,M.N. (1990) Mapping and characterization of Paracentrotus lividus mitochondrial transcripts: multiple and overlapping transcription units. Curr. Genet., 17, 235245.[CrossRef][Web of Science][Medline]
- Roberti,M., Mustich,A., Gadaleta,M.N. and Cantatore,P. (1991) Identification of two homologous mitochondrial DNA sequences, which bind strongly and specifically to a mitochondrial protein of Paracentrotus lividus. Nucleic Acids Res., 19, 62496254.
[Abstract/Free Full Text] - Loguercio Polosa,P., Roberti,M., Musicco,C., Gadaleta,M.N., Quagliariello,E. and Cantatore,P. (1999) Cloning and characterisation of mtDBP, a DNA-binding protein which binds two distinct regions of sea urchin mitochondrial DNA. Nucleic Acids Res., 27, 18901899.
[Abstract/Free Full Text] - Fernandez-Silva,P., Loguercio Polosa,P., Roberti,M., Di Ponzio,B., Gadaleta,M.N., Montoya,J. and Cantatore,P. (2001) Sea urchin mtDBP is a two-faced transcription termination factor with a biased polarity depending on the RNA polymerase. Nucleic Acids Res., 29, 47364743.
[Abstract/Free Full Text] - Adams,M.D. Celniker,S.E., Holt,R.A., Evans,C.A., Gocayne,J.D., Amanatides,P.G., Scherer,S.E., Li,P.W., Hoskins,R.A., Galle,R.F. et al. (2000) The genome sequence of Drosophila melanogaster. Science, 287, 21852195.
[Abstract/Free Full Text] - Lewis,D.L., Farr,C.L. and Kaguni,L.S. (1995) Drosophila melanogaster mitochondrial DNA: completion of the nucleotide sequence and evolutionary comparisons. Insect Mol. Biol., 4, 263278.[Web of Science][Medline]
- Berthier,F., Renaud,M., Alziari,S. and Durand,R. (1986) RNA mapping on Drosophila mitochondrial DNA: precursors and template strands. Nucleic Acids Res., 14, 45194533.
[Abstract/Free Full Text] - Takata,K., Yoshida,H., Hirose,F., Yamaguchi,M., Kai,M., Oshige,M., Sakimoto,I., Koiwai,O. and Sakaguchi,K. (2001) Drosophila mitochondrial transcription factor A: characterization of its cDNA and expression pattern during development. Biochem. Biophys. Res. Commun., 287, 474483.[CrossRef][Web of Science][Medline]
- Goto,A., Matsushima,Y., Kadowaki,T. and Kitagawa,Y. (2001) Drosophila mitochondrial transcription factor A (d-TFAM) is dispensable for the transcription of mitochondrial DNA in Kc167 cells. Biochem J., 354, 243248.[CrossRef][Web of Science][Medline]
- McCulloch,V., Bonnie,L., Seidel-Rogol,B.L. and Shadel,G.S. (2002) A human mitochondrial transcription factor is related to RNA adenine methyl transferases and binds S-adenosylmethionine. Mol. Cell. Biol., 22, 11161125.
[Abstract/Free Full Text] - Barile,M., Brizio,C., De Virgilio,C., Delfine,S., Quagliariello,E. and Passarella,S. (1997) Flavin adenine dinucleotide and flavin mononucleotide metabolism in rat liver. The occurrence of FAD pyrophosphatase and FMN phosphohydrolase in isolated mitochondria. Eur. J. Biochem., 249, 777785.[Web of Science][Medline]
- Lupas,A., Van Dyke,M. and Stock,J. (1991) Predicting coiled coils from protein sequences. Science, 252, 11621164.
[Free Full Text] - Fried,M,G. and Crothers,D.M. (1984) Kinetics and mechanism in the reaction of gene regulatory proteins with DNA. J. Mol. Biol., 172, 263282.[CrossRef][Web of Science][Medline]
- Valverde,J.R., Marco,R. and Garesse,R. (1994) A conserved heptamer motif for ribosomal RNA transcription termination in animal mitochondria. Proc. Natl Acad. Sci. USA, 91, 53685371.
[Abstract/Free Full Text] - Roberti,M., Loguercio Polosa,P., Musicco,C., Milella,F., Qureshi,S., Gadaleta,M.N., Jacobs,H.T. and Cantatore,P. (1999) In vivo mitochondrial DNAprotein interactions in sea urchin eggs and embryos. Curr. Genet., 34, 449458.[CrossRef][Web of Science][Medline]
- Thompson,J.D., Higgins,D.G. and Gibson,T.J. (1994) CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res., 22, 46734680.
[Abstract/Free Full Text]
This article has been cited by other articles:
![]() |
T. T. Torres, M. Dolezal, C. Schlotterer, and B. Ottenwalder Expression profiling of Drosophila mitochondrial genes via deep mRNA sequencing Nucleic Acids Res., October 20, 2009; (2009) gkp856v1. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. K. Hyvarinen, J. L. O. Pohjoismaki, A. Reyes, S. Wanrooij, T. Yasukawa, P. J. Karhunen, J. N. Spelbrink, I. J. Holt, and H. T. Jacobs The mitochondrial transcription termination factor mTERF modulates replication pausing in human mitochondrial DNA Nucleic Acids Res., October 8, 2007; 35(19): 6458 - 6474. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Roberti, F. Bruni, P. L. Polosa, M. N. Gadaleta, and P. Cantatore The Drosophila termination factor DmTTF regulates in vivo mitochondrial transcription Nucleic Acids Res., May 3, 2006; 34(7): 2109 - 2116. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Asin-Cayuela, T. Schwend, G. Farge, and C. M. Gustafsson The Human Mitochondrial Transcription Termination Factor (mTERF) Is Fully Active in Vitro in the Non-phosphorylated Form J. Biol. Chem., July 8, 2005; 280(27): 25499 - 25505. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Prieto-Martin, J. Montoya, and F. Martinez-Azorin New DNA-Binding Activity of Rat Mitochondrial Transcription Termination Factor (mTERF) J. Biochem., December 1, 2004; 136(6): 825 - 830. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Schonfeld, L. Wobbe, R. Borgstadt, A. Kienast, P. J. Nixon, and O. Kruse The Nucleus-encoded Protein MOC1 Is Essential for Mitochondrial Light Acclimation in Chlamydomonas reinhardtii J. Biol. Chem., November 26, 2004; 279(48): 50366 - 50374. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Matsushima, R. Garesse, and L. S. Kaguni Drosophila Mitochondrial Transcription Factor B2 Regulates Mitochondrial DNA Copy Number and Transcription in Schneider Cells J. Biol. Chem., June 25, 2004; 279(26): 26900 - 26905. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Prieto-Martin, J. Montoya, and F. Martinez-Azorin Phosphorylation of rat mitochondrial transcription termination factor (mTERF) is required for transcription termination but not for binding to DNA Nucleic Acids Res., April 15, 2004; 32(7): 2059 - 2068. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||













