Nucleic Acids Research, 2003, Vol. 31, No. 6 1640-1645
© 2003 Oxford University Press
Human mitochondrial DNA is packaged with TFAM
Department of Clinical Chemistry and Laboratory Medicine, Kyushu University Graduate School of Medical Sciences, 3-1-1 Maidashi, Higashi-ku, Fukuoka 812-8582, Japan and 1 Biomolecular Characterization Division, RIKEN (The Institute for Physical and Chemical Research), Wako 351-0198, Japan
*To whom correspondence should be addressed. Tel: +81 92 642 5749; Fax: +81 92 642 5772; Email: kang{at}mailserver.med.kyushu-u.ac.jp
Received December 9, 2002; Revised and Accepted January 20, 2003
| ABSTRACT |
|---|
|
|
|---|
Mitochondrial transcription factor A (TFAM), a member of the high mobility group proteins, is essential for maintenance of mitochondrial DNA (mtDNA). Most TFAM and mtDNA (both of which are normally soluble) was recovered from the particulate fraction of human placental mitochondria when extracted with the non-ionic detergent Nonidet P-40. mtDNA and TFAM were co-immunoprecipitated by anti-TFAM antibodies. TFAM was released into the supernatant by DNase I digestion of mtDNA in the particulate fraction. Thus, TFAM and mtDNA are tightly associated with each other, and it is likely that few TFAM or mtDNA molecules exist in an unbound form in mitochondria. Based on the fact that TFAM is abundant enough to wrap mtDNA entirely, these results suggest that human mtDNA is packaged with TFAM.
| INTRODUCTION |
|---|
|
|
|---|
Mitochondrial transcription factor A (TFAM) was first purified and cloned as a transcription factor for mitochondrial DNA (mtDNA) (1,2). TFAM shows a high affinity to the light and heavy strand promoters, LSP and HSP, respectively (1,2). TFAM indeed enhances mtDNA transcription by mitochondrial RNA polymerase in a promoter-specific fashion in the presence of a mitochondrial transcription factor B (3,4). Because replication of mammalian mtDNA is proposed to be coupled with transcription (5), TFAM is thought to be essential for replication of mtDNA. Consistent with this notion, targeted disruption of the mouse TFAM gene is an embryonic lethal mutation causing depletion of mtDNA (6). TFAM is a member of the high mobility group (HMG) proteins and contains two HMG-box domains. Many HMG-family proteins are capable of binding, wrapping, bending and unwinding DNA regardless of sequence specificity (79). Abf2p, a TFAM homolog of Saccharomyces cerevisiae, is also an HMG-family protein. Abf2p abundantly exists in mitochondria, every 15 bp of mtDNA (10). Unlike mammalian TFAM, Abf2p is not required for transcription initiation of mtDNA (10). Saccharomyces cerevisiae devoid of Abf2p loses mtDNA when cultured in the presence of fermentable carbon sources (11), but this mtDNA depletion is rescued by a bacterial histone-like protein HU (12), suggesting that Abf2p maintains mtDNA as an architectural factor. Because TFAM can substitute for Abf2p as well (2), human TFAM may share common properties with Abf2p and HU. Despite of its ability to package mtDNA, TFAM has not been considered to package mtDNA in human mitochondria because its amount was estimated to be only 15 molecules per mtDNA (1).
mtDNA is postulated to have a nucleoid structure in lower eukaryotes, S.cerevisiae (1315) and Physarum polycephalum (16). However, its structure is not well elucidated at a molecular level. Recently, human mtDNA was also proposed to exist in a nucleoid structure, but the proposal is simply based on a dotted pattern of mtDNA staining (17,18). The human mtDNA nucleoid has never been isolated and thus its structure is much less characterized than those of lower eukaryotes. Recently, we have reported that human TFAM is abundant enough to wrap entire mtDNA (19). In this study, we show that most TFAM is indeed associated with mtDNA and thus organizes a proteinDNA complex. The misunderstanding that mtDNA is rather naked has not been experimentally denied in mammals to date. The results in this study are the first to experimentally show that human mtDNA is far from naked. Also, we propose that TFAM functions as a main constitutive factor of nucleoid structure in mammals. In addition, we discuss the association of the mtDNA/TFAM complex with mitochondrial membranes.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Materials and miscellaneous methods
Anti-human TFAM antibodies were raised by immunizing rabbits with recombinant GST-TFAM fusion protein (20). The antibodies were purified using an affinity column in which histidine-tagged TFAM protein (20) was immobilized on the gel using an UltraLinkTM kit (Pierce). Anti-human mitochondrial single-stranded DNA-binding protein (mtSSB) and anti-human p32 were as described previously (19,21). Anti-human voltage-dependent anion channel 1 (VDAC) and anti-iron sulfur protein of complex II were produced by immunizing rabbits with C-terminal peptides of these proteins, GHKLGL GLEFQA and TYKEKKASV, respectively. These two antibodies were affinity-purified using the isolated peptides. Anti-60-kDa heat shock protein (HSP60) monoclonal antibodies were from StressGen Biotechnologies Corp. (Victoria, BC, Canada). ExTaq DNA polymerase and DNase I were from Takara (Seta, Japan). Non-ionic detergents, Nonidet P-40 (NP-40) was from Wako (Kyoto, Japan).
For immunoprecipitation, the affinity-purified anti-TFAM antibodies or control IgG were immobilized on magnetic beads (tosylactivated Dynabeads® M-280, Dynal) (0.75 µg of IgG/107 beads) according to the manufacturers instructions. Proteins were quantified using a DC protein assay kit (BioRad Laboratories). Bovine serum albumin was used as a standard. Sodium dodecylsulfatepolyacrylamide gel electrophoresis (SDSPAGE) and western blotting were performed as described previously (19).
Disruption of mitochondrial membranes
Human placental mitochondria were prepared by a combination of differential and Percoll gradient centrifugation (22). Mitochondria were solubilized essentially according to the method of Miyakawa et al. (13). All solutions contained 1x concentration of a protease inhibitor mix, CompleteMiniTM (Roche). Briefly, mitochondria (5 mg protein/ml) were solubilized in 2 ml of TES buffer (0.25 M sucrose, 10 mM TrisHCl, pH 7.0 and 1 mM EDTA) containing 0.5% NP-40. After incubation for 30 min at 4°C with shaking, the mitochondria were centrifuged for 30 min at 10 000 g at 4°C and separated into a supernatant (S1) and a pellet. The pellet was suspended in 2 ml of the same solubilizing buffer and homogenized with a PotterElvehjem homogenizer (P1). The particulate fraction P1 was centrifuged as above. The second supernatant was designated S2. The second pellet was suspended in 2 ml of buffer, homogenized as above, and designated P2. Approximately 20% of mitochondrial proteins were recovered typically from the P2 fraction. Western blotting analysis was performed using 2.5 µl of the preparations.
The P2 fraction (1.0 ml) was mixed with an equal volume of TEN buffer (10 mM TrisHCl, pH 7.0, 1 mM EDTA and 150 mM NaCl) containing 80% sucrose (w/v) and placed at the tube bottom. Then, stepwise sucrose gradients (5
30% in TEN buffer, 1 ml each) were layered on top. The gradient steps were serially reduced by 2.5% from the bottom to top. The tube was centrifuged in a Beckman SW41Ti rotor for 15 h at 39 000 r.p.m. (200 000 g) at 4°C. After centrifugation, 1 ml samples were collected from the top down. The pellet at the bottom was homogenized in 1 ml of TES/0.5% NP-40 and designated P3. For western blotting, 5 µl of each fraction was used.
Mitochondria of human U937 cells were prepared by a combination of differential and sucrose gradient centrifugation (23). The mitochondria were sonicated in TES buffer (1 mg/ml) and then centrifuged for 1 h in a Hitachi 120AT rotor at 80 000 r.p.m. (238 000 g) at 4°C. The soluble fraction was recovered. The pellet was homogenized in 1 vol of TES buffer for further analysis. The soluble fraction (200 µl) was applied to a Superose 12HR column (10 x 300 mm, Amersham) and separated using an FPLC system (Amersham) at a flow rate of 0.8 ml/min at 4°C. A fraction was collected every 1 min. For western blotting 20 µl samples were used.
Immunoprecipitation
P2 (240 µg protein) was incubated for 2 h with rotation at 4°C in 1.7 ml of a mixture containing 10 mM TrisHCl, pH 7.0, 150 mM NaCl, 100 µg/ml bovine serum albumin, 0.5% NP-40, antibody-immobilized magnetic beads (corresponding to 8 µg IgG) and 1x concentration of a protease inhibitor mix, CompleteMiniTM. The beads were pelleted on the wall of a tube using a magnet. The supernatant was mixed with an equal volume of 2x SDS sample buffer (125 mM TrisHCl, pH 6.8, 10% glycerol, 4% SDS and 2% 2-mercapthoethanol) and heated for 5 min at 95°C (IP-sup). The beads were washed three times with 1 ml of TBS/NP-40 (10 mM TrisHCl, pH 7.0, 150 mM NaCl and 0.5% NP-40). Proteins were eluted from the beads in 340 µl of 1x SDS sample buffer without 2-mercapthoethanol by heating for 5 min at 95°C. The beads were pelleted using a magnet and the resulting solution was recovered (IP-pellet). For western blotting, 40 and 4 µl of IP-sup and IP-pellet, respectively, were used.
Immunocytochemistry
HeLa MRV11 cells (23) were cultured on cover slips in 3.5 cm dishes in 2 ml of DMEM (Sigma) containing 10% fetal calf serum. The cells were incubated in the presence of 100 nM Mitotracker Red CMXRos (Molecular Probes) for 20 min. After washing with PBS (10 mM sodium phosphate, pH 7.4 and 150 mM NaCl) three times, the cells were fixed with 2 ml of acetone/methanol (50/50, v/v) for 5 min. After washing with PBS three times, the fixed cells were incubated with 250-fold diluted anti-TFAM affinity-purified antibodies (4 µg/ml) in PBS for 1 h. After washing, the cells were incubated with 250-fold diluted Alexa Fluor 488 goat anti-rabbit IgG (Molecular Probes) for 30 min. Fluorescence images were taken using a Radiance 2000 confocal laser microscope (BioRad Laboratories).
Polymerase chain reaction (PCR) detection of mtDNA
Because of difficulties with DNA extraction efficiency, we amplified an mtDNA fragment without extracting DNA. Briefly, 10 µl samples were mixed with 10 µl of 2x digestion buffer (100 mM TrisHCl, pH 8.0, 2 mM EDTA, 2.0% SDS and 2 mg/ml proteinase K) and incubated for 30 min at 55°C. After the addition of 180 µl of distilled water, the mixtures were further incubated for 10 min at 100°C to inactivate proteinase K. Then the mixtures were cooled down to room temperature, vortexed, and centrifuged for 10 min at 10 000 g. The supernatants were diluted 10-fold with distilled water (thus final samples were 200-fold diluted). One microliter of the DNA samples was used in 20 µl of the reaction mixture for amplification of an mtDNA region (nucleotides 73197603). The primers used were: mt3, ttgagaagccttcgcttcgaag; mt4, ttgcgctfcatgtgccattaag. Twenty-five cycles of DNA amplification were performed: DNA denaturing at 94°C for 30 s, annealing at 60°C for 30 s, and DNA synthesis at 72°C for 45 s for each cycle.
DNase I digestion
P2 (36 µg protein) was incubated in 50 µl of a reaction mixture containing 40 mM TrisHCl, pH 7.5, 8 mM MgCl2, 5 mM dithiothreitol, 0.5% NP-40 and 15 U DNase I for 45 min at 4°C. The reaction mixture was centrifuged for 30 min at 10 000 g at 4°C. The supernatant was mixed with an equal volume of the 2x SDS sample buffer. The pellet was solubilized with 100 µl of the 1x SDS sample buffer. Then, the samples were heated for 5 min at 95°C.
| RESULTS |
|---|
|
|
|---|
Insolubility of TFAM and mtDNA
Human placental mitochondria were treated with various concentrations of the non-ionic detergent NP-40, and then separated into supernatants and particulate fractions (Fig. 1A). mtSSB and p32, a matrix protein (21), were largely released into the soluble fraction at 0.1% NP-40 (Fig. 1A, lanes 2 and 7), indicating that the outer and inner membranes were substantially permeabilized. Nevertheless, most TFAM, like the iron sulfur protein of complex II that peripherally attaches to mitochondrial inner membranes, remained in the particulate fraction. At 0.5 and 1.0% NP-40, the iron sulfur protein was released into the supernatants and VDAC, an integral outer membrane protein, was partially released (Fig. 1A, lanes 4, 5, 9 and 10). Thus, at these concentrations, the mitochondrial membranes were substantially, if not completely, solubilized. However, under these conditions, most TFAM molecules were still recovered from the particulate fractions. To examine the effects of ionic strength, we added NaCl to the buffer (Fig. 1B). Because TFAM was not released into the supernatant by the addition of 150 mM NaCl (Fig. 1B, lanes 4 and 9), the association of TFAM with the particulate fractions was not caused by the low ionic strength. Considering that TFAM itself is a soluble protein, mitochondria seem to contain surprisingly few unbound or free TFAM molecules. A small part of mtSSB and p32 remained in the particulate fraction even at 1.0% NP-40 (Fig. 1A, lanes 5 and 10). To examine if the remaining portions were due to artificial entrapment by the pellets, we re-suspended the first 0.5% NP-40 particulate fraction (P1) in the same buffer containing 0.5% NP-40, homogenized, and separated it again into supernatant (S2) and pellet (P2). The iron sulfur protein in P1 was completely removed by this washing from P2, but the levels of mtSSB and p32 remained nearly the same (Fig. 1C, lanes 4 and 5), suggesting that this small portion of mtSSB and p32 is indeed associated with the particulate fraction. Because mtSSB is a soluble protein, the mtSSB in the particulate fractions would be bound to the single-stranded region of mitochondrial D-loops (19).
|
Association of TFAM with mtDNA
TFAM is a member of the HMG protein family and is a non-specific DNA-binding protein. Therefore, TFAM is likely to interact with mtDNA. We detected mtDNA by a PCR method. As shown in Figure 1C, most mtDNA was recovered from the particulate fractions (lanes 3 and 5 in the bottom row). Even after we further separated the NP-40 insoluble fraction by stepwise sucrose-density gradient centrifugation, TFAM and mtDNA were recovered from the same pellet fraction in 45% sucrose but not in the other fractions (data not shown). As long as we use centrifugation methods, we cannot rule out the simple co-sedimentation of TFAM and mtDNA. To confirm that TFAM and mtDNA are associated with each other, we immunoprecipitated the NP-40 insoluble fraction (P2) using anti-TFAM antibodies. Almost all TFAM was immunoprecipitated by the antibodies (Fig. 2A, lane 6). Non-specific signals were observed in lanes 35. Because those signals were observed in the absence of P2 (lanes 4 and 5) but not in the absence of IgG (lane 1), it is likely that IgG light chains detached from the beads migrated to the same position as TFAM and were detected by the secondary anti-IgG antibody. Under these conditions, most mtDNA (Fig. 2B) was co-immunoprecipitated by anti-TFAM, suggesting that most mtDNA is associated with TFAM. No immunoprecipitation of VDAC (Fig. 2A, lane 6) neglects that outer membranes were non-specifically immunoprecipitated. Digestion of mtDNA with DNase I in the particulate fraction released most TFAM into the supernatant (Fig. 3), suggesting that essentially all TFAM is associated with mtDNA.
|
|
Immunolabeling of TFAM
Immunolabeling of HeLa MRV11 cells using anti-TFAM showed a granular pattern in cytoplasm (Fig. 4a). Mitochondria were stained in a tubular form with a fluorescent dye, Mitotracker Red (Fig. 4b). The merged image shows that a large part of the dots were located within mitochondria (Fig. 4c and d). This pattern indicates that TFAM does not exist diffusely in the mitochondrial matrix. The number of dots is approximately a few hundred in one HeLa MRV11 cell (Fig. 4), and the mtDNA copy number per cell is estimated by Southern blotting to be
1000 (19). Given that each dot may represent one TFAM/mtDNA complex, such a complex would contain a few copies of mtDNA on average.
|
Sonication of mitochondria
We disrupted mitochondria by sonication without detergent. The sonication procedure, in contrast to detergent solubilization, released TFAM into the soluble fraction (200 000 g supernatant) but little of the iron sulfur protein (Fig. 5A), being consistent with the idea that the NP-40 insolubility of the TFAM/mtDNA would be via macromolecular substances that can be readily disrupted by sonication, such as DNA, cytoskeleton and membranes. The supernatant was applied to size exclusion chromatography. p32, which is known to exist as a homotrimer (24), and HSP60, a matrix protein, were detected at the positions corresponding to their expected molecular weights (Fig. 5B). Although purified TFAM exists as a monomer in solution (1), TFAM appeared mainly in the void volume (>500 kDa), but also was distributed in many fractions associated with molecular weights larger than the TFAM monomer. mtDNA fragments eluted almost in parallel with TFAM (Fig. 5B), and mtDNA in the soluble fraction was immunoprecipitated by anti-TFAM (data not shown). These results suggest that TFAM still maintains a complex with mtDNA after the disruption of mtDNA molecules by sonication.
|
| DISCUSSION |
|---|
|
|
|---|
The results in this study are the first to clearly indicate that most TFAM molecules associate with mtDNA and vice versa. The TFAM/mtDNA ratio is
900:1 in the NP-40-insoluble fraction of human placental mitochondria (19). Taken together, these results suggest that
900 molecules of TFAM are bound to one molecule of mtDNA on average. This amount of TFAM could cover the mtDNA entirely. Hence, we can no longer say that human mtDNA is naked. LSP, a promoter for transcription of the light strand (25), would be bound first and left last by TFAM, because TFAM has higher affinity to LSP than to the rest of the mtDNA molecule (2,20,26) and fully activates the LSP-specific transcription at a level where a ratio of TFAM/DNA template is
10 in the presence of mitochondrial transcription factor B (3). There fore, under the conditions where
900 molecules of TFAM are bound to mtDNA, LSP is likely to be persistently occupied by TFAM. Given that binding of TFAM to LSP initiates transcription of mtDNA, TFAM may be (at least potentially) abundant enough to constitutively and fully activate the mitochondrial transcription in a normal state where mitochondrial transcription factors B are present. This is compatible with the recent finding that TFAM levels can be substantially reduced without significant inhibition of mtDNA transcription in insect cells (27). Consistent with this, mitochondrial gene expression largely depends on the mtDNA copy number (28).
Human mtDNA is speculated to take on a nucleoid structure (17,18). However, this contention depends almost entirely on morphological observations that mtDNA is stained simply in a punctuate pattern in cells. Structural and biochemical evidence for a mammalian mtDNA nucleoid has been scarcely provided to date. In this study, we biochemically demonstrated that mtDNA associates with TFAM. The packaging of human mtDNA by TFAM may be critical for maintaining mtDNA as is packaging of yeast mtDNA by Abf2p, based on the following: (i) TFAM is able to substitute for Abf2p, a TFAM homolog of yeast, which is not supposed to significantly affect the transcription role for the maintenance of mtDNA (2); (ii) TFAM is abundant enough to cover mtDNA (19); (iii) most mtDNA molecules are associated with TFAM, and vice versa (Figs 2 and 3); (iv) the 50% reduction in TFAM in TFAM+/ mice decreases mtDNA by
50% (6). mtDNA depletion accompanies low levels of TFAM without a decrease in its mRNA level (29). Both mtDNA and TFAM could be unstable in a free form.
Both mtDNA and TFAM were recovered from the 10 000 g pellets after NP-40 solubilization (Fig. 1) and from the pellets in 45% sucrose by sucrose-density gradient centrifugation (data not shown), while the yeast mtDNAprotein complexes are recovered from the 16 000 g supernatants and from the boundary between 20 and 40% sucrose (13). This raises the possibility that TFAM/mtDNA complexes are associated with the other macromolecules under our experimental conditions. It is assumed that nuclear DNA is looped into domains by attachment to some underlying skeleton (e.g. a matrix or scaffold; for reviews, see 30). Human mtDNA is supposed to associate with mitochondrial inner membranes (31,32), though the association itself has never been convincingly evidenced. Our 0.5% NP-40 solubilization is incomplete as a large part of VDAC was recovered from the particulate fraction (Fig. 1). Under these conditions, mitochondrial outer and inner membrane proteins, monoamine oxidase and adenine nucleotide translocator, were substantially co-immunoprecipitated by anti-TFAM (identified by mass spectrometry, data not shown), suggesting that the TFAM/mtDNA complex associates with the membranes. The association with membranes may contribute to the sedimentation of the TFAM/mtDNA complex by the lower speed centrifugation. Because VDAC was not co-immunoprecipitated, it is unlikely the mitochondrial membrane fragments were non-specifically co-immunoprecipitated. The TFAM/mtDNA complex might associate with a special mitochondrial membrane domain that is resistant to NP-40 solubilization.
| ACKNOWLEDGEMENTS |
|---|
This work was supported in part by Uehara Memorial Foundation and Grants-in-Aid for Scientific Research from the Ministry of Education, Science, Technology, Sports, and Culture of Japan.
| REFERENCES |
|---|
|
|
|---|
- Fisher,R.P. and Clayton,D.A. (1988) Purification and characterization of human mitochondrial transcription factor 1. Mol. Cell. Biol., 8, 34963509.
[Abstract/Free Full Text] - Parisi,M.A., Xu,B. and Clayton,D.A. (1993) A human mitochondrial transcription activator can functionally replace a yeast mitochondrial HMG-box protein both in vivo and in vitro. Mol. Cell. Biol., 13, 19511961.
[Abstract/Free Full Text] - Falkenberg,M., Gaspari,M., Rantanen,A., Trifunovic,A., Larsson,N.G. and Gustafsson,C.M. (2002) Mitochondrial transcription factors B1 and B2 activate transcription of human mtDNA. Nature Genet., 31, 289294.[CrossRef][Web of Science][Medline]
- McCulloch,V., Seidel-Rogol,B.L. and Shadel,G.S. (2002) A human mitochondrial transcription factor is related to RNA adenine methyltransferases and binds S-adenosylmethionine. Mol. Cell. Biol., 22, 11161125.
[Abstract/Free Full Text] - Shadel,G.S. and Clayton,D.A. (1997) Mitochondrial DNA maintenance in vertebrates. Annu. Rev. Biochem., 66, 409435.[CrossRef][Web of Science][Medline]
- Larsson,N.G., Wang,J., Wilhelmsson,H., Oldfors,A., Rustin,P., Lewandoski,M., Barsh,G.S. and Clayton,D.A. (1998) Mitochondrial transcription factor A is necessary for mtDNA maintenance and embryogenesis in mice. Nature Genet., 18, 231236.[CrossRef][Web of Science][Medline]
- Bustin,M. (1999) Regulation of DNA-dependent activities by the functional motifs of the high-mobility-group chromosomal proteins. Mol. Cell. Biol., 19, 52375246.
[Free Full Text] - Wolffe,A.P. (1994) Architectural transcription factors. Science, 264, 11001103.
[Free Full Text] - Wolffe,A.P. (1999) Architectural regulations and Hmg1. Nature Genet., 22, 215217.[CrossRef][Web of Science][Medline]
- Diffley,J.F.X. and Stillman,B. (1992) DNA binding properties of an HMG1-related protein from yeast mitochondria. J. Biol. Chem., 267, 33683374.
[Abstract/Free Full Text] - Diffley,J.F.X. and Stillman,B. (1991) A close relative of the nuclear, chromosomal high-mobility group protein HMG1 in yeast mitochondria. Proc. Natl Acad. Sci. USA, 88, 78647868.
[Abstract/Free Full Text] - Megraw,T.L. and Chae,C.B. (1993) Functional complementarity between the HMG-like yeast mitochondrial histone HM and bacterial histon-like protein HU. J. Biol. Chem., 268, 1275812763.
[Abstract/Free Full Text] - Miyakawa,I., Sando,N., Kawano,S., Nakamura,S. and Kuroiwa,T. (1987) Isolation of morphorogically intact mitochondrial nucleoids from the yeast, Saccharomyces cerevisiae. J. Cell Sci., 88, 431439.
[Abstract/Free Full Text] - Newman,S.M., Zelenaya-Toroitskaya,O., Perlman,P.S. and Butow,R.A. (1996) Analysis of mitochondrial DNA nucleoid in wild-type and mutant strain of Saccharomyces cervisiae that lacks the mitochondrial HMG box protein Abf2p. Nucleic Acids Res., 24, 386393.
[Abstract/Free Full Text] - Kaufman,B.A., Newman,S.M., Hallberg,R.L., Slaughter,C.A., Perlman,P.S. and Butow,R.A. (2000) In organello formaldehyde crosslinking of proteins to mtDNA: identification of bifunctional proteins. Proc. Natl Acad. Sci. USA, 97, 77727777.
[Abstract/Free Full Text] - Sasaki,N., Sakai,A., Kawano,S., Kuroiwa,H. and Kuroiwa,T. (1998) DNA synthesis in isolated mitochondrial nucleoids from plasmodia of Physarum polycephalum. Protoplasma, 203, 221231.[CrossRef]
- Satoh,M. and Kuroiwa,T. (1991) Organization of multiple nucleoids and DNA molecules in mitochondria of a human cell. Exp. Cell Res., 196, 137140.[CrossRef][Web of Science][Medline]
- Spelbrink,J.N., Li,F.Y., Tiranti,V., Nikali,K., Yuan,Q.P., Tariq,M., Wanrooij,S., Garrido,N., Comi,G., Morandi,L., Santoro,L., Toscano,A., Fabrizi,G.M., Somer,H., Croxen,R., Beeson,D., Poulton,J., Suomalainen,A., Jacobs,H.T., Zeviani,M. and Larsson,C. (2001) Human mitochondrial DNA deletions associated with mutations in the gene encoding Twinkle, a phage T7 gene 4-like protein localized in mitochondria. Nature Genet., 28, 223231.[CrossRef][Web of Science][Medline]
- Takamatsu,C., Umeda,S., Ohsato,T., Ohno,T., Abe,Y., Fukuoh,A., Shinagawa,H., Hamasaki,N. and Kang,D. (2002) Regulation of mitochondrial D-loops by transcription factor A and single-stranded DNA-binding protein. EMBO Rep., 3, 451456.[CrossRef][Web of Science][Medline]
- Ohno,T., Umeda,S., Hamasaki,N. and Kang,D. (2000) Binding of human mitochondrial transcription factor A, an HMG box protein, to a four-way DNA junction. Biochem. Biophys. Res. Commun., 271, 492498.[CrossRef][Web of Science][Medline]
- Muta,T., Kang,D., Kitajima,S. and Hamasaki,N. (1997) p32 protein, a splicing factor 2-associated protein, is localized in mitochondrial matrix and is functionally important in maintaining oxidative phosphorylation. J. Biol. Chem., 272, 2436324370.
[Abstract/Free Full Text] - Gasnier,F., Rousson,R., Lerme,F., Vaganay,E., Louisot,P. and Gateau-Roesch,O. (1993) Use of Percoll gradients for isolation of human placenta mitochondria suitable for investigating outer membrane proteins. Anal. Biochem., 212, 173178.[CrossRef][Web of Science][Medline]
- Kang,D., Nishida,J., Iyama,A., Nakabeppu,Y., Furuichi,M., Fujiwara,T., Sekiguchi,M. and Takeshige,K. (1995) Intracellular localization of 8-oxo-dGTPase in human cells, with special reference to the role of the enzyme in mitochondria. J. Biol. Chem., 270, 1465914665.
[Abstract/Free Full Text] - Jiang,J., Zhang,Y., Krainer,A.R. and Xu,R.M. (1999) Crystal structure of human p32, a doughnut-shaped acidic mitochondrial matrix protein. Proc. Natl Acad. Sci. USA, 96, 35723577.
[Abstract/Free Full Text] - Clayton,D.A. (1991) Replication and transcription of vertebrate mitochondrial DNA. Annu. Rev. Cell. Biol., 7, 453478.[CrossRef][Web of Science][Medline]
- Fisher,R.P., Lisowsky,T. and Breen,G.A. (1991) A rapid, efficient method for purifying DNA-binding proteins. J. Biol. Chem., 266, 91539160.
[Abstract/Free Full Text] - Goto,A., Matsushima,Y., Kadowaki,T. and Kitagawa,Y. (2001) Drosophila mitochondrial transcription factor A (d-TFAM) is dispensable for the transcription of mitochondrial DNA in Kc167 cells. Biochem. J., 354, 243248.[CrossRef][Web of Science][Medline]
- Williams,R.S. (1986) Mitochondrial gene expression in mammalian striated muscle. J. Biol. Chem., 261, 1239012394.
[Abstract/Free Full Text] - Larsson,N., Oldfors,A., Holme,E. and Clayton,D.A. (1994) Low levels of mitochondrial transcription factor A in mitochondrial DNA depletion. Biochem. Biophys. Res. Commun., 200, 13741381.[CrossRef][Web of Science][Medline]
- Getzenberg,R.H., Pienta,K.J., Ward,W.S. and Coffey,D.S. (1991) Nuclear structure and the three-dimensional organization of DNA. J. Cell. Biochem., 47, 28999.[CrossRef][Web of Science][Medline]
- Albring,M., Griffith,J. and Attardi,G. (1977) Association of a protein structure of probable membrane derivation with HeLa cell mitochondrial DNA near its origin of replication. Proc. Natl Acad. Sci. USA, 74, 13481352.
[Abstract/Free Full Text] - Jackson,D.A., Bartlett,J. and Cook,P.R. (1996) Sequences attaching loops of nuclear and mitochondrial DNA to underlying structures in human cells: the role of transcription units. Nucleic Acids Res., 24, 12121219.
[Abstract/Free Full Text]
This article has been cited by other articles:
![]() |
H. Tsutsui, S. Kinugawa, and S. Matsushima Mitochondrial oxidative stress and dysfunction in myocardial remodelling Cardiovasc Res, February 15, 2009; 81(3): 449 - 456. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Hayashi, M. Yoshida, M. Yamato, T. Ide, Z. Wu, M. Ochi-Shindou, T. Kanki, D. Kang, K. Sunagawa, H. Tsutsui, et al. Reverse of Age-Dependent Memory Impairment and Mitochondrial DNA Damage in Microglia by an Overexpression of Human Mitochondrial Transcription Factor A in Mice J. Neurosci., August 20, 2008; 28(34): 8624 - 8634. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. F. Bogenhagen, D. Rousseau, and S. Burke The Layered Structure of Human Mitochondrial DNA Nucleoids J. Biol. Chem., February 8, 2008; 283(6): 3665 - 3675. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. M. Facucho-Oliveira, J. Alderson, E. C. Spikings, S. Egginton, and J. C. St. John Mitochondrial DNA replication during differentiation of murine embryonic stem cells J. Cell Sci., November 15, 2007; 120(22): 4025 - 4034. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. A. Kaufman, N. Durisic, J. M. Mativetsky, S. Costantino, M. A. Hancock, P. Grutter, and E. A. Shoubridge The Mitochondrial Transcription Factor TFAM Coordinates the Assembly of Multiple DNA Molecules into Nucleoid-like Structures Mol. Biol. Cell, September 1, 2007; 18(9): 3225 - 3236. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Cotney, Z. Wang, and G. S. Shadel Relative abundance of the human mitochondrial transcription system and distinct roles for h-mtTFB1 and h-mtTFB2 in mitochondrial biogenesis and gene expression Nucleic Acids Res., June 18, 2007; (2007) gkm424v2. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Amaral, J. Ramalho-Santos, and J. C. St John The expression of polymerase gamma and mitochondrial transcription factor A and the regulation of mitochondrial DNA content in mature human sperm Hum. Reprod., June 1, 2007; 22(6): 1585 - 1596. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Ohgaki, T. Kanki, A. Fukuoh, H. Kurisaki, Y. Aoki, M. Ikeuchi, S. H. Kim, N. Hamasaki, and D. Kang The C-terminal Tail of Mitochondrial Transcription Factor A Markedly Strengthens its General Binding to DNA J. Biochem., February 1, 2007; 141(2): 201 - 211. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. He, C.-C. Mao, A. Reyes, H. Sembongi, M. Di Re, C. Granycome, A. B. Clippingdale, I. M. Fearnley, M. Harbour, A. J. Robinson, et al. The AAA+ protein ATAD3 has displacement loop binding properties and is involved in mitochondrial nucleoid organization J. Cell Biol., January 16, 2007; 176(2): 141 - 146. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. L. O. Pohjoismaki, S. Wanrooij, A. K. Hyvarinen, S. Goffart, I. J. Holt, J. N. Spelbrink, and H. T. Jacobs Alterations to the expression level of mitochondrial transcription factor A, TFAM, modify the mode of mitochondrial DNA replication in cultured human cells Nucleic Acids Res., November 6, 2006; 34(20): 5815 - 5828. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Wang and D. F. Bogenhagen Human Mitochondrial DNA Nucleoids Are Linked to Protein Folding Machinery and Metabolic Enzymes at the Mitochondrial Inner Membrane J. Biol. Chem., September 1, 2006; 281(35): 25791 - 25802. [Abstract] [Full Text] [PDF] |
||||
![]() |
E.C. Spikings, J. Alderson, and J.C.St. John Transmission of mitochondrial DNA following assisted reproduction and nuclear transfer Hum. Reprod. Update, July 1, 2006; 12(4): 401 - 415. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Kajitani, H. Yamaguchi, Y. Dan, M. Furuichi, D. Kang, and Y. Nakabeppu MTH1, an Oxidized Purine Nucleoside Triphosphatase, Suppresses the Accumulation of Oxidative Damage of Nucleic Acids in the Hippocampal Microglia during Kainate-Induced Excitotoxicity J. Neurosci., February 8, 2006; 26(6): 1688 - 1698. [Abstract] [Full Text] [PDF] |
||||
![]() |
X. Cheng, T. Kanki, A. Fukuoh, K. Ohgaki, R. Takeya, Y. Aoki, N. Hamasaki, and D. Kang PDIP38 Associates with Proteins Constituting the Mitochondrial DNA Nucleoid J. Biochem., December 1, 2005; 138(6): 673 - 678. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Kuroda, K. Nakagawa, T. Yamasaki, K.-i. Nakamura, R. Takeya, F. Kuribayashi, S. Imajoh-Ohmi, K. Igarashi, Y. Shibata, K. Sueishi, et al. The superoxide-producing NAD(P)H oxidase Nox4 in the nucleus of human vascular endothelial cells Genes Cells, December 1, 2005; 10(12): 1139 - 1151. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Ryu, J. Lee, S. Impey, R. R. Ratan, and R. J. Ferrante Antioxidants modulate mitochondrial PKA and increase CREB binding to D-loop DNA of the mitochondrial genome in neurons PNAS, September 27, 2005; 102(39): 13915 - 13920. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Ikeuchi, H. Matsusaka, D. Kang, S. Matsushima, T. Ide, T. Kubota, T. Fujiwara, N. Hamasaki, A. Takeshita, K. Sunagawa, et al. Overexpression of Mitochondrial Transcription Factor A Ameliorates Mitochondrial Deficiencies and Cardiac Failure After Myocardial Infarction Circulation, August 2, 2005; 112(5): 683 - 690. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. D. Taylor, H. Zhang, J. S. Eaton, M. S. Rodeheffer, M. A. Lebedeva, T. W. O'Rourke, W. Siede, and G. S. Shadel The Conserved Mec1/Rad53 Nuclear Checkpoint Pathway Regulates Mitochondrial DNA Copy Number in Saccharomyces cerevisiae Mol. Biol. Cell, June 1, 2005; 16(6): 3010 - 3018. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Matsushima, C. Adan, R. Garesse, and L. S. Kaguni Drosophila Mitochondrial Transcription Factor B1 Modulates Mitochondrial Translation but Not Transcription or DNA Copy Number in Schneider Cells J. Biol. Chem., April 29, 2005; 280(17): 16815 - 16820. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Kanki, K. Ohgaki, M. Gaspari, C. M. Gustafsson, A. Fukuoh, N. Sasaki, N. Hamasaki, and D. Kang Architectural Role of Mitochondrial Transcription Factor A in Maintenance of Human Mitochondrial DNA Mol. Cell. Biol., November 15, 2004; 24(22): 9823 - 9834. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Matsushima, R. Garesse, and L. S. Kaguni Drosophila Mitochondrial Transcription Factor B2 Regulates Mitochondrial DNA Copy Number and Transcription in Schneider Cells J. Biol. Chem., June 25, 2004; 279(26): 26900 - 26905. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. I. Ekstrand, M. Falkenberg, A. Rantanen, C. B. Park, M. Gaspari, K. Hultenby, P. Rustin, C. M. Gustafsson, and N.-G. Larsson Mitochondrial transcription factor A regulates mtDNA copy number in mammals Hum. Mol. Genet., May 1, 2004; 13(9): 935 - 944. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Sasaki, H. Kuroiwa, C. Nishitani, H. Takano, T. Higashiyama, T. Kobayashi, Y. Shirai, A. Sakai, S. Kawano, K. Murakami-Murofushi, et al. Glom Is a Novel Mitochondrial DNA Packaging Protein in Physarum polycephalum and Causes Intense Chromatin Condensation without Suppressing DNA Functions Mol. Biol. Cell, December 1, 2003; 14(12): 4758 - 4769. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. F. Bogenhagen, Y. Wang, E. L. Shen, and R. Kobayashi Protein Components of Mitochondrial DNA Nucleoids in Higher Eukaryotes Mol. Cell. Proteomics, November 1, 2003; 2(11): 1205 - 1216. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. L. Garstka, W. E. Schmitt, J. Schultz, B. Sogl, B. Silakowski, A. Perez-Martos, J. Montoya, and R. J. Wiesner Import of mitochondrial transcription factor A (TFAM) into rat liver mitochondria stimulates transcription of mitochondrial DNA Nucleic Acids Res., September 1, 2003; 31(17): 5039 - 5047. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||




















